Application of Pinus massoniana PmVNS2 gene

Abstract

The invention discloses application of a Pinus massoniana PmVNS2 gene, and belongs to the technical field of plant genetic engineering. The pinus massoniana PmVNS2 gene is obtained through cloning, the nucleotide sequence of the pinus massoniana PmVNS2 gene is shown as SEQ ID NO.1, and the expression protein sequence of the pinus massoniana PmVNS2 gene is shown as SEQ ID NO.2. A plant expression vector 35S:: PmVNS2 is constructed and transferred into a poplar leaf, and a poplar PmVNS2 transgenic plant is obtained through cultivation and screening. Compared with a control plant, the root number, plant height or ground diameter are obviously improved. Real-time fluorescent quantitative PCR finds that PmVNS2 significantly promotes up-regulation of expression levels of most secondary wall synthesis key enzyme genes and transcription factor coding genes in poplar; further scanning electron microscope results show that the number of heterologous expression transgenic poplar secondary xylem cell layers is obviously increased, and cell walls are obviously thickened. The invention provides an effective molecular tool and method for improving the properties of the poplar, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and more specifically relates to the application of the Masson pine PmVNS2 gene. Background Art

[0002] Masson pine (Pinus massoniana) is a perennial evergreen coniferous tree of the Pinaceae family. It is widely distributed in southern my country, including Jiangsu, Anhui, Zhejiang, Hunan, Jiangxi, Fujian, Yunnan, Guizhou, and Guangdong and Guangxi. Its rapid growth, straight trunk, and tolerance to barrenness make it a core species for afforestation and industrial timber in southern my country's barren hills. According to the Ninth National Forest Resources Inventory (2014-2018), Masson pine stands cover 8.043 million hectares and have a standing stock of 626 million cubic meters, accounting for 4.47% and 3.67% of the dominant tree species in China's arbor forests, respectively. This ranks sixth nationwide in both area and standing stock, providing a vital raw material for industries such as wood processing, pulping and papermaking, and rosin extraction. Its wood is widely used in construction pile foundations, mine pillars, wood fiber production and underwater engineering due to its straight grain, long fibers, high hardness and water resistance. By-products such as rosin, tannin extract and Poria cocos culture also have high added value in the pharmaceutical and chemical fields.

[0003] As a typical gymnosperm species, Pinus massoniana has significant differences in its wood anatomical structure, secondary cell wall (SCW) components, and the molecular regulatory mechanisms of its formation from those of angiosperm species such as poplar: (1) At the anatomical level, in the xylem, the main component of wood, Pinus massoniana lacks the characteristic vascular tissue of broadleaf trees. Water transport and mechanical support functions are undertaken by tracheids with both transporting capabilities, and its fiber length is significantly longer than that of broadleaf species; (2) At the SCW component level, coniferous wood lignin is mainly composed of guaiacyl (G-type) monomers, while broadleaf wood contains syringyl (S-type) monomers, and there is also significant differentiation in the arrangement pattern of cellulose microfibrils and the type of hemicellulose; (3) At the molecular regulatory level, although both are composed of a two-level master switch system composed of NAC and MYB family transcription factors, it constitutes the core regulatory hub of SCW synthesis. Angiosperms have developed a highly specialized VND-NST / SND-MYB regulatory axis, in which the VND subfamily (such as VND7) drives vessel differentiation and PCD, while the NST / SND subfamily regulates fiber thickening and, in collaboration with MYB58 / 63, activates the S-type lignin pathway. However, gymnosperms rely on a simplified NAC-MYB regulatory cascade for secondary wall synthesis and lack genes for key enzymes in S-type lignin synthesis. However, the large size of gymnosperm genomes (the Masson pine genome is approximately 25 Gb) and the lack of genetic transformation systems have resulted in insufficient functional validation of VNS orthologs and the delineation of their regulatory networks, resulting in slow progress.

[0004] As a renewable resource, wood, with its cellulose and lignin components, is not only the raw material foundation for traditional papermaking, construction, and furniture industries, but is also considered an ideal alternative to new biofuels. However, the contradiction between the long growth cycle of trees and the surging demand for industrial raw materials is becoming increasingly prominent, necessitating the development of fast-growing, high-quality varieties through genetic breeding. Although Masson pine is a well-established timber species, its phenotypic traits are susceptible to environmental disturbances, limiting the efficiency of traditional breeding. Molecular analysis of the genetic regulation mechanisms of wood traits could significantly improve the efficiency of cultivating high-quality timber species. Summary of the Invention

[0005] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide an application of the Masson pine PmVNS2 gene, specifically for genetic improvement and breeding of poplars.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:

[0007] The application of the Masson pine PmVNS2 gene in promoting the formation of secondary wall of poplar. The nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.1.

[0008] In some embodiments, the applying comprises the following steps:

[0009] (1) Construction of a vector for the PmVNS2 gene;

[0010] (2) transforming the vector of the PmVNS2 gene into poplar tissues or cells;

[0011] (3) Cultivate and screen transgenic poplar plants with thickened secondary walls.

[0012] In some embodiments, the vector is a plant expression vector.

[0013] In some embodiments, the plant expression vector is 35S::PmVNS2.

[0014] The application of the Masson pine PmVNS2 gene in increasing the rooting quantity, plant height or ground diameter of poplar trees, wherein the nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.1.

[0015] The invention discloses an application of the masson pine PmVNS2 gene in increasing the number of secondary xylem cell layers of poplar. The nucleotide sequence of the masson pine PmVNS2 gene is shown in SEQ ID NO.1.

[0016] The application of the Masson pine PmVNS2 gene in increasing the expression of poplar lignin synthesis-related genes, cellulose synthesis-related genes or secondary wall formation-related MYB transcription factors, the nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.1.

[0017] In some embodiments, the poplar lignin synthesis-related gene is PAL4, C4H2, 4CL5, HCT1, C3H3, CCOAOMT1, CCR2, COMT2 or CAD1; the poplar cellulose synthesis-related gene is CesA2B or CesA3A; the poplar MYB transcription factor is MYB002, MYB003, MYB020, MYB021, MYB090, MYB128 or MYB158.

[0018] The application of the Masson pine PmVNS2 gene in reducing the expression of genes related to poplar xylan synthesis, the nucleotide sequence of the PmVNS2 gene is shown in SEQ ID NO.1.

[0019] In some embodiments, the poplar xylan synthesis-related gene is GT43B or GT43D.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention clones the PmVNS2 gene of Masson pine, uses poplar tissue culture seedlings as materials, constructs a plant expression vector 35S::PmVNS2 on this basis, transfers it into poplar leaves, and cultivates and screens poplar PmVNS2 transgenic plants. Inspection reveals that the plant height of the transgenic plants is significantly higher than that of CK plants, and the number of roots of the transgenic plants grown for 40 days is significantly more than that of the CK plants; the ground diameter (1 cm above the roots) of the transgenic plants grown for 100 days is larger than that of the CK plants; the number of secondary xylem cell layers of the transgenic plants grown for 40 days is significantly 1.5 times that of the CK plants, and the secondary wall thickness (3.45±0.27μm) is significantly greater than that of the CK plants (1.91±0.18μm); the expression levels of lignin and cellulose synthesis-related genes in the transgenic plants are 2-5 times that of the CK plants, the expression levels of xylan synthesis-related genes are significantly lower than those of the CK plants, and the expression level of the downstream MYB transcription factor is 2-8 times that of the CK plants. Experiments show that the heterologous expression of the Masson pine PmVNS2 gene provided by the present invention in poplars promotes the improvement of poplar growth traits, provides an effective molecular tool and method for improving poplar growth traits, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The expression pattern of PmVNS2 gene in different tissues of Pinus massoniana;

[0023] Figure 2 This is the expression level of PmVNS2 gene after drought stress in Pinus massoniana;

[0024] Figure 3 This is the subcellular localization map of the PmVNS2 gene;

[0025] Figure 4 This is a molecular detection diagram of PmVNS2 transgenic poplar;

[0026] Figure 5 is the expression level of PmVNS2 in transgenic lines and CK lines;

[0027] Figure 6 Figure 2 shows the plant height and rooting results of the PmVNS2 transgenic line and the CK line;

[0028] Figure 7 Statistical graphs of plant height (a), number of adventitious roots (b), and total root length (c) of PmVNS2 transgenic lines at 40 days;

[0029] Figure 8 The phenotype of the PmVNS2 transgenic strain after 60 days of transplantation of tissue culture seedlings (40 days);

[0030] Figure 9 Statistical graph of plant height and ground diameter of PmVNS2 transgenic lines after 60 days of transplantation from tissue culture seedlings (40 days);

[0031] Figure 10 This is the phenotype of the paraffin section of the 10th-11th stem section of the PmVNS2 transgenic line;

[0032] Figure 11 The phenotype of the PmVNS2 transgenic line was obtained by scanning electron microscopy of the 10th-11th stem section.

[0033] Figure 12 The expression levels of lignin, cellulose and xylan biosynthesis-related genes in the PmVNS2 transgenic line;

[0034] Figure 13 This is the expression level of downstream MYB transcription factors in the PmVNS2 transgenic line. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical solutions and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. Unless otherwise specified in the following embodiments, the technical means used are conventional means well known to those skilled in the art.

[0036] The plant material used in the present invention is poplar tissue culture seedlings, which are grown on WPM rooting medium under the following culture conditions: 16 hours of light, 8 hours of darkness, and a humidity setting of 70%.

[0037] Zero Cloning Kit cloning vector and Trans1-T1 Escherichia coli competent cells were purchased from Quanshijin (Beijing) Biotechnology Co., Ltd.

[0038] Agrobacterium strain EHA105 was purchased from Qingke (Beijing) Biological Co., Ltd.

[0039] The overexpression vector pH35GS was stored in the laboratory of Nanjing Forestry University.

[0040] RNAprep Pure polysaccharide and polyphenol plant total RNA extraction kit and polysaccharide and polyphenol plant genomic DNA extraction kit were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; AxyPrep TM DNA Gel Extraction Kit was purchased from AXYGEN (USA); Prime STAR Max DNA Polymerase high-fidelity enzyme, Prime Script TM RTMaster Mix reverse transcription reagent, Power UP TM SYBR Green Master Mix quantitative reagent was purchased from Thermo Fisher (USA); TIAN pure Midi Plasmid Kit (spin column type) was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; One Step Cloning Kit was purchased from Novozymes (Nanjing) Biotechnology Co., Ltd.; XhoI and KpnI-HF enzymes, T4 DNA ligase, and BsaI-HF enzyme were purchased from TaKaRa Biotechnology (Beijing) Co., Ltd.; other commonly used reagents for molecular experiments were purchased.

[0041] Example 1

[0042] 1. Extraction of Total RNA

[0043] RNA was extracted from the developing xylem of Pinus massoniana using a polysaccharide and polyphenol plant total RNA extraction kit.

[0044] The experimental steps are as follows:

[0045] Before use, dissolve 1500 U of DNase I powder in 550 μL of RNase-free ddH₂O. Aliquot 10 μL of DNase I into each tube, gently mix, and store at -20°C until ready to use. Quickly grind plant tissue in liquid nitrogen to a powder. Add 475 μL of Lysis Buffer SL and 25 μL of β-mercaptoethanol and immediately vortex. Centrifuge at 12,000 rpm for 2 minutes. Transfer the resulting supernatant to a CS filter column and centrifuge at 12,000 rpm for 2 minutes. Carefully transfer the supernatant from the collection tube to a new RNase-free centrifuge tube, using a pipette tip to avoid aspirating cell debris. Slowly add 200 μL of anhydrous ethanol to the RNase-free centrifuge tube containing the supernatant, mix thoroughly, and transfer the mixture to an adsorption column CR3. Centrifuge at 12,000 rpm for 15 seconds, discard the waste liquid, and return the adsorption column CR3 to the collection tube. Add 350 μL of deproteinizing solution RW1 to the adsorption column and centrifuge at 12,000 rpm for 15 seconds. Discard the waste solution and return the adsorption column CR3 to the collection tube. Transfer 10 μL of DNase I stock solution to a new RNase-free centrifuge tube and add 70 μL of RDD buffer. Mix gently. Add 80 μL of DNase I working solution to the center of the adsorption column CR3 and let it stand at room temperature for 15 minutes. Add 350 μL of deproteinizing solution RW1 directly to the adsorption column CR3 and centrifuge at 12,000 rpm for 15 seconds. Discard the waste solution. Add 500 μL of rinse solution RW1 to the adsorption column CR3, add anhydrous ethanol, centrifuge at 12,000 rpm for 15 seconds, and discard the waste solution. Return the adsorption column CR3 to the collection tube. Repeat the above steps. Centrifuge at 12,000 rpm for 2 minutes. Place the adsorption column CR3 in a new RNase-Free centrifuge tube, open the lid and let it air dry for 2 minutes. Then, drop 35 μL of RNase-Free ddH2O onto the middle of the adsorption membrane and let it stand at room temperature for 3 minutes (this step is performed on ice). Centrifuge at 12,000 rpm for 1 minute and collect the solution into a centrifuge tube. Re-aspirate the solution into the adsorption column CR3, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 rpm for 1 minute to obtain total RNA.

[0046] Total RNA quality detection: NanoDrop 2000 spectrophotometer was used to measure the extracted total RNA concentration and OD 260 / OD 280 and OD 260 / OD 230 The integrity of RNA was checked by 1% agarose gel electrophoresis.

[0047] 2. cDNA Synthesis

[0048] Plant total RNA was reverse transcribed into cDNA using the Prime Script RT Master Mix kit.

[0049] The reaction system is: Prime Script RT Master Mix 4μL, Total RNA (1000ng)XμL, and RNase-Free ddH2O supplemented to 20μL.

[0050] The PCR reaction program is: 37°C, 15 minutes; 85°C, 5 seconds. After the reaction is completed, the cDNA product is diluted according to specific needs and stored at 4°C.

[0051] 3. Primer design

[0052] Specific amplification primers were designed for the PmVNS2 gene sequence in the xylem RNA-seq data of Pinus massoniana. Oligo7 was used to design primers with a length of 23-28 nt, a GC content of 40%-70%, and an annealing temperature of Tm ≥ 60°C. The primer sequences are shown below.

[0053] PmVNS2-F: 5'-ATGAACACGCTATCTCGCGTTCCTC-3',

[0054] PmVNS2-R: 5'-TCATTTTCCTGCAAAGCTCCAGAG-3'.

[0055] 4. Amplification of target fragment

[0056] The target fragment was amplified using the high-fidelity enzyme Prime STAR Max DNA Polymerase using the cDNA of Pinus massoniana xylem as a template.

[0057] The reaction system is:

[0058] Prime STAR Max pre mix (2×) 25 μL PmVNS2-F 1 μL PmVNS2-R 1 μL cDNA / DNA 1 μL <![CDATA[ddH2O]]> 22 μL Total volume 50μL

[0059] The reaction procedure is:

[0060]

[0061] The PCR amplification product was detected by 1% agarose gel electrophoresis, and a single and clear gel band was recovered for purification.

[0062] 5. Purification and ligation of target fragments

[0063] AxyPrep Gel Extraction Kit TM DNA Gel Extraction Kit is used to recover and purify the target fragment. The experimental steps are as follows:

[0064] Add 600μL of Buffer DE-A to the centrifuge tube containing the gel, mix thoroughly, and heat at 75°C, mixing intermittently every 2-3 minutes until the gel is completely melted. Add 300μL of Buffer DE-B and 200μL of isopropanol, mix thoroughly. Aspirate the mixture and transfer it to a DNA preparation tube in a 2mL centrifuge tube. Centrifuge at 12,000 rpm for 1 minute. Discard the filtrate. Add 500μL of Buffer W1 and centrifuge at 12,000 rpm for 1 minute. Discard the filtrate. Return the preparation tube to the centrifuge tube, add 700μL of Buffer W2 (pre-dilution with anhydrous ethanol), let stand at room temperature for 3 minutes, centrifuge at 12,000 rpm for 1 minute, and discard the filtrate. Repeat the above steps. Return the preparation tube to the 2mL centrifuge tube and centrifuge at 12,000 rpm for 2 minutes. Place the preparation tube in a new 1.5mL centrifuge tube and air-dry at room temperature with the lid uncovered for 5 minutes. Add 20μL of ddH2O to the center of the preparation membrane and let stand at room temperature for 2 minutes. Centrifuge at 12,000 rpm for 1 minute. Pipette the resulting solution back into the preparation tube and let it stand at room temperature for 2 minutes. Centrifuge at 12,000 rpm for 1 minute to obtain the purified solution of the target fragment.

[0065] The concentration and purity of the recovered DNA were detected using NanoDrop 2000c and ligated to For Zero cloning vectors, ddH2O can be added to make up for high concentrations. The reaction system is as follows:

[0066]

[0067] The PCR reaction program is: 25°C, 15 min. The ligation product is stored in a refrigerator at 4°C until use.

[0068] Add 5 μL of the ligation product obtained in the previous step to 50 μL of Trans1-T1 competent cells (the competent cells have been completely thawed), gently stir with your fingers to mix, and place on ice for 30 minutes. Heat shock at 42°C for 1 minute, then place on ice for 2 minutes and add to 800 μL of LB liquid culture medium. Resuscitate at 37°C and 150 rpm for 60 minutes. Remove the revived bacterial solution and centrifuge at 4000 rpm for 5 minutes. Aspirate 600 μL of the supernatant from the centrifuged bacterial solution in a clean bench. Use a pipette to mix the remaining 200 μL of bacterial solution, add it to LB solid culture medium with ampicillin (Amp) resistance, and spread it evenly with a coating rod; place it upside down in a 37°C constant temperature incubator and incubate for 12 hours.

[0069] Pick a single colony of appropriate size from the LB plate and inoculate each colony into 800 μL of LB liquid medium containing Amp resistance. Shake the culture on a temperature-controlled shaker at 250 rpm and 37°C for 4-6 hours. Then, perform a bacterial test.

[0070] The reaction system is as follows;

[0071] 2× Rapid Taq Master Mix 5μL M13F Forward Primer (10μM) 0.5μL M13R Reverse Primer (10μM) 0.5μL bacterial liquid 1 μL <![CDATA[ddH2O]]> 6μL Total volume 10 μL

[0072] The reaction procedure is:

[0073]

[0074] PCR products were initially size-checked using 1% agarose gel electrophoresis. Positive bacterial cultures whose bands aligned with the target fragment were selected and sent to Sangon for sequencing. Sequencing results revealed the sequence of the target gene, 1062 bp in length, as shown in SEQ ID NO. 1, designated PmVNS2. The expressed protein sequence is shown in SEQ ID NO. 2.

[0075] Example 2

[0076] 1. RNA was extracted from the roots, tender stems, needles, megasporophyll, microsporophyll, cones and xylem of Pinus massoniana using a polysaccharide and polyphenol plant total RNA extraction kit according to the method in Example 1, and reverse transcribed into cDNA. The specific method is as shown in Example 1. Real-time fluorescence quantitative PCR (RT-qPCR) technology was used to detect the specific expression of PmVNS2 gene in different tissues. Each reaction was repeated three times, with DDI1 as the internal reference gene and 2 -ΔΔCt The relative expression levels were calculated using the primer sequences shown below:

[0077] qRTPmVNS2-F: 5'-TCCGCAGCTGGAGAGTCCAA-3',

[0078] qRTPmVNS2-R: 5'-AGCTGCTGACTGTGGATTGGC-3'.

[0079] qRTDDI1-F: 5'-GCTGTCTAATATGCGTTCT-3',

[0080] qRTDDI1-R: 5'-GCTTCCTCCAGAGTCAT-3'.

[0081] The qRT-PCR reaction system is as follows:

[0082] PowerUPTM SYBR Green Master mix 5.0μL PCR Forward Primer (10 μM) 0.5μL PCR Reverse Primer (10 μM) 0.5μL cDNA 1.0μL <![CDATA[ddH2O]]> 3.0μL Total volume 10 μL

[0083] The reaction procedure is as follows:

[0084]

[0085] The results are as follows Figure 1As shown, the PmVNS2 gene is expressed in roots, microsporophyll, megasporophyll, young stem, needles, cones, and xylem, with the expression level in roots set as a reference level of 1. The expression level in the xylem was significantly higher than in other tissues, with a relative expression level of 6.1 times that in the roots. The next highest expression level was in the young stem, where the expression level was 3.5 times that in the roots. This suggests that the gene likely plays a role in the formation of the xylem in Masson pine.

[0086] 2. 30-day-old soil-grown Pinus massoniana seedlings were thoroughly watered with a 300 mM mannitol solution. Leaves were collected at 0, 6, 12, 24, 48, and 72 hours. RNA was extracted and converted to cDNA. qRT-PCR was performed for PmVNS2 using the following primer sequences:

[0087] qRTPmVNS2-F: 5'-TCCGCAGCTGGAGAGTCCAA-3',

[0088] qRTPmVNS2-R: 5'-AGCTGCTGACTGTGGATTGGC-3'.

[0089] qRTDDI1-F: 5'-GCTGTCTAATATGCGTTCT-3',

[0090] qRTDDI1-R: 5'-GCTTCCTCCAGAGTCAT-3'.

[0091] The qRT-PCR reaction system is as follows:

[0092] PowerUPTM SYBR Green Master mix 5.0μL PCR Forward Primer (10 μM) 0.5μL PCR Reverse Primer (10 μM) 0.5μL cDNA 1.0μL <![CDATA[ddH2O]]> 3.0μL Total volume 10 μL

[0093] The reaction procedure is as follows:

[0094]

[0095] The results are as follows Figure 2 As shown in the results, the expression level of PmVNS2 increased continuously from 0 to 12 hours after drought stress treatment, reaching a peak at 12 hours, at which point the expression level was 9.46 times that of the CK. Subsequently, the expression level began to decline, reaching its lowest value after 72 hours of drought treatment, at 2.11 times that of the CK. These results indicate that drought stress can induce the expression of the PmVNS2 gene, suggesting that the PmVNS2 gene may be involved in the response of Masson pine to abiotic stress.

[0096] 3. Using seamless cloning (NC) technology, a fusion expression vector (35S::PmVNS2-GFP) was constructed between the green fluorescent protein (GFP) and the PmVNS2 protein, which were driven by the 35S cauliflower mosaic virus (35SCaMV) promoter. 20-bp universal linkers (minus the stop codon) were added to both ends of the specific primers for the PmVNS2 gene. The upstream universal linker was agtggtctctgtccagtcct; the downstream universal linker was ggtctcagcagaccacaagt. PCR amplification was then performed, and the amplified product was recovered and purified using the AxyPrep™ DNA Gel Extraction Kit for use in the next step. The primer sequences are shown below:

[0097] qRTPmVNS2-F: 5'-AGTGGTCTCTGTCCAGTCCTATGAACACGCTATCTC GCGTTCCTC-3',

[0098] qRTPmVNS2-R: 5'-GGTCTCAGCAGACCACAAGTTTTTCCTGCAAAGCT CCAGAG-3'.

[0099] The Nimble Cloning reaction is as follows:

[0100] Nimble Cloning System Expression Vectors (20-100)ng Nimble Mix 5μL PCR products (10-50)ng <![CDATA[ddH2O]]> Make up to 10 μL Total volume 10 μL

[0101] Reaction procedure: 50°C, 1h.

[0102] Transform the competent E. coli strain Trans1-T1, plate on LB solid medium containing Amp resistance, and incubate at 37°C for 12 hours. Select positive colonies for PCR identification and sequencing verification.

[0103] The transient transformation system of Pinus massoniana protoplasts established in the laboratory of Nanjing Forestry University was used. The specific transformation steps are as follows:

[0104] Isolation of protoplasts: Cut the needles of Pinus massoniana that have grown well for about 15 days into 0.5-1.0 mm filaments and immediately transfer them to freshly prepared enzymatic solution. Enzyme hydrolysis is carried out in the dark at 28°C for 4-6 hours. An equal volume of W5 solution (2 mM MES pH 5.7, 154 mM NaCl, 125 mM CaCl2, 5 mM KCl) is added to terminate the reaction. Use W5 solution to filter the protoplasts through a 0.75 mm nylon mesh into a round-bottom centrifuge tube, and centrifuge at 100 g for 8 minutes to collect the precipitate. After washing with W5 once, resuspend the protoplasts to 8 × 10 5cells / mL. In the transient transformation experiment, 10 μg of plasmid DNA was added to 100 μL of protoplast suspension, followed by an equal volume of freshly prepared PEG solution (0.2 M mannitol, 100 mM CaCl2, and different concentrations of PEG4000 (20%, 30%, 40%, W / V). After incubation at room temperature for 30 minutes, 1 mL of W5 was slowly added to terminate the reaction, and the protoplasts were collected by centrifugation at 150 g for 5 minutes. After gently resuspending with 100 μL of WI solution (4 mM MES pH 5.7, 0.6 M mannitol, 20 mM KCl), the cells were transferred to a 24-well culture plate (Falcon) and incubated in the dark at 25°C for 12-18 hours. The results were observed using a Lumen Dynamic Connections fluorescence microscope. The experiment was repeated three times to ensure accuracy.

[0105] The results are as follows Figure 3 As shown, PmVNS2 protein was transiently expressed in protoplasts of Pinus massoniana needles. The PmVNS2-GFP signal was only expressed in the nucleus, while the control 35S::GFP signal was expressed in the cytoplasm, cell membrane and nucleus, indicating that PmVNS2 is a nuclear-localized protein.

[0106] Example 3

[0107] 1. Overexpression vector construction

[0108] The ORF sequence of PmVNS2 was constructed into the overexpression vector pH35GS using the One-Step Cloning Kit, generating the plant overexpression vector 35S::PmVNS2. The specific steps are as follows: Use a sterile inoculating loop to dip the overexpression vector pH35GS bacterial solution and streak it onto a LB solid medium plate containing spectinomycin (Spc); incubate the plate upside down at 37°C for approximately 12 hours, pick a single colony, shake the plate, and then test the solution; expand the positive bacterial solution and extract the plasmid, and test the plasmid purity and concentration for future use; linearize the pH35GS vector plasmid using two endonucleases, XhoI and KpnI-HF. The reaction system is as follows:

[0109] purified pH35GS vector 1 μg CutSmart(buffer) 5μL XOt 2μL KpnI-HF 2μL <![CDATA[ddH2O]]> up to 50μL Total volume 50μL

[0110] The reaction program was: 37°C, 60 min, 65°C, 25 min.

[0111] The digested products were detected by electrophoresis on 1% agarose gel and then recovered and purified using AxyPrep™ DNA Gel Extraction Kit.

[0112] Homologous sequences from both ends of the linearized vector were introduced into the 5' ends of the forward and reverse amplification primers for the target fragment, so that the amplified fragment would have homologous sequences corresponding to the ends of the linearized cloning vector. The primers after adding the adapters are KpnI-PmVNS2-F and XhoI-PmVNS2-R, respectively. The primer sequences are as follows:

[0113] KpnI-PmVNS2-F: 5'-GGGGACTCTAGAATAGGTACCATGAACACGCTATCT CGCGTTCCTC-3',

[0114] XhoI-PmVNS2-R: 5'-CCTCAGCTACTTAAGCTCGAGTCATTTTCCTGCAAA GCTCCAGAG-3'.

[0115] Using PmVNS2 plasmid as template, KpnI-PmVNS2-F and XhoI-PmVNS2-R primers and high-fidelity enzyme PrimeSTAR Max DNA Polymerase were used to amplify the target fragment, and the amplified product was recovered and purified using AxyPrepTM DNA Gel Extraction Kit.

[0116] The reaction system is:

[0117] PrimeSTAR Max pre mix (2×) 25 μL KpnI-PmVNS2-F 1 μL XhoI-PmVNS2-R 1 μL cDNA / DNA 1 μL <![CDATA[ddH2O]]> 22 μL Total volume 50μL

[0118] The reaction procedure is:

[0119]

[0120] according to II. Recommended recombination reaction system: Select the optimal amount of insert fragment. The reaction system is as follows:

[0121] Linearized vector 200ng Destination fragment 30ng 5×CE II Buffer 4μL Exnase II 2μL <![CDATA[ddH2O]]> Up to 20μL Total volume 20 μL

[0122] The reaction procedure was as follows: incubate at 37°C for 30 minutes, then immediately place on ice. The recombinant plasmid was transformed into the competent E. coli strain Trans1-T1, following the procedure described in Example 1. Single clones were selected for bacterial culture testing. Finally, sequencing was performed to confirm the correct insertion orientation and sequence of the overexpression recombinant vector. The plasmid was then extracted and stored for future use. The remaining bacterial culture was then stored at -80°C for further use.

[0123] 2. Transformation of Agrobacterium

[0124] Thaw the EHA105 competent cells from the -80°C freezer in advance, then add at least 100 ng of the recovered and purified 35S::PmVNS2 plasmid. Mix by flicking gently and place on ice for 30 minutes. Quickly freeze in liquid nitrogen for 1 minute. Heat shock in a 37°C water bath for 3 minutes and quickly place on ice for 1-2 minutes. Add 800 μL of LB liquid culture medium. Resuscitate on a temperature-controlled shaker at 28°C and 100 rpm for 3-4 hours. Centrifuge at 3000 rpm for 3 minutes. Aspirate 600 μL of the supernatant, pipette to mix the remaining bacterial solution, and evenly spread it on LB solid culture medium containing kanamycin (Kan, 50 mg / L) + streptomycin (Str, 30 mg / L) using a spreading rod. Incubate inverted in a 28°C incubator for 30-48 hours. Pick a single colony and place it in 800 μL of LB liquid medium containing Kan (50 mg / L) and Str (30 mg / L). Propagate the culture on a shaker at 28°C and 250 rpm for 22-24 hours. If the PCR test is positive, the resulting positive culture will be used as the seed culture for the genetic transformation experiment.

[0125] 3. Leaf disc method for transformation of poplar

[0126] Inoculate 800 μL of the positive bacterial suspension into 5 mL of LB liquid medium containing Kan (50 mg / L) and Str (30 mg / L). Propagate the suspension on a shaker at 28°C and 250 rpm for approximately 12 hours to prepare the seed solution. Add 1 mL of the seed solution to a flask and add 50 mL of LB liquid medium containing Kan and Str. Propagate the suspension at 28°C and 250 rpm for approximately 6 hours. In a laminar flow hood, aspirate 100 μL of the suspension to measure the OD600 value; an OD600 of 0.5 is optimal. Aliquot the suspension into 50 mL centrifuge tubes and centrifuge at 5000 rpm at 4°C for 10 minutes. Discard the supernatant and collect the pellet. Resuspend and mix the suspension in an equal volume (50 mL) of sugar-free MS liquid medium. Add acetosyringone (20 μL / mol) and gently shake at 90 rpm at 28°C for 30-60 minutes. Take poplar tissue culture seedlings that have grown for 35-45 days and are in good condition, take the stretched leaves, cut wounds along the edges of the leaves, and place some leaves directly into the differentiation medium as the positive control group. Place the remaining leaves into the mixed bacteria and infect them on a shaker at 28°C and 90rpm for 20-30 minutes. Take out the leaf disc, use sterile filter paper to absorb the residual bacterial liquid on the leaves, transfer them into the differentiation medium without antibiotics, and place them in a 28°C incubator together with the positive control group for dark culture for 48 hours. Wash the leaf disc with sugar-free MS liquid culture medium containing Timentin (Tim, 100 mg / L) that inhibits the growth of Agrobacterium, and repeat 3 times. Then place it in the differentiation medium containing Tim (100 mg / L) and culture it in light for 7 days. After 7 days, replace it with the differentiation medium containing Kan (50 mg / L) + Tim (100 mg / L) for positive strain screening and culture. When resistant adventitious buds emerge from the leaf discs, they are cut and placed in a seedling growth medium containing Kan (50 mg / L) + Tim (100 mg / L) to allow stem elongation. When the resistant buds reach approximately 1 cm, the terminal buds are cut and transferred to a rooting medium containing Kan (50 mg / L) + Tim (100 mg / L) for screening of resistant plants. All operations are performed in a clean bench.

[0127] 4. Positive plant screening

[0128] DNA from transgenic plants and wild-type plants (CK) was extracted using a polysaccharide and polyphenol DNA extraction kit. The following experimental steps were performed: An appropriate amount of plant tissue was thoroughly ground in liquid nitrogen. 400 μl of GPS buffer and 10 μl of RNase A (10 mg / ml) were quickly added to the ground powder. After vortexing, the centrifuge tube was placed in a 65°C waterbath for 15 minutes, repeatedly inverting the tube to mix the sample. 100 μl of GPA buffer was added to the centrifuge tube, vortexed for 1 minute, and centrifuged at 12,000 rpm (~13,400 × g) for 5 minutes. The supernatant was transferred to a CS filter column and centrifuged at 12,000 rpm (~13,400 × g) for 1 minute. The filtrate was transferred to a new centrifuge tube. 500 μl of anhydrous ethanol was added to the new centrifuge tube and mixed thoroughly (a flocculent precipitate may form). Transfer the solution and flocculent precipitate from the previous step to RNase-Free Adsorption Column CR2. Centrifuge at 12,000 rpm (~13,400 × g) for 1 minute. Discard the waste solution and return the RNase-Free Adsorption Column CR2 to the collection tube. Add 550 μl of Deproteinization Buffer RD to the RNase-Free Adsorption Column CR2 and centrifuge at 12,000 rpm (~13,400 × g) for 1 minute. Discard the waste solution and add 700 μl of Rinsing Buffer PW. Centrifuge at 12,000 rpm (~13,400 × g) for 1 minute. Discard the waste solution and return the RNase-Free Adsorption Column CR2 to the collection tube. Repeat the above steps. Return the RNase-Free Adsorption Column CR2 to the collection tube and centrifuge at 12,000 rpm (~13,400 × g) for 2 minutes. Discard the collection tube. Transfer the RNase-Free Adsorption Column CR2 to a new centrifuge tube and let it air dry at room temperature for 5-10 minutes. Add 30 μL of ddH2O to the RNase-Free adsorption column CR2, incubate at room temperature for 5 minutes, and centrifuge at 12,000 rpm (~13,400 × g) for 2 minutes to collect the solution into a centrifuge tube. Re-aspirate the collected solution into the adsorption column CR2, incubate at room temperature for 3 minutes, and centrifuge at 12,000 rpm (~13,400 × g) for 2 minutes to obtain genomic DNA.

[0129] PCR detection of the overexpression strain at the DNA level was performed using the 35S::PmVNS2 plasmid as a positive (+) control and CK as a negative (-) control. The vector primer p35Sf3 was used as the upstream primer (5'-AGGAAGGTGGCTCCTACAAATGCCATC-3') and the target gene-specific primer PmVNS2-R (PmVNS2-R: 5'-TCATTTTCCTGCAAAGCTCCAGAG-3') as the downstream primer.

[0130] The results are as follows Figure 4As shown in the figure, the same target bands were detected in 8 transgenic lines (T1-T8) and the positive control (+), which preliminarily proved that the exogenous T-DNA carrying the PmVNS2 gene had been successfully integrated into the poplar genomic DNA.

[0131] RNA was extracted from T1-T8 and CK strains using a polysaccharide and polyphenol RNA extraction kit and reverse transcribed into cDNA for qRT-PCR analysis. The transcript levels of the PmVNS2 gene in the overexpressing plants were determined. The primer sequences are as follows:

[0132] qRTPmVNS2-F: 5'-TCCGCAGCTGGAGAGTCCAA-3',

[0133] qRTPmVNS2-R: 5'-AGCTGCTGACTGTGGATTGGC-3';

[0134] EF1α-F: 5'-GGCAAGGAGAAGGTACACAT-3',

[0135] EF1α-R: 5'-CAATCACACGCTTGTCAATA-3'.

[0136] The results are as follows Figure 5 As shown, the expression level of the CK line was set as reference level 1. PmVNS2 expression was highest in transgenic T7 (597-fold), followed by 532-fold and 418-fold in T1 and T6, respectively. The three transgenic lines with the highest relative expression levels (T1, T6, and T7) and the CK line were selected as materials for subsequent experiments.

[0137] 5. Phenotypic Observation of Transgenic Lines

[0138] 1) Observe and analyze various aspects of plant development, including rooting time, root number, and plant height. Transgenic and CK tissue culture seedlings cultured under the same growth conditions were used for observation and statistics. Data measured included plant height, number of lateral roots, maximum lateral root length, and total root length. Five plants from each of the three transgenic lines, T1, T6, and T7, and CK, were analyzed every 10 days for a total of 40 days. Results were analyzed using one-way analysis of variance. Significant differences are indicated by different lowercase letters (P < 0.05).

[0139] The results are as follows Figure 6 and Figure 7As shown, compared with CK plants, the transgenic lines exhibited significant growth advantages in plant height and root development (including root number and total root length). From 0 to 20 days, the root growth advantage was significant, with the average root number and total root length reaching 2.00 times and 2.52 times that of the CK, respectively. During the 20-30 day period, the total root length of the transgenic lines increased significantly, especially in the T7 line (46.73 ± 1.62 cm vs. 18.83 ± 2.84 cm for the CK line). During the 30-40 day period, the root number and total root length of the transgenic lines were 2.00 times and 1.83 times that of the CK, respectively. The plant height of the transgenic lines (increased by 6.68 cm from 10 to 40 days) was significantly greater than that of the CK line (5.80 cm).

[0140] 2) Subsequently, the jars containing the transgenic and CK tissue culture seedlings were opened for greenhouse hardening. The culture medium on the roots was washed away with water containing a trace amount of chlorpyrifos. The seedlings were then transplanted into sterilized nutrient soil and grown for 60 days. Phenotypic differences in plant height and ground diameter between the transgenic and CK plants were analyzed.

[0141] The results are as follows Figure 8 and Figure 9 As shown, after 60 days of growth in soil pots, the transgenic lines further exhibited enhanced phenotypic advantages: plant height and ground diameter (2.61±0.15 mm vs. CK line: 1.99±0.14 mm) were significantly greater than those of CK. These results suggest that PmVNS2 may coordinate plant growth by promoting aboveground development (including plant height and stem radial growth) and root expansion.

[0142] Example 4

[0143] 1. Paraffin section

[0144] Based on the enhanced radial growth of stems in PmVNS2-overexpressing strains reported above, we further investigated the regulatory role of PmVNS2 in secondary wall formation. Paraffin sections of transgenic lines (T1 and T7) and the CK strain grown on MS medium for 40 days were analyzed. The specific steps are as follows:

[0145] Stem segments from nodes 10-11 of transgenic T1, T7, and CK lines were cut into 2 mm segments and fixed in FAA fixative (50% anhydrous ethanol: 38% formaldehyde: glacial acetic acid = 18:1:1) for 24 h. Dehydration was performed sequentially as follows: immersion in distilled water for 0.5 h → 35% ethanol for 40 min → Grade I solution (50% distilled water + 40% ethanol + 10% n-butanol) → Grade II solution (30% distilled water + 50% ethanol + 20% n-butanol) → Grade III solution (15% distilled water + 50% ethanol + 35% n-butanol) → Grade IV solution (5% distilled water + 40% ethanol + 55% n-butanol) → Grade V solution (25% ethanol + 75% n-butanol) → Grade VI solution (100% n-butanol), with two immersions for 1 h each to complete dehydration. After dehydration, the specimens were immersed in a mixture of n-butanol and paraffin (1:1) for 24 hours, followed by three immersions in pure paraffin (1 hour apart). The specimens were placed in an embedding cassette containing the paraffin solution and placed in cold water to rapidly solidify the liquid paraffin for subsequent sectioning. The trimmed paraffin blocks were serially sectioned and mounted on slide adhesive. The dewaxing and staining process was as follows: slides were immersed in pure xylene twice (25 minutes each) → 1 / 2 xylene + 1 / 2 ethanol → 100% ethanol → 95% ethanol → 85% ethanol → 70% ethanol → 50% ethanol → 35% ethanol → distilled water (1 minute each) → 1% safranin aqueous solution for 12 hours → distilled water for 5 minutes → 35% ethanol → 50% ethanol → 70% ethanol → 85% ethanol (3 minutes each) → 95% ethanol + 0.1% Fast Green aqueous solution for 30 seconds → pure alcohol twice → 1 / 2 xylene + 1 / 2 ethanol → pure xylene twice (5 minutes each). After sealing, the slides were observed under an optical microscope.

[0146] Microscopic observation results Figure 10 The results showed that compared with the CK strain, the number of secondary xylem cell layers in the transgenic T1 and T7 strains increased by about 1.5 times, and the proportion of the medullary cavity and primary xylem was relatively reduced.

[0147] 2. Electron microscope scanning

[0148] To observe the secondary wall thickness of the stems of T1, T7, and CK lines, the stem bases of each poplar plant were cross-sectioned and subjected to scanning electron microscopy. The bases of the transgenic and CK lines were cut into 5 mm sections and immediately fixed in a 4% glutaraldehyde fixative. The samples were dehydrated at the Modern Analysis and Testing Center of Nanjing Forestry University and then cut into ultra-thin sections for critical point drying. The dried samples were attached to an observation platform and sprayed with gold. Observation was performed using a scanning electron microscope (Quanta 200, USA).

[0149] The analysis of the ultrastructure of the stem cross section by scanning electron microscopy (SEM) further showed that ( Figure 11), the xylem cell wall thickness of the transgenic line (3.45±0.27μm) was significantly different from that of the CK line (1.91±0.18μm). These histological and ultrastructural results together indicate that overexpression of PmVNS2 can specifically promote the deposition of xylem secondary walls.

[0150] Example 5

[0151] 1. Screen the genes related to lignin, cellulose, and xylan biosynthesis in the poplar genome and detect their expression levels in the PmVNS2 overexpression strain. The primer sequences are as follows:

[0152] qRTPAL4-F: 5'-GCCCCCTGATCGAAGTGATT-3',

[0153] qRTPAL4-R: 5'-TGGCAATTTCGGCACCTTTG-3';

[0154] qRTC4H2-F: 5'-AAGAGGTTCTGCACACGCAA-3',

[0155] qRTC4H2-R: 5'-AATCCCATGAGTTGCAGCCT-3';

[0156] qRT4CL5-F: 5'-AAATGGCGCAAATGGGGATG-3',

[0157] qRT4CL5-R: 5'-GGGGCAGAGTCTACACACAT-3';

[0158] qRTHCT1-F: 5'-TGCGGAGGAGTTTCACTTGG-3',

[0159] qRTHCT1-R: 5'-GTGTTGAGCTGATCCCTGGT-3'.

[0160] qRTC3H3-F: 5'-GTCAAGCCTGTGAGGTTCCG-3',

[0161] qRTC3H3-R: 5'-GGCAGCAACCTCATCTTCTC-3';

[0162] qRTCCOAOMT1-F: 5'-CATCTTTGTGGATGCTGACA-3',

[0163] qRTCCOAOMT1-R: 5'-GACGGCAGAGAGTGATGCCA-3';

[0164] qRTCCR2-F: 5'-GACCATTGTTGCAGCCCACT-3',

[0165] qRTCCR2-R: 5'-GGTAGGGATGGGGTACTCAG-3';

[0166] qRTCOMT2-F: 5'-AACAGCCATTGAACTCGACC-3',

[0167] qRTCOMT2-R: 5'-GACACCATCCTCGTTCTTGGT-3'.

[0168] qRTCAD1-F: 5'-ACTTGGAGGAGTAGGGCACA-3',

[0169] qRTCAD1-R: 5'-AACAAACTGCAATGGGGCAT-3';

[0170] qRTCesA2B-F: 5'-TGGAGCGGAGTAAGCATTGAG-3',

[0171] qRTCesA2B-R: 5'-TCCAGCAACAACTCCAACGA-3';

[0172] qRTCesA3A-F: 5'-CCAGGCAACCACTATGGAGAA-3',

[0173] qRTCesA3A-R: 5'-ATTAGGCTCACCCTCACGCT-3'.

[0174] qRTGT43B-F: 5'-CCAGCTCCACCAAGCTCTAA-3',

[0175] qRTGT43B-R: 5'-ATGATCCAACTCTGCTTCGGG-3';

[0176] qRTGT43D-F: 5'-CCCCCATCTCACCAAAACGA-3',

[0177] qRTGT43D-R: 5'-CCGTACATAAGTGGGCGTGA-3';

[0178] The results are as Figure 12As shown, the expression levels of lignin biosynthesis-related genes (including CCR2, C3H3, C4H2, 4CL5, COMT2, and HCT1) in transgenic plants were significantly upregulated by 2-5 times compared to CK plants. Furthermore, the expression levels of key cellulose biosynthesis enzyme genes, CesA2B and CesA3A, were significantly increased, while the xylan biosynthesis-related genes, GT43B and GT43D, showed a downregulation trend. This suggests that PmVNS2 may regulate secondary wall deposition by synergistically activating the lignin and cellulose biosynthesis pathways and inhibiting xylan production.

[0179] 2. Detect the expression levels of MYB transcription factors related to secondary wall formation in poplar in PmVNS2 overexpression lines. The primer sequences are as follows:

[0180] qRTMYB002-F: 5'-TTCAAAAAGGGCTTGTGGTC-3',

[0181] qRTMYB002-R: 5'-TATTGCCAAGAAGGGAATGC-3'.

[0182] qRTMYB003-F: 5'-CATTCTTGGCAACAGGTGGT-3',

[0183] qRTMYB003-R: 5'-TCGTTTGGTGAGGATGTGGA-3'.

[0184] qRTMYB020-F: 5'-AATGGACAAGGGTGTTGGAG-3',

[0185] qRTMYB020-R: 5'-GACCACCTGTTGCCAAGAAT-3'.

[0186] qRTMYB021-F: 5'-TCCATTTGCATTCCCTTCTC-3',

[0187] qRTMYB021-R: 5'-CCTCCCATGACATCTTTGCT-3'.

[0188] qRTMYB090-F: 5'-GGCCTGCAGAAGATGAGAAG-3',

[0189] qRTMYB090-R: 5'-TCCGGTGAGAAGCAAGAAGT-3'.

[0190] qRTMYB128-F: 5'-TACGAAAGCCTTCAGCACCT-3',

[0191] qRTMYB128-R: 5'-GAAAAAGCTCCCCACGTACA-3'.

[0192] qRTMYB158-F: 5'-GCTTGCCCTAGAGGTCACTG-3',

[0193] qRTMYB158-R: 5'-GGCTATGAGTGCCCATTTGT-3'.

[0194] The expression levels of seven MYB transcription factors related to secondary wall formation (MYB002, MYB003, MYB020, MYB021, MYB090, MYB128 and MYB158) in transgenic lines were significantly higher than those in CK lines ( Figure 13 MYB128 was upregulated most significantly (>8-fold), with expression of the remaining MYB genes reaching 2-7 times that of the CK strain. This synergistic activation of the MYB regulatory network suggests that PmVNS2 may drive ectopic secondary wall deposition during wood formation by acting upstream of the NAC-MYB regulatory cascade.

Claims

1. Application of the Masson pine PmVNS2 gene in promoting secondary wall formation in poplars, characterized in that: The nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The following steps are involved: (1) Construction of a vector for the PmVNS2 gene; (2) transforming the vector of the PmVNS2 gene into poplar tissues or cells; (3) Cultivate and screen transgenic poplar plants with thickened secondary walls.

3. The use according to claim 2, characterized in that The vector is a plant expression vector.

4. The use according to claim 3, characterized in that The plant expression vector is 35S::PmVNS2.

5. Application of the Masson pine PmVNS2 gene in increasing the number of roots, plant height or ground diameter of poplars, characterized in that: The nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.

1.

6. Application of the Masson pine PmVNS2 gene in increasing the number of secondary xylem cell layers in poplar, characterized in that: The nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.

1.

7. Use of the Masson pine PmVNS2 gene in increasing the expression of genes related to lignin synthesis, cellulose synthesis, or MYB transcription factors related to secondary wall formation in poplars, characterized in that: The nucleotide sequence of the Masson pine PmVNS2 gene is shown in SEQ ID NO.

1.

8. The use according to claim 7, characterized in that The poplar lignin synthesis-related genes are PAL4, C4H2, 4CL5, HCT1, C3H3, CCOAOMT1, CCR2, COMT2 or CAD1; the poplar cellulose synthesis-related genes are CesA2B or CesA3A; and the poplar MYB transcription factors are MYB002, MYB003, MYB020, MYB021, MYB090, MYB128 or MYB158.

9. The use of the Masson pine PmVNS2 gene in reducing the expression of genes related to poplar xylan synthesis, characterized in that: The nucleotide sequence of the PmVNS2 gene is shown in SEQ ID NO.

1.

10. The use according to claim 9, characterized in that The poplar xylan synthesis-related gene is GT43B or GT43D.

Images