Gene HD-Zip for judging nitrogen tolerance of wheat under nitrogen deficiency condition and application of gene HD-Zip

Abstract

The invention provides a gene HD-Zip for judging nitrogen tolerance of wheat under a nitrogen deficiency condition and application of the gene HD-Zip, and belongs to the technical field of biological agriculture. The gene HD-Zip related to the nitrogen deficiency tolerance character is obtained through the combination of normal nitrogen and nitrogen deficiency condition stress treatment of natural wheat varieties around the world and whole genome association analysis and verification. The HD-Zip gene is in down-regulated expression in response to wheat nitrogen deficiency stress. The HD-Zip gene provided by the invention can be used for distinguishing wheat tolerance varieties and sensitive varieties under the nitrogen deficiency condition, screening wheat nitrogen deficiency tolerance varieties and evaluating the nitrogen content condition in soil for planting wheat.

Description

Technical Field

[0001] The present invention belongs to the technical field of bio-agriculture, and in particular relates to a gene HD-Zip for judging nitrogen tolerance of wheat under nitrogen deficiency conditions and an application thereof. Background Art

[0002] Wheat (Triticum aestivum L.), as an important staple crop, plays a vital role in the global food supply. High-yield wheat production depends on the input of fertilizers. Among fertilizers, nitrogen is the main nutrient limiting productivity in many ecosystems, as wheat grains (number, size, and protein content) are the main driver of high nitrogen demand. The extensive use of nitrogen fertilizers in wheat production can easily lead to a lack of balance between nitrogen supply and demand. However, wheat plants grown under high nitrogen conditions have relatively low nitrogen use efficiency, suggesting that wheat can use available nitrogen more efficiently and the potential to reduce nitrogen demand while maintaining high yields has not yet been realized. Summary of the Invention

[0003] In view of this, the object of the present invention is to provide a wheat HD-Zip gene having the characteristic of responding to nitrogen deficiency stress, which is used to judge the tolerance or sensitivity of wheat based on its significant differential expression under nitrogen deficiency conditions.

[0004] The present invention provides a wheat gene HD-Zip, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0005] The present invention provides an application of detecting the relative expression level of the HD-Zip gene in judging the tolerance of wheat varieties under nitrogen deficiency conditions.

[0006] Preferably, in the method for judging the tolerance of wheat varieties under nitrogen deficiency conditions, when the relative expression level of the HD-Zip gene in the test sample is downregulated compared with the reference sample, it indicates that the test sample is a nitrogen deficiency-sensitive wheat variety; if there is no significant difference, the test sample is judged to be a nitrogen deficiency-tolerant wheat variety.

[0007] The present invention provides an application of detecting the relative expression level of the HD-Zip gene in distinguishing nitrogen deficiency-tolerant wheat varieties from nitrogen deficiency-sensitive wheat varieties.

[0008] Preferably, the method for distinguishing nitrogen deficiency-tolerant wheat varieties from nitrogen deficiency-sensitive wheat varieties is that when the relative expression level of the HD-Zip gene in the test sample is downregulated compared with the reference sample, the test sample is judged to be a nitrogen deficiency-sensitive wheat variety; if there is no significant difference, the test sample is judged to be a nitrogen deficiency-tolerant wheat variety.

[0009] The present invention provides an application of detecting the relative expression level of the HD-Zip gene in screening nitrogen deficiency-tolerant wheat varieties.

[0010] Preferably, the method for screening nitrogen deficiency-tolerant wheat varieties screens wheat varieties whose relative expression levels of the HD-Zip gene have no significant difference compared with reference samples as breeding materials.

[0011] Preferably, the reference samples include at least one of the following: Xuzhou No. 25, Azulon, Chuanmai No. 41, Shijiazhuang No. 8 and Shaanmai No. 512.

[0012] Preferably, the nitrogen deficiency includes a condition where the nitrogen content in the wheat growth environment is lower than 0.4 mM.

[0013] Preferably, the reagent for detecting the relative expression level of the HD-Zip gene includes qPCR primers;

[0014] The qPCR primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 3.

[0015] The present invention provides a wheat HD-Zip gene, the nucleotide sequence of which is shown in SEQ ID NO: 1. The present invention screened out the gene HD-Zip that responds to nitrogen deficiency stress by treating natural wheat varieties from all over the world under normal nitrogen and nitrogen deficiency conditions in combination with genome-wide association analysis (GWAS), and verified by qPCR that the expression levels of the HD-Zip gene in wheat extreme tolerance lines and sensitive lines showed significant differences, and that the expression was significantly downregulated in the sensitive lines. This indicates that the HD-Zip gene is downregulated in response to wheat nitrogen deficiency stress. It can be seen that the HD-Zip gene provided by the present invention can be used to distinguish between wheat tolerant and sensitive varieties under nitrogen deficiency conditions, screen wheat nitrogen deficiency tolerant varieties, and evaluate the nitrogen content in the soil where wheat is grown. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Figure 1 shows the statistical analysis of wheat seedling traits under different nitrogen levels in the greenhouse; a shows plant phenotypes under normal nitrogen (control) and nitrogen deficiency (treatment) conditions (15 days), with a scale bar of 10 cm; b shows the correlation matrix of six phenotypes related to nitrogen tolerance under normal nitrogen and nitrogen deficiency conditions. Note: All Pearson correlation coefficients shown in the matrix are significant at different levels; blank blocks indicate no significant correlation between the corresponding pairs; c–h show the six phenotypic measurements of 284 wheat varieties under two different conditions, including stem dry weight (c), root dry weight (d), root-to-shoot ratio (e), stem nitrogen accumulation (f), root nitrogen accumulation (g), and total nitrogen accumulation (h);

[0017] Figure 2The results of the analysis of wheat related traits under nitrogen deficiency conditions are shown in Figure 2. (a) is the frequency distribution result of relative stem dry weight; (b) is the frequency distribution result of relative root dry weight; (c) is the frequency distribution result of relative root-to-shoot ratio; (d) is the frequency distribution result of relative stem nitrogen accumulation; (e) is the frequency distribution result of relative root nitrogen accumulation; (f) is the frequency distribution result of relative total nitrogen accumulation; Note: Correlation analysis between relative aboveground traits of wheat, including relative aboveground dry weight (RSDW), relative root-to-shoot ratio (RRS), relative aboveground nitrogen accumulation (RSN) and relative total nitrogen accumulation (RTN) (g); Correlation analysis between relative and root traits of wheat, including relative root dry weight (RRDW), relative root-to-shoot ratio, relative root nitrogen accumulation (RRN) and relative total nitrogen accumulation (RTN) (h);

[0018] Figure 3 The results of genome-wide association analysis 1, (a) to (c) are QQ plots and Manhattan plots of three relative traits related to nitrogen deficiency, including RSDW (a), RRDW (b), and RRS (c); the dotted line indicates the significance threshold (p#1×10 3 );

[0019] Figure 4 The results of genome-wide association analysis 1, (a) to (c) are QQ plots and Manhattan plots of three relative traits related to nitrogen deficiency, including RSN (a), RRN (b), and RTN (c); the dotted line indicates the significance threshold (p#1×10 3 );

[0020] Figure 5 The Venn diagram analysis results of genes related to wheat root nitrogen tolerance identified by GWAS;

[0021] Figure 6 The morphological characteristics of the extremely sensitive strain W101 and the extremely tolerant strain W199 after nitrogen deficiency treatment;

[0022] Figure 7 These are the related gene expression results in extreme nitrogen deficiency tolerant and sensitive wheat lines. DETAILED DESCRIPTION

[0023]

[0024] In an embodiment of the present invention, 284 natural wheat varieties were subjected to normal nitrogen and nitrogen deficiency concentration stress treatments. The results showed that nitrogen deficiency stress significantly inhibited the aboveground growth and nitrogen accumulation of wheat plants, but promoted root growth. A related gene that improves the nitrogen utilization efficiency of wheat under nitrogen deficiency conditions was screened out by genome-wide association analysis (GWAS), namely the HD-Zip gene, numbered TraesCS5A03G0110200, Chinese_Spring1.0_chr5A:39845263-39851540. The expression level of the HD-Zip gene in strains that are extremely sensitive and extremely tolerant to nitrogen deficiency stress was verified by RT-qPCR technology. The results showed that the HD-Zip gene was down-regulated in extremely sensitive strains, which was consistent with the results of genome-wide association analysis. It shows that the HD-Zip gene responds to wheat nitrogen deficiency stress treatment by down-regulating expression. In the present invention, the nitrogen deficiency preferably includes conditions where the nitrogen content in the wheat growth environment is less than 0.4 mM. In the present embodiment, a culture medium with a nitrogen content of 0.4 mM in the cultivation environment was used as a nitrogen deficiency stress treatment, while a culture medium with a nitrogen content of 4 mM was used as a normal growth condition.

[0025] The present invention provides an application of detecting the relative expression level of the HD-Zip gene in judging the tolerance of wheat varieties under nitrogen deficiency conditions.

[0026] In the present invention, the reagents for detecting the relative expression level of the HD-Zip gene preferably include qPCR primers. The qPCR primers preferably include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 2 (CTGCTGTCGAATGGGTGC) and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 3 (CGATAGTTCCACCATTACCC). The qPCR reaction system preferably includes: 50 ng of cDNA template, 0.4 μl of each forward / reverse primer (10 μM), a 10 μl mix, and ddH2O to 20 μl. The qPCR reaction procedure preferably includes a pre-denaturation at 94°C for 30 seconds, followed by 45 cycles of denaturation at 94°C for 5 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 10 seconds, followed by melting curve analysis, with fluorescence signals collected every 0.5°C from 60°C to 95°C for 5 seconds per degree Celsius.

[0027] In the present invention, the method for determining the tolerance of a wheat variety to nitrogen deficiency conditions is preferably such that when the relative expression level of the HD-Zip gene in the test sample is significantly downregulated compared to that in the reference sample, the test sample is determined to be a nitrogen deficiency-sensitive wheat variety; if there is no significant difference, the test sample is determined to be a nitrogen deficiency-tolerant wheat variety. The reference samples are nitrogen deficiency-tolerant wheat varieties, such as Xuzhou No. 25, Azulon, Chuanmai No. 41, Shijiazhuang No. 8, and Shanmai No. 512.

[0028] The present invention provides an application of detecting the relative expression level of the HD-Zip gene in distinguishing nitrogen deficiency-tolerant wheat varieties from nitrogen deficiency-sensitive wheat varieties.

[0029] The method for distinguishing nitrogen deficiency-tolerant wheat varieties from nitrogen deficiency-sensitive wheat varieties is to determine that the test sample is a nitrogen deficiency-sensitive wheat variety when the relative expression level of the HD-Zip gene in the test sample is downregulated compared to a reference sample. The reference sample preferably includes at least one of the following: Xuzhou No. 25, Azulon, Chuanmai No. 41, Shijiazhuang No. 8, and Shanmai No. 512.

[0030] The present invention provides an application of detecting the relative expression level of the HD-Zip gene in screening nitrogen deficiency-tolerant wheat varieties.

[0031] In the present invention, the method for screening nitrogen deficiency-tolerant wheat varieties involves selecting wheat varieties whose relative expression levels of the HD-Zip gene are not significantly different from those of reference varieties as breeding materials. The reference varieties preferably include at least one of the following: Xuzhou No. 25, Azulon, Chuanmai No. 41, Shijiazhuang No. 8, and Shaanmai No. 512.

[0032] In the present invention, the method for distinguishing nitrogen deficiency-tolerant wheat varieties from nitrogen deficiency-sensitive wheat varieties is preferably such that when the relative expression level of the HD-Zip gene in the test sample is downregulated compared to that in the reference sample, the test sample is identified as a nitrogen deficiency-sensitive wheat variety; if there is no significant difference, the test sample is identified as a nitrogen deficiency-tolerant wheat variety. The reference sample is the same as that in the above technical solution and will not be further described here.

[0033] The present invention provides an application of detecting the relative expression level of the HD-Zip gene in screening nitrogen deficiency-tolerant wheat varieties.

[0034] In the present invention, the method for screening nitrogen deficiency tolerant wheat varieties preferably involves screening wheat varieties with no significant difference in relative expression level of the HD-Zip gene compared to a reference sample as breeding materials. The reference sample is the same as the above technical solution and will not be described in detail here.

[0035] The following describes in detail the gene HD-Zip for determining nitrogen tolerance of wheat under nitrogen deficiency conditions and its application provided by the present invention in conjunction with the examples. However, these examples should not be construed as limiting the scope of protection of the present invention.

[0036] Example 1

[0037] A method for screening genes related to nitrogen deficiency tolerance in wheat

[0038] 1. Materials and Methods

[0039] 1.1 Plant materials and growth conditions

[0040] A total of 284 common wheat germplasms from all over the world were collected (see Table 1).

[0041] Table 1 Summary of information on 284 wheat germplasms

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051] Seeds of all wheat lines were sterilized with 3% hydrogen peroxide for 30 min, rinsed three times with tap water, and then transferred to a sand bed. After germination, 7-day-old seedlings (two-leaf stage) were despermed and transplanted into a hydroponic solution prepared in distilled water (1 mM ammonium sulfate, 1 mM potassium nitrate, 1.5 mM calcium chloride, 1 mM magnesium sulfate, 0.5 mM potassium dihydrogen phosphate, 0.046 mM H3BO3, 9.6 μM manganese chloride·4H2O, 0.01 mM (NH4)6Mo7O 24Plants were incubated in a nutrient solution containing 4 mM nitrogen (N) for 7 days (4H2O, 4 μM ZnSO4·7H2O, 0.4 μM CuSO4·5H2O, and 0.095 mMFe(III)-EDTA, pH 5.8). Over the next 15 days, the plants were divided into two treatments: a control culture solution containing 4 mM nitrogen (N) and a nitrogen-deficient culture solution containing 0.4 mM nitrogen (N). The culture solution was refreshed every 3 days.

[0052] In the experiment, wheat was grown in a natural light greenhouse at the Zhongyuan Research Institute of Zhejiang University in Zhengzhou, China, with a day / night temperature of 22 / 18°C.

[0053] 1.2 Dry weight and nutritional analysis

[0054] Each wheat plant was photographed and divided into stem and root, and then the plants were treated at 105°C for 30 minutes and dried in an oven at 80°C to constant weight. The dry weight of the stem and root was recorded. The nitrogen content of the raw material was determined by the Kjeldahl method. About 0.3g of the raw material was added to a dry 100ml Kjeldahl nitrogen flask and hydrolyzed in 15mL of concentrated sulfuric acid (H2SO4) solution containing 0.4g CuSO4 and 4g K2SO2 in a heating block at 420°C for 2h. After cooling, 20ml of H2O was added to the hydrolyzate, which was then titrated and neutralized to measure the amount of nitrogen in the raw material.

[0055] Root to shoot ratio (RS) = root dry weight (RDW) / stem dry weight (SDW) Formula I;

[0056] Total nitrogen accumulation (TN) = aboveground nitrogen accumulation (SN) + root nitrogen accumulation (RN) Formula II

[0057] Each treatment was replicated three times, and three plants were randomly selected. Correlations between traits were calculated using SPSS 21.0 (IBM, Armonk, NY, USA), and treatment average phenotypes were compared using t-tests.

[0058] The nitrogen deficiency tolerance index is used to characterize the relative changes in SDW, RDW, RS, SN, RN, and TN (labeled as RSDW, RRDW, RRS, RSN, RRN, and RTN, respectively) under nitrogen deficiency stress. The relative change of each trait is calculated by dividing the value under nitrogen deficiency treatment / normal treatment, for example, RSDW = (SDW (control) - SDW (nitrogen deficiency)) / SDW (control).

[0059] 1.3 Genome-wide association study (GWAS)

[0060] Capital Bio genotyped all 284 accessions using a wheat 90K single nucleotide polymorphism (SNP; Illumina, 81,587 SNPs) array. SNPs used for subsequent GWAS analysis were obtained after quality control (minor allele frequency > 0.05, missing data < 20%). The physical locations of the SNPs were obtained from the International Wheat Genome Sequencing Consortium website (IWGSC, http: / / www.wheatgenome.org / IWGSC v1.1).

[0061] The population structure was analyzed using the admixture 1.3.0 program. ADMIXTURE was run with K = 1 to K = 20 clusters to determine the optimal value of K. The R package APE was used to create phylogenetic trees to observe the genetic relationships of the samples and eliminate outliers.

[0062] TASSEL v5.2 software was used to perform a genome-wide association analysis based on GLM for the nitrogen deficiency tolerance index of the phenotypic traits. In this example, the P value indicates whether the SNP is associated with the corresponding trait, and R 2 Indicates the phenotypic variation explained by the marker.

[0063] Because the Bonferroni-Holm correction for multiple testing (α = 0.05) (Holm, 1979) was too conservative and no significant marker-trait association (MTA) was detected using this criterion, markers with an adjusted -log10 (P value) ≥ 3.0 were selected as significantly associated markers. In addition, Manhattan and QQ plots were drawn using the CM plot package implemented in R3.6.

[0064] 1.4 Candidate gene analysis and annotation

[0065] Candidate genes were identified as all genes located within the region surrounding the significant SNP (±50 kb) at each significant locus in the IWGSC3 (IWGSC v1.1) physical location. wGRN (http: / / wheat.cau.edu.cn / wGRN), an interactive web server, was then used to accurately prioritize candidate genes associated with nitrogen deficiency-responsive traits in genome-wide association studies. By inputting QTLs from the GWAS results and homologous genes previously identified as involved in rice nitrogen metabolism, genes associated with improved nitrogen use efficiency in wheat under nitrogen deficiency conditions were discovered.

[0066] 2. Results

[0067] 2.1 Phenotypic responses of nitrogen-responsive traits to different environments

[0068] Six agronomic indices of nitrogen deficiency tolerance were observed and calculated in the experiment, including SDW, RDW, RS, SN, RN, and TN. All traits showed wide variation among 284 wheat accessions. Continuous variation was observed in all traits, and their distributions were approximately normal. Plants exposed to normal nitrogen (control) and nitrogen deficiency (treatment) conditions (15 days) at the seedling stage ( Figure 1 (a)). All traits except RRDW and RRS decreased under nitrogen deficiency compared with the control. The mean values ​​of SDW, SN, RN, and TN decreased by 35.5%, 67.5%, 32.2%, and 61.7%, respectively, under nitrogen deficiency. In contrast, the mean values ​​of RRDW and RRS increased by 41.8% and 121.1%, respectively, under nitrogen deficiency. Figure 1 In addition, significant positive correlations were observed between the data for all six nitrogen deficiency-related traits under both nitrogen conditions ( Figure 2 (a)-(f)), indicating that most of the phenotypic variation comes from genetic factors.

[0069] In order to further explore the relationships between the six nitrogen deficiency-related traits under different nitrogen conditions, a correlation matrix ( Figure 1 (b)). The results showed that SDW and SN were significantly positively correlated, with Pearson correlation coefficients (r) of 0.727 and 0.731 under normal and nitrogen-deficient conditions, respectively. Furthermore, a significant positive correlation was observed between RDW and RN data under both nitrogen conditions. These results suggest that SDW and RDW can serve as key phenotypic indicators for characterizing nitrogen use efficiency in wheat. RS was significantly negatively correlated with both SN and TN under different nitrogen levels (p < 0.01), indicating that an increase in the root-to-shoot ratio may significantly reduce nitrogen use efficiency in wheat.

[0070] 2.2 Growth responses of wheat lines to nitrogen deficiency stress

[0071] To identify the responses of extreme wheat lines to nitrogen deficiency, relative traits (RSDW, RRDW, RRS, RSN, RRN, and RTN) were used as composite selection indices under different nitrogen levels.

[0072] Under nitrogen deficiency stress, stem weight and nitrogen accumulation were reduced in all wheat lines compared with the control ( Figure 2 However, approximately 94% of the lines showed an increase in root dry weight in response to nitrogen deficiency. In addition, more than 90% of the lines showed a decrease in root nitrogen accumulation compared to the control.

[0073] Furthermore, by selecting lines with the top 15% relative stem and root biomass indices under nitrogen deficiency, W268 (CA1119), W193 (Emai W23), W101 (Afu), W94 (Aca601), and W4 (Fengchan 3) were identified as extremely nitrogen-deficiency-sensitive lines. Meanwhile, W299 (Azulon), W187 (Chuanmai 41), W110 (Shijiazhuang 8), W53 (Shaanmai 512), and W199 (Xuzhou 25) were more tolerant to nitrogen deficiency, as the bottom 15% relative stem and root biomass indices were responses to nitrogen deficiency stress. Subsequently, ten wheat lines exhibiting extreme nitrate responsiveness were used as material for further candidate gene analysis.

[0074] In addition, the correlation analysis between the nitrogen deficiency response traits of seedlings under nitrogen deficiency stress was calculated, and the correlation coefficients of the six traits were given. Multivariate analysis showed that under nitrogen deficiency conditions, there was a robust covariation (p < 0.01) between stem-related parameters (RSDW, RSN) and root system structure indicators (RRDW, RRN) ( Figure 2 (g)-(h)).

[0075] 2.3 Marker-trait association (MTAs) analysis

[0076] A genome-wide association analysis based on GLM was performed on the nitrogen deficiency tolerance index of phenotypic traits. A total of 70 SNPs (MTA) were identified that were significantly associated with six nitrogen deficiency tolerance-related traits (including RSDW, RRDW, RRS, RSN, RRN, and RTN) at a P value of 0.001 (log10 value of 3) ( Figure 3 and Figure 4 ).

[0077] The largest number of loci were found in genome A (33) and genome B (22), while 15 loci were found in genome D. Of these loci, 16 were detected by RSDW, 21 by RRDW, 15 by RRS, 18 by RSN, 9 by RRN, and 5 by RTN.

[0078] Notably, nine loci (BobWhite_c19327_314, BobWhite_c47740_85, BobWhite_c8037_1135, BS00106306_51, Excalibur_c3004_250, Excalibour_rep_c70996_188, IAAV8527, Kukri_c17417_291, Tdurum_contig46954_406, wsnp_CAP11_rep_c4111_1943520, and wsnp_Ra_c38873-46699852) were identified as having two or more traits, demonstrating the presence of pleiotropic regions. Furthermore, QQ plots for all traits indicated that false positives in this GWAS were adequately controlled.

[0079] As a result, 67, 27, 39, 48, 61 and 10 genes were identified using RRDW, RRN, RRS, RSDW, RSN and RTN, respectively ( Figure 5 ).

[0080] Using the QTLs identified in GWAS as input, 220 candidate genes were predicted by wGRN combined with known homologous genes in rice. In the embodiment, wGRN prioritized TraesCS5A03G0110200 (HD-Zip) as a high-confidence candidate based on its connectivity with genes in the functional network.

[0081] Example 2

[0082] Verification of HD-Zip gene expression levels in extreme varieties using RT-qPCR

[0083] Ten extreme nitrogen deficiency-tolerant and -sensitive wheat lines were treated with nitrogen deficiency (0.4 mM N) or normal nitrogen levels (4 mM N) for 15 days. The treated wheat plants were photographed and their morphological characteristics were observed. RNA was extracted from the wheat plants and analyzed by RT-qPCR. Three biological replicates were performed for each sample. Total RNA from the stems was extracted using the Plant RNA Kit (ER302; TransGenBiotech, Beijing, China), and cDNA was synthesized using the cDNA Synthesis Kit (AU341; TransGenBiotech, Beijing, China). Quantitative reverse transcription polymerase chain reaction (qPCR) analysis was performed using the Green qPCR Kit (AQ601; TransGenBiotech, Beijing, China) to determine gene expression levels. Experiments were performed in triplicate. The primers used for qPCR detection are as follows: F_HD-Zip: CTGCTGTCGAATGGGTGC (SEQ ID NO: 2); R_HD-Zip: CGATAGTTCCACCATTACCC (SEQ ID NO: 3); F_Actin: CAACGAGCTCCGTGTCGCA (SEQ ID NO: 4); R_Actin: GAGGAAGCGTGTATCCCTCATAG (SEQ ID NO: 5); the qPCR reaction system is preferably: 50 ng of cDNA template, 0.4 μl of each forward / reverse primer (10 μM), 10 μl mix, and ddH2O to 20 μl. The qPCR reaction program is a 94°C initial denaturation for 30 seconds, followed by 45 cycles of denaturation at 94°C for 5 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 10 seconds. Melting curve analysis is performed from 60°C to 95°C, with fluorescence signals collected every 0.5°C for 5 seconds per degree Celsius.

[0084] See the results Figure 6 and Figure 7 . To verify the function of the candidate gene, extremely tolerant and sensitive lines were exposed to normal nitrogen (control) and nitrogen deficiency (treatment) conditions. The results showed that nitrogen deficiency stress significantly inhibited the aboveground growth and nitrogen accumulation of wheat plants, but promoted root growth. In all extremely nitrogen deficiency-sensitive and tolerant lines, HD-Zip expression levels were downregulated, and the relative expression of HD-Zip was more downregulated in extremely sensitive lines, indicating that the expression and regulatory patterns between extreme lines in response to nitrogen starvation are different.

[0085] Ten wheat plants were cultured under nitrogen deficiency conditions (0.4 mM N) for 15 days. W199 (Xuzhou No. 25) served as a reference sample and tested using the aforementioned RT-qPCR method. The test sample was identified as a nitrogen-deficiency-sensitive wheat variety if the relative expression level of the HD-Zip gene was downregulated compared to the reference sample. If there was no significant difference, the sample was identified as a nitrogen-deficiency-tolerant wheat variety. The results showed that seven of the wheat plants were nitrogen-deficiency-sensitive varieties, while the remaining three were nitrogen-deficiency-tolerant varieties, achieving a 100% phenotypic consistency.

[0086] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A wheat gene HD-Zip, characterized in that: The nucleotide sequence is shown in SEQ ID NO:

1.

2. Use of detecting the relative expression level of the HD-Zip gene according to claim 1 in determining the tolerance of wheat varieties under nitrogen deficiency conditions.

3. The application according to claim 2, characterized in that: The method for judging the tolerance of wheat varieties under nitrogen deficiency conditions is as follows: when the relative expression level of the HD-Zip gene in the test sample is significantly downregulated compared with the reference sample, it indicates that the test sample is a nitrogen deficiency-sensitive wheat variety; if there is no significant difference, the test sample is judged to be a nitrogen deficiency-tolerant wheat variety.

4. Use of detecting the expression level of the HD-Zip gene according to claim 1 in distinguishing nitrogen deficiency-tolerant wheat varieties from nitrogen deficiency-sensitive wheat varieties.

5. The application according to claim 4, characterized in that: The method for distinguishing nitrogen deficiency-tolerant wheat varieties from nitrogen deficiency-sensitive wheat varieties is as follows: when the relative expression level of the HD-Zip gene in the test sample is downregulated compared with the reference sample, the test sample is judged to be a nitrogen deficiency-sensitive wheat variety; if there is no significant difference, the test sample is judged to be a nitrogen deficiency-tolerant wheat variety.

6. Use of detecting the relative expression level of the HD-Zip gene according to claim 1 in screening nitrogen deficiency-tolerant wheat varieties.

7. The application according to claim 6, characterized in that The method for screening nitrogen deficiency-tolerant wheat varieties screens wheat varieties whose relative expression levels of the HD-Zip gene have no significant difference compared with reference samples as breeding materials.

8. The use according to claim 5 or 7, characterized in that: The reference samples include at least one of the following: Xuzhou No. 25, Azulon, Chuanmai No. 41, Shijiazhuang No. 8 and Shaanmai No.

512.

9. The use according to any one of claims 2 to 7, characterized in that: The nitrogen deficiency includes a condition in which the nitrogen content in the wheat growth environment is lower than 0.4 mM.

10. The use according to any one of claims 2 to 7, characterized in that: The reagents for detecting the relative expression level of the HD-Zip gene include qPCR primers; The qPCR primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO: 2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO: 3.

Images