Chicken sex identification method based on fluorescence labeling

Abstract

The invention discloses a chicken sex identification method based on fluorescence labeling, and belongs to the technical field of gene engineering. The chicken sex identification method comprises the following steps: co-transfecting a CRISPR / Cas9 system and a WPG-EGFP donor plasmid into chicken primordial germ cells PGCs, screening to obtain EGFP positive PGCs, micro-injecting the EGFP positive PGCs into a receptor chicken embryo, hatching to obtain an EGFP reproductive chimera chicken, and identifying the sex through fluorescence labeling, the CRISPR / Cas9 system comprises sgRNA of a targeted chicken W chromosome WPG gene; the WPG-EGFP donor plasmid is constructed by inserting an EGFP gene into a WPG gene locus through a homologous recombination strategy. According to the method, the sex of the chicken can be visually and rapidly identified. The method solves the problems that a traditional sex identification method is complex in operation and depends on sample ages, has the advantages of high efficiency and accuracy, and is suitable for sex control and screening of poultry such as laying hens and broilers.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a chicken sex identification method based on fluorescence marking. Background Art

[0002] In poultry farming, sex identification and sex control are key links in improving production efficiency. For example, egg-laying chicken production requires screening of hens, while broiler chicken production has specific requirements for sex ratio. Traditional methods rely on morphological observation or molecular techniques based on sex chromosomes (Z / W) (such as PCR), but have the following defects: Morphological observation: identification requires waiting until the chicks are sexually mature, which is time-consuming and has a high error rate; Molecular technology: The operation is complex, the cost is high, and it is not applicable to early embryo samples. Among existing gene editing technologies, although CRISPR / Cas9 has been used for poultry gene modification, the integration of sex-specific markers and rapid detection has not yet been achieved.

[0003] In recent years, the rapid development of gene editing technology, especially the widespread application of the CRISPR / Cas9 system, has opened up new possibilities for precise targeted gene insertion. Therefore, how to achieve sex identification of poultry based on the CRISPR / Cas9 system is of great significance. Summary of the Invention

[0004] The present invention aims to provide a method for chicken sex identification based on fluorescent labeling to solve the problems of the prior art. The chicken sex identification method provided by the present invention can quickly identify the sex of chickens in the embryonic or chick stage, breaking through the limitations of traditional technologies.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] Technical Solution 1: A chicken sexing method based on fluorescence markers, comprising the following steps: co-transfecting the CRISPR / Cas9 system and the WPG-EGFP donor plasmid into chicken primordial germ cells (PGCs), screening for EGFP-positive PGCs, and microinjecting them into recipient chicken embryos. Hatching the EGFP-positive chimeric chickens, and identifying their sex based on the presence of the fluorescent marker,

[0007] The CRISPR / Cas9 system includes an sgRNA targeting the WPG gene on the chicken W chromosome; the WPG-EGFP donor plasmid is constructed by inserting the EGFP gene into the WPG gene site through a homologous recombination strategy.

[0008] Furthermore, the sequence of the sgRNA is selected from at least one of SEQ ID NO. 1-3.

[0009] Furthermore, the homologous recombination strategy is homologous direct repair or homology arm-mediated end joining.

[0010] Furthermore, the transfection is co-delivered by using a Cas9 protein and sgRNA complex and Lipofectamine 3000 reagent.

[0011] Furthermore, the screening is performed by flow sorting.

[0012] Furthermore, the amount of cells microinjected is 1 μL.

[0013] Furthermore, the identification of sex by the presence of a fluorescent marker is specifically as follows: the chimeric chicken offspring that expresses green fluorescence is a female chicken, and the offspring that does not express green fluorescence is a male chicken. After the recipient chicken embryo grows up, this fluorescent marker is not limited to the gonads.

[0014] Furthermore, the chicken primordial germ cells PGCs are derived from recessive white-feathered Rock chickens, and the recipient chicken embryos are apricot chickens.

[0015] Technical Solution 2: Application of the chicken sex identification method in poultry sex control and screening.

[0016] The present invention discloses the following technical effects:

[0017] This study utilizes CRISPR / Cas9 technology to precisely insert the EGFP gene into the WPG gene locus on the W chromosome of PGCs. The edited PGCs are then injected into recipient chicken embryos to produce EGFP-producing chimeras. This method establishes a fluorescent marker-based sexing method for chickens. This method enables hens to express green fluorescent protein, while males lack a fluorescent signal. This method can rapidly identify the sex of chickens during the embryonic or chickling stage, overcoming the limitations of traditional techniques. This technology can be extended to all chicken breeds, providing an efficient and accurate solution for poultry farming. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 The results of DF-1 cells transfected with three sgRNAs; A is a schematic diagram of the knockout plasmid; B is DF-1 cells selected with puromycin, and NC is the control group. The scale bar is 100 μm; C is the amplification product verified by T7E1 enzyme digestion; D is the sequencing result after the amplification product was connected to the T vector;

[0020] Figure 2The results of DF-1 co-transfection with knockout plasmid and donor plasmid; A is a schematic diagram of the donor plasmid; B is the co-transfection of HDR donor plasmid and knockout plasmid; C is the co-transfection of HMEJ donor plasmid and knockout plasmid; D is the flow cytometry analysis result;

[0021] Figure 3 The transfection results of PGCs are shown in Figure 1. A is a bright field image; B is an EGFP enhanced green fluorescence image; C is a merged image of Merge fluorescence + bright field;

[0022] Figure 4 The results of flow cytometry sorting of PGCs cells are shown in Figure 2. Specifically, positive and wild-type PGCs cells were obtained by flow cytometry sorting.

[0023] Figure 5 The results of flow cytometry sorting of PGCs cells are shown in Figure 2. Specifically, strong positive and weak positive PGCs cells were obtained by flow cytometry sorting.

[0024] Figure 6 The results of two flow cytometry sorting of PGCs cells; A is positive PGCs cells; B is strongly positive PGCs cells; C is weakly positive PGCs cells;

[0025] Figure 7 PCR verification of gene knock-in accuracy; A is a schematic diagram of primer design; BE are the amplification results of primers 1, 2, 3, and 4, respectively; KI represents positive PGCs cells, SP represents positive PGCs cells, WP represents weakly positive PGCs cells, and WT represents wild-type PGCs cells;

[0026] Figure 8 Verification of the migration ability of PGCs; A is the gonad of a normal chicken embryo at 7 days of development; B is the gonad of a recipient chicken embryo at 7 days of development; C is the gonad of a recipient chicken embryo at 14 days of development; scale bars are 2000 μm; Bright field represents bright field images; EGFP represents enhanced green fluorescence images; Merge represents the merged images of fluorescence and bright field;

[0027] Figure 9 These are photos of EGFP reproductive chimera chicks with different numbers; among them, A is numbered 0040; B is numbered 0036; C is numbered 0033; and D is numbered 0038; the numbers are the wing numbers of the chicks after hatching. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] Example 1: Using EGFP gene to edit hens

[0034] 1. Preparation of Feeder Cells

[0035] Remove cryopreserved primary mouse embryonic fibroblasts (MEFs) from liquid nitrogen, thaw in a 37°C water bath, centrifuge to remove the cryopreservation solution, and seed into 6-well plates. Culture in DMEM / F12 medium supplemented with 10% fetal bovine serum at 37°C until confluence exceeds 95%. Treat with 10 μg / mL mitomycin C for 2 hours, then replace with normal growth medium until ready for use.

[0036] 2. Isolation of PGCs

[0037] Fertilized recessive white-feathered Rock chicken eggs (purchased from Guangdong Wen's Food Group Co., Ltd.) were incubated at a constant temperature and humidity until embryonic day 6.5-7 (Hamburger Hamilton Stages 30, HH30). The gonads were removed and digested with 0.025% trypsin to obtain PGCs, which were then inoculated onto MEF feeder layers for expansion.

[0038] 3. Design of sgRNA targeting pseudogenes on chromosome W

[0039] The sequence of the chicken W chromosome WPG gene was found on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). The sgRNA online design website (http: / / crispor.tefor.net / ) was then used to design the sgRNA for the WPG gene. The top three sgRNAs (sgRNA1: ATAGGTTAACCAATCTAGGG (SEQ ID NO.1); sgRNA2: GAAATAGGTTAACCAATCTA (SEQ ID NO.2); sgRNA3: GCCAATCTAGGGTGGATAAAC (SEQ ID NO.3)) were selected based on the website's prediction scores. The corresponding DNA fragments were integrated into the PX459 plasmid by Qingke Biotechnology. The results of the three sgRNA transfections into DF-1 cells are shown in Figure 2. Figure 1 .

[0040] 4. Construction of the WPG-EGFP Donor Plasmid

[0041] Referring to the WPG (414742) sequence in the NCBI database, the 800 bp upstream and downstream sequences of sgRNA2 (SEQ ID NO.4 and SEQ ID NO.5) were obtained as homologous sequences to be inserted into the donor plasmid.

[0042] SEQ ID NO.4:

[0043] ;

[0044] SEQ ID NO.5:

[0045] ATTGACAATTTATCTATCTCCAGGGGAAAGCTGTATACAAGCAAGGAACTAAATCAGTGCCAACAACAACGATAAATGTTTTAGAATCACCTAATGTGCGGAATGTCAATTTTAACTGAAATCCACTTCAGGTCAGATTATCTCTCAGACTCAACCTGAACCCATTACTTAGAAGATGGTCTGAAGTCCAGCTGAAGCACTTAAAACACAAAGTGAACTGAGTGGTTCCTAAACAAAACGCATTCAAAGTAGTAGTAGTTTGGTTTCCTTTCCCAGAAAGAATGCTCTGAGTATGTCTTCAAAGAATTCCACCCTGAATTCTCCTATTCAGTTTTAACAATGAATTACCTAACTCCATATAAATGGAATAAAAAAATTTTGCAACAAAAATCCCTTTGAATGCACACTAGCATTATACTCAATTTACATCCCTAGTGAGAAGGCTAACAAGACTAAATATTTCAATTATTTTTGTAAGCAAGTACAATGGCATAATAAACAGTGACTATTAGAAGATAAATTTGTCAGAAAATTCTGCTCTTGCTGTAGAAATTTTGAAATACCAACATTTTTTGAAGTTGCAATTTTTCTTAAGAAATGTTAATACTGAAATCTAAAATCCTAAATGTACAAAACTGTAAATGTTTCTATCTACAAGATAGCAATCTATGTCCAAAATTACCTGAAGTTTCTTAAACTCCTCTTGCTAGTTGGTAGCCTTGCAAGGGAAGTGAAAATTTCTTCCAGTATTAGCTGTCTATGTTTTTCGTACCTGGAGAAGACCTATTTAACAGTCATAG。

[0046] Design two donor plasmids according to the homologous direct repair strategy (HDR) and the homologous arm-mediated end joining (HMEJ) strategy (vector backbone such as Figure 2(As shown in Figure A). The specific method for constructing the donor plasmid for the HDR strategy is to have the EGFP gene sequence and left and right homology arm sequences synthesized by GenScript Biotech and then inserted into a blank donor plasmid. In the HMEJ strategy, the donor plasmid design principles are essentially the same as those for the HDR strategy, but additional sgRNA2 recognition sequences are introduced at both ends of the HL and HR homology arm sequences to improve site-directed knock-in efficiency.

[0047] EGFP gene sequence (SEQ ID NO.6):

[0048] .

[0049] 5. Propagation and Purification of Targeting and Donor Plasmids

[0050] The WPG gene targeting plasmid and the WPG-EGFP donor plasmid were transformed into competent cells (DH5α), propagated in LB medium containing ampicillin, and then purified using the endotoxin-free plasmid extraction kit of Meiji Bio to obtain high-quality plasmids.

[0051] 6. Co-transfection of DF-1 with the targeting plasmid and donor plasmid

[0052] (1) Cell preparation: One day before transfection, plate cells at an appropriate density into a 12-well plate, ensuring that the cell density reaches 60%-80% confluence on the day of transfection;

[0053] (2) Preparation of complex: Under sterile conditions, prepare two 1.5 mL tubes A and B, add 50 μL of Opti-MEM serum-free medium to each tube; add 500 ng of knockout plasmid and 500 ng of donor plasmid to tube B, then add 2 μL of P3000 reagent to tube B and gently pipette to mix; add 1.5 μL of Lipofectamine 3000 reagent to tube A and gently mix the solution; slowly add the prepared P3000-DNA solution dropwise to the Lipofectamine 3000 solution while gently mixing. Let it stand for 10-15 minutes to form a DNA-Lipofectamine complex;

[0054] (3) Cell incubation: Slowly add the DNA-Lipofectamine complex to the cells and gently shake the well plate to ensure uniform distribution. Then place the 12-well plate in a 37°C, 5% CO2 incubator and incubate for 6 hours. The results of co-transfection of knockout plasmid and donor plasmid into DF-1 are shown in Figure 2 .

[0055] 7. Transfection of PGCs

[0056] (1) PGCs were collected with a pipette, centrifuged at 1000 rpm for 4 min, and then resuspended in Opti-MEM in a 12-well plate. 3 × 10 5 cells / well;

[0057] (2) Prepare two 1.5 mL tubes containing 50 μL of OPTI, labeled as tube A and tube B. Add 72 pmol of Cas9 protein and 72 pmol of EasyEdit sgRNA to tube A, and add 1.5 μL of Lipofectamine 2000 reagent to tube B.

[0058] (3) Prepare two more 1.5 ml tubes containing 50 μL of OPTI, labeled tube C and tube D. Add 1 μg of donor plasmid and 2 μL of P3000 reagent to tube C, and add 1.5 μL of Lipofectamine 3000 reagent to tube D.

[0059] (4) Incubate the liquid in tube A at room temperature for 15 min, and gently mix the liquids in tubes C and D and incubate at room temperature for 15 min;

[0060] (5) Gently mix the liquids in tubes A and B and incubate at room temperature for 10 min. Add the mixed liquids in tubes C and D to a 12-well plate at 100 μL / well.

[0061] (6) Add the mixture of tubes A and B to the same well, 100 μL / well, and incubate the cells in a 37°C, 5% CO2 incubator for 6 h. Then, aspirate the cells and centrifuge to remove the transfection solution. Resuspend the cells in the cell chamber and continue to culture under the feeder layer environment. The transfection results of PGCs are shown in Figure 3 .

[0062] 8. Flow Cytometry Isolation of PGCs

[0063] (1) Collect the transfected PGCs cells and resuspend them in serum-free medium to prepare a uniform cell suspension;

[0064] (2) Filter the cell suspension through a strainer to remove cell clumps and debris;

[0065] (3) The prepared suspension sample is loaded into a flow cytometer for detection. First, the cell population is selected based on the FSC and SSC values, and cell debris is removed. Then, a histogram is drawn with the horizontal axis representing the FITC fluorescence intensity and the vertical axis representing the cell count to analyze the distribution of the green fluorescence signal in the cell suspension.

[0066] (4) Set FITC positive and negative cells, divide different sorting groups according to fluorescence intensity, and finally separate high FITC and low FITC PGCs cells. The results of two flow cytometry sorting of PGCs cells are as follows: Figure 4-Figure 6 shown.

[0067] 7. Identification of Positive PGCs

[0068] To verify whether the EGFP gene is accurately knocked into the WPG gene site of the W chromosome in PGCs, the present invention extracted genomic DNA from strongly positive (SP), weakly positive (WP) and wild-type (WT) PGCs, and designed four pairs of primers for the knock-in site. The results of PCR detection (PCR identification primers for PGCs cell DNA, PCR reaction system and details are shown in Tables 1-3) showed that the expected band was amplified only in positive cells, while no corresponding amplified product was detected in wild-type cells ( Figure 7 ).

[0069] Table 1 PCR identification primers for positive PGCs cell DNA

[0070]

[0071] Table 2 PCR reaction system

[0072]

[0073] Table 3 PCR reaction program

[0074]

[0075] 9. Microinjection of PGCs

[0076] (1) Opening the egg (Xinghua chicken, purchased from Fengkai County Zhicheng Poultry Breeding Co., Ltd.): First, disinfect the surface of the egg with 75% alcohol. Before injection, place the egg horizontally for 30 minutes to allow the embryo to move to the center of the egg. Use curved forceps to carefully open a small hole on the surface of the egg and gently tear open the inner shell membrane. Use a microscope to observe and locate the position of the peripheral blood vessels of the chicken embryo;

[0077] (2) Aspirate cells: Connect the microinjection needle and the mouth pipette, and aspirate the cell fluid into the injection needle. The volume of the liquid in the injection needle should be kept at about 2 μL.

[0078] (3) Cell injection: Adjust the focus of the microscope to clearly observe the direction of blood flow in the peripheral blood vessels. Slowly insert the injection needle into the egg. After touching the blood vessel, slightly force it through the blood vessel, but do not penetrate it completely. At this time, adjust the position by oral suction to ensure that the cell suspension flows with the blood. The injection volume is controlled within 1 μL. After the injection is completed, slowly pull out the needle vertically to avoid collision with the blood vessel;

[0079] (4) Sealing the egg: Cut the sealing film into small pieces of appropriate size and cover the opening of the egg; use a heated alcohol lamp to melt the tweezers and gently melt the edge of the film to ensure that the sealing film is tightly bonded to the surface of the egg to prevent air from entering.

[0080] 10. PGCs migration capability verification

[0081] After the injected and sealed eggs are incubated for another 7 days, the development of the recipient chicken embryos can be observed. At this time, carefully open a small hole in the air chamber of the egg, use tweezers to clamp the head of the chicken embryo, gently pull it out and transfer it to a culture dish. During this process, special attention should be paid to avoid damaging other tissues. Next, use tweezers to remove the head of the chicken embryo and place the chicken embryo in a position with the abdomen facing up. Under a microscope, use pointed tweezers to carefully open the abdominal cavity, gradually lift up the heart, intestines and other visceral tissues, and expose the left and right gonads of the chicken embryo. The exposed gonads are observed under a fluorescence microscope to confirm whether there is expression of green fluorescence (such as Figure 7As shown in Figure 2, green fluorescent PGCs have been accurately inserted into the WPG gene locus on the W chromosome. Among the offspring of EGFP chimeras, those expressing fluorescence are female chickens, while those not expressing fluorescence are male chickens. The presence of green fluorescence indicates that the injected PGCs have successfully migrated and colonized the gonads of the recipient chicken embryos. Figure 8 .

[0082] 11. EGFP germline chimera chicken

[0083] The present invention successfully injected EGFP-expressing strong positive PGCs cells into 70 recipient chicken embryos. Except for the dissected chicken embryos, the remaining embryos continued to incubate for 21 days, and finally successfully hatched 16 chicks. In the early chick stage, 3 chicks did not survive, and currently 13 have survived. This result shows that the present invention successfully obtained the first generation (F0) EGFP reproductive chimera chickens. EGFP reproductive chimera chicks are shown in the photo. Figure 9 .

[0084] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A chicken sex identification method based on fluorescent labeling, characterized in that: The following steps are involved: The CRISPR / Cas9 system and WPG-EGFP donor plasmid were co-transfected into chicken primordial germ cells (PGCs). EGFP-positive PGCs were screened and microinjected into recipient chicken embryos. EGFP-positive chimeric chickens were hatched and their sex was identified by the presence of a fluorescent marker. The CRISPR / Cas9 system includes an sgRNA targeting the WPG gene on the chicken W chromosome; the WPG-EGFP donor plasmid is constructed by inserting the EGFP gene into the WPG gene site through a homologous recombination strategy.

2. The chicken sex identification method according to claim 1, wherein The sequence of the sgRNA is selected from at least one of SEQ ID NO. 1-3.

3. The chicken sex identification method according to claim 1, wherein The homologous recombination strategy is homology direct repair or homology arm-mediated end joining.

4. The chicken sex identification method according to claim 1, wherein The transfection is achieved by co-delivery of Cas9 protein and sgRNA complex and Lipofectamine 3000 reagent.

5. The chicken sex identification method according to claim 1, wherein The screening is performed by flow sorting.

6. The chicken sex identification method according to claim 1, wherein The amount of cells microinjected was 1 μL.

7. The chicken sex identification method according to claim 1, characterized in that: The specific method of identifying sex by the presence or absence of fluorescent markers is: if the gonad tissue expresses green fluorescence, the chicken is a hen; if the gonad tissue has no fluorescence, the chicken is a rooster.

8. The chicken sex identification method according to claim 1, wherein The chicken primordial germ cells (PGCs) are derived from recessive white-feathered Rock chickens, and the recipient chicken embryos are apricot chickens.

9. Use of the chicken sex identification method according to any one of claims 1 to 8 in poultry sex control and screening.

Images