Preparation method and application of radioactive probe based on DTN-SYL3C conjugate

Abstract

The invention discloses a preparation method of a radioactive probe based on a DTN-SYL3C conjugate and application of the radioactive probe in dynamic PET imaging of EpCAM positive colorectal cancer, and the preparation method of the radioactive probe comprises the following steps: firstly, constructing a T20-DTN-DBCO nano structure through self-assembly by a one-step annealing method; then, an azide modified SYL3C aptamer and the T20-DTN-DBCO nanostructure are subjected to directional coupling, a T20 modified DTN-SYL3C conjugate is obtained, and the T20 modified DTN-SYL3C conjugate is purified through agarose gel electrophoresis; and finally, carrying out complementary pairing on the < 68 > Ga-NOTA-A20 and the T20-DTN-SYL3C through a base, so as to obtain the < 68 > Ga-DTN-SYL3C probe. The radioactive probe provided by the invention can prolong the in-vivo circulation time of the aptamer and improve the targeted uptake of the tumor site, and meanwhile, the pharmacokinetics improvement effect can be accurately quantified by matching with dynamic PET (Polyethylene Terephthalate).

Description

Technical Field

[0001] The present invention relates to the fields of nuclear medicine and molecular imaging, and in particular to a preparation method and application of a radioactive probe based on a DTN-SYL3C conjugate. Background Art

[0002] Epithelial cell adhesion molecule (EpCAM) is an important target for the diagnosis and treatment of colorectal cancer. The aptamer SYL3C can specifically target EpCAM, but its rapid metabolism and short tumor retention limit imaging effectiveness. DNA tetrahedron (DTN) nanocarriers can improve the in vivo circulation properties of aptamers, but quantitative pharmacokinetic validation of DTN conjugation strategies is currently lacking. Summary of the Invention

[0003] In order to solve the above problems, the present invention provides a method based on the radionuclide gallium-68 ( 68 Preparation of a radioactive probe of Ga)-labeled DNA tetrahedron (DTN)-SYL3C aptamer conjugate (DTN-SYL3C) and its application in dynamic PET imaging of EpCAM-positive colorectal cancer.

[0004] To achieve the above object, the technical solution adopted by the present invention is:

[0005] A method for preparing a radioactive probe based on a DTN-SYL3C conjugate comprises the following steps:

[0006] Synthesis of S1 and DTN-SYL3C

[0007] S1.1. DTN framework construction: Two of the four DTN chains were modified with T20 chains and DBCO groups, respectively, and then self-assembled to construct a T20-DTN-DBCO nanostructure through a one-step annealing method; wherein the four DTN chains are:

[0008] S1:

[0009] ATTGCTGTATTGGCTCTGGTGATGATGCGTTAAAGGATCTCGTATAGCAGCTCAGTCCACTCGAAC

[0010] T20-S2:

[0011] TTTTTTTTTTTTTTTTTTTCATAGTCAATAACGCATCACCAGAGCCAAATGACGACATCTGTGCGATGAAACCTAGCAGACC

[0012] DBCO-S3:

[0013] DBCO-GAGATCCTATGACTATGGGTCTGCTAGGTACAGTCTGTCGCTTATGCACTAGAGCTGCTATAC

[0014] T20-S4:

[0015] TTTTTTTTTTTTTTTTTTTGTCGTCAAACAGCAATGTTCGAGTGGACAAGTGCATAAGCGACAGACTGATCATCGCACAGA;

[0016] S1.2 Aptamer Coupling: Using click chemistry, the azide-modified SYL3C aptamer (Azide-SYL3C) was directionally coupled to the T20-DTN-DBCO nanostructure at a 1:1 molar ratio to obtain the T20-modified DTN-SYL3C conjugate, which was then purified by agarose gel electrophoresis.

[0017] S2. Radiolabeling

[0018] S2.1, 68 Ga elution: elution to obtain 68 GaCl3 solution, adjust pH to 4.0-4.5;

[0019] S2.2, NOTA chelation: To pH = 4.0-4.5 68 An appropriate amount of NOTA-A20 (nucleic acid precursor) was added to the GaCl3 solution, and after the reaction, it was purified by PD-10 column to obtain 68 Ga-NOTA-A20;

[0020] S2.3. Complementary pairing markers: 68 Ga-NOTA-A20 and T20-DTN-SYL3C are complementary to each other through base pairing, and the obtained 68 Ga-DTN-SYL3C probe.

[0021] Furthermore, the step S1.1 specifically includes the following steps:

[0022] Each DTN single chain powder was dissolved in ultrapure water and centrifuged to prepare a concentration of 100 μ The M solution was set aside, and each single strand was added to the TM buffer in a ratio of 1:1:1:1 and mixed. A gradient annealing program was performed: 95°C for 10 min → linearly cooled to 4°C for 20 min to obtain DBCO-modified DNA tetrahedron, namely T20-DTN-DBCO nanostructure.

[0023] Furthermore, the TM buffer system is: 10 mM Tris-HCl, 5 mM MgCl2, pH 8.0.

[0024] Furthermore, in step S1.2, the specific process of directional coupling is as follows:

[0025] Using click chemistry, 100 μ MAzide-SYL3C single chain and T20-DTN-DBCO were mixed and shaken at a molar ratio of 1:1 and reacted in a 29°C metal bath at 400 rpm for 2 h to generate the T20-DTN-SYL3C complex. The reaction system was filtered through a 30 kDa ultrafiltration tube (7500 g, 10 min) to remove unbound single-chain small molecules and then purified by agarose gel electrophoresis-gel recovery.

[0026] Furthermore, in step S2.1, 68 Ge / 68 The radioactivity of 3 mCi / mL was obtained by eluting with 0.1 M HCl in the Ga generator. 68 For GaCl3 solution, adjust the pH to 4.0-4.5 using 0.5 M sodium acetate.

[0027] Furthermore, in step S2.2, NOTA-A20 (nucleic acid precursor) and 68 GaCl3 was reacted at 37°C and 400 rpm for 30 min.

[0028] Furthermore, in step S2.3, 68 Ga-NOTA-A20 and T20-DTN-SYL3C were base-paired at 37°C and 400 rpm for 10 minutes.

[0029] The radioactive probe prepared by the method for preparing a radioactive probe based on a DTN-SYL3C conjugate described in the present invention can be used in dynamic PET imaging of EpCAM-positive colorectal cancer.

[0030] The present invention successfully synthesized a radioactive probe that can be used to target colorectal cancer using the DTN coupling strategy. 68 Ga-DTN-SYL3C: Corresponding results demonstrate that this probe exhibits longer in vivo circulation, higher targeted uptake at tumor sites, and superior performance compared to SYL3C alone. Furthermore, dynamic PET can precisely quantify the effect of DTN conjugation on the pharmacokinetics of the aptamer, enabling quantitative evaluation. DETAILED DESCRIPTION

[0031] The present invention will be described in detail below with reference to specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those skilled in the art, several variations and improvements can be made without departing from the scope of the present invention. These all fall within the scope of protection of the present invention.

[0032] Example 1: Preparation 68 Ga-DTN-SYL3C probe

[0033] Synthesis of S1 and DTN-SYL3C

[0034] 1.1. DTN framework construction: involving four single chains of DTN, two of which are modified with T20 chain and dibenzocyclooctyne (DBCO) group respectively. The four single chains are:

[0035] S1:

[0036] ATTGCTGTATTGGCTCTGGGTGATGCGTTAAAGGATCTCGTATAGCAGCTCAGTCCACTCGAACT20-S2:

[0037] TTTTTTTTTTTTTTTTTTTCATAGTCAATAACGCATCACCAGAGCCAAATGACGACATCTGTGCGATGAAACCTAGCAGACC

[0038] DBCO-S3:

[0039] DBCO-GAGATCCTATGACTATGGGTCTGCTAGGTACAGTCTGTCGCTTATGCACTAGAGCTGC TATAC

[0040] T20-S4:

[0041] TTTTTTTTTTTTTTTTTTTTGTCGTCAAACAGCAATGTTCGAGTGGACAAGTGCATAAGCGACAGACTGATCATCGCACAGA

[0042] The single-chain S1, single-chain T20-S2, single-chain DBCO-S3, and single-chain T20-S4 powders were dissolved in ultrapure water and centrifuged to prepare a concentration of 100 μThe DTN single chains were mixed in a TM buffer (10 mM Tris-HCl, 5 mM MgCl2, pH 8.0) system at a ratio of 1:1:1:1, and a gradient annealing program was performed: 95°C for 10 min → linearly cooled to 4°C for 20 min to self-assemble into T20-DTN-DBCO nanostructures.

[0043] 1.2 Aptamer coupling:

[0044] 1.2.1 Directed Coupling

[0045] Using click chemistry, the azide-modified SYL3C aptamer (Azide-SYL3C) was coupled to the T20-DTN-DBCO nanostructure at a 1:1 molar ratio to obtain the T20-modified DTN-SYL3C conjugate, which was then purified by agarose gel electrophoresis. μ The MAzide-SYL3C single chain was dissolved in ultrapure water and shaken, then mixed with DTN-DBCO at a molar ratio of 1:1 and shaken. The mixture was then reacted in a metal bath (400 rpm) at 29°C (room temperature) for 2 h to generate the T20-DTN-SYL3C complex. The reaction system was passed through a 30 kDa ultrafiltration tube (7500 g, 10 min) to remove unbound single-chain small molecules. The complex was then purified by agarose gel electrophoresis-gel recovery: a 2% agarose gel (Solar Red stained, prepared by intermittent heating) was prepared, and after electrophoresis at 110 V for 25 min, the target band (approximately 247 bp) was located under a UV transilluminator.

[0046] 1.2.2, Use "confined electrophoresis" technology:

[0047] A collection tank was prefabricated 2 mm ahead of the migration path of the strip. The target product was concentrated in the tank by a second energization. The collected solution was concentrated by ultrafiltration (30 kDa, 7500 g) and stored at 4°C until use.

[0048] S2. Radiolabeling

[0049] 2.1、 68 Ga elution: from 68 Ge / 68 Ga generator was eluted with 0.1M HCl to obtain 68 GaCl3 solution (radioactivity 3 mCi / mL) was adjusted to pH 4.0-4.5 using 0.5 M sodium acetate.

[0050] 2.2. NOTA chelation: Add NOTA-A20 (nucleic acid precursor) and 68 GaCl3 reaction (37 ° C, 400 rpm, 30 min), and then purified by PD-10 column to obtain68 Ga-NOTA-A20; specifically, 68 4 mL of GaCl3 solution is usually taken, 290 μL of 0.5 M sodium acetate buffer is added to each tube, mixed, and the pH is adjusted to 4.0-4.5. Then, NOTA-A20 (nucleic acid precursor) is added and reacted at 37°C, 400 rpm for 30 min. 68 The radioactivity of GaCl3 ranges from 3 to 4 mCi, the volume is 1 mL, the concentration of NOTA-A20 is 100 μM, and the feed volume is 30 μL (ie, 3 nM).

[0051] 2.3 Complementary pairing markers: 68 Ga-NOTA-A20 and T20-DTN-SYL3C were paired by base complementation (37°C, 400 rpm, 10 min) to obtain 68 Ga-DTN-SYL3C probe. Purified by PD-10 column 68 The concentration of Ga-NOTA-A20 in a single tube was measured by a microplate reader, and the relevant molar concentration was calculated. Since there are two T20s on the T20-DTN-SYL3C conjugate, both can pair with the A20 chain according to the principle of base complementary pairing. Therefore, the T20-DTN-SYL3C and 68 The Ga-NOTA-A20 molar ratio is roughly maintained at 1:2.

[0052] Comparative Example 1: Preparation 68 Ga-DTN probe

[0053] Synthesis of S1 and T20-DTN

[0054] The single chains S1, T20-S2, S3, and T20-S4 were self-assembled into T20-DTN nanostructures by a one-step annealing method (95°C → 4°C gradient cooling);

[0055] S2. Radiolabeling

[0056] 68 The synthesis of Ga-NOTA-A20 was the same as in Example 1. 68 Ga-NOTA-A20 and T20-DTN were prepared by base complementary pairing (37°C, 400 rpm, 10 min). 68 Ga-DTN probe.

[0057] Comparative Example 2: Preparation 68 Ga-SYL3C probe

[0058] S1, 68 Ga elution

[0059] from68 Ge / 68 Ga generator was eluted with 0.1M HCl to obtain 68 GaCl3 solution (radioactivity 3 mCi / mL) was adjusted to pH 4.0-4.5 using 0.5 M sodium acetate.

[0060] S2, NOTA chelation

[0061] Add NOTA-SYL3C and 68 GaCl3 reaction (37 ° C, 400 rpm, 30 min), and then purified by PD-10 column to obtain 68 Ga-SYL3C probe. NOTA-SYL3C is essentially a single-stranded DNA modified with a NOTA group, synthesized by our company (Beixin, Suzhou).

[0062] Example 2: HPLC verification of radioactive probe labeling

[0063] Use HPLC (size exclusion column) to run the precursors NOTA-SYL3C, T20-DTN, and T20-DTN-SYL3C respectively, and observe the peaks and peak times of the three in the nucleic acid detection channel (260nm); after completing the relevant radioactive labeling, run the samples separately. 68 Ga-SYL3C, 68 Ga-DTN and 68 Ga-DTN-SYL3C was detected using the radioactivity detection channel (AD) for peak and elution time. HPLC results showed that the main peak of the precursor NOTA-SYL3C was a sharp peak with a peak at 8-9 minutes and a duration of 2 minutes. T20-DTN had a single sharp peak at 6 minutes and a duration of 1.5-2 minutes. T20-DTN-SYL3C had a double M-like peak with one high and one low peak at 5.5 minutes and a duration of 1.5 minutes. The corresponding radioactive peak had a slightly delayed elution time, but the peak shape and timing were essentially similar to the precursor peak (due to a slight peak shape shift caused by the increased molecular weight after radiolabeling).

[0064] Example 3: Pharmacokinetic study in healthy mice

[0065] Plasma half-life determination: experimental group was injected via tail vein 68 Ga-DTN-SYL3C (50-100 μCi) (n=5) was injected into BALB / c female mice (6-7 weeks old). 68 Ga-SYL3C.

[0066] Treatment method: Blood samples were collected through the eye socket at different time points after injection (1 min, 5 min, 10 min, 15 min, 30 min, 45 min, 60 min, 120 min and 240 min). The radioactivity was measured using a γ counter and the plasma half-life (T) was calculated using a two-compartment model. 1 / 2 ) and the area under the curve (AUC 0-∞ ). The results show that 68 Ga-DTN-SYL3C and 68 Ga-SYL3C reaches the peak of radioactivity in the blood in about 5 minutes. 68 The decrease of Ga-SYL3C was faster.

[0067] 68 AUC of Ga-SYL3C 0-∞ 421.4±40.69%ID·g -1 h, 68 AUC of Ga-DTN-SYL3C 0-∞ 755.2±68.21%ID·g -1 ·h, and its in vivo bioavailability was increased by an average of 1.8 times compared with that of SYL3C alone.

[0068] 68 T of Ga-SYL3C 1 / 2 =7.26±0.17min, 68 Ga-DTN-SYL3C T 1 / 2 =11.39±2.66min, which was 1.6 times longer on average than that of SYL3C alone.

[0069] These results demonstrate that the DTN coupling strategy in healthy mice can improve the in vivo circulation of the SYL3C aptamer to a certain extent.

[0070] Example 4: Dynamic PET Imaging

[0071] 4.1 Preparation before imaging:

[0072] (1) Model construction: HT-29 colorectal cancer cells (EpCAM positive) were inoculated subcutaneously into BALB / c nude mice (5-6 weeks old) and used for imaging after the tumor volume reached 8-10 mm.

[0073] (2) Preparation of indwelling needle for dynamic scanning: Take a polyethylene microtube with a length of 15 cm, insert the metal needle part of a syringe with an outer diameter of 13 mm (21G) and 25 mm (25G) at both ends respectively, then use a 1 mL syringe to draw 0.5 mL of PBS and push it at a constant speed within 10 seconds. If there is no resistance and no leakage, it is considered to be unobstructed. After completion, sterilize and set aside.

[0074] 4.2 Imaging process:

[0075] (1) Probe injection: Injection through the tail vein 68 Ga-DTN-SYL3C (50-100 μCi) (n≥3), control group included 68 Ga-SYL3C and 68 Ga-DTN.

[0076] (2) Dynamic scanning: A small animal PET system (Siemens Inveon MM) was used for 60 minutes of dynamic imaging. The parameters were the OSEM3D-PSF reconstruction algorithm, the matrix size was 320 × 320 × 200, and the frame structure was: 60 s × 10 frames + 300 s × 10 frames.

[0077] (3) Data analysis: Tumors, heart, liver, kidneys and other organs were delineated by ROI (region of interest), and radioactive uptake (%ID / g) and time-activity curve (TAC) were calculated to analyze the probe uptake and metabolic characteristics in EpCAM-positive colorectal cancer tumors.

[0078] (4) Biodistribution Verification: After imaging, mice were sacrificed and the tumor and major organs (blood, brain tissue, heart, lungs, liver, spleen, kidneys, stomach tissue, large intestine, small intestine, and muscle tissue) were dissected and weighed. The radioactivity distribution was measured using a gamma counter. After attenuation correction, the results were expressed as % ID / g. The tissue / blood ratio (T / B) and tissue / muscle ratio (T / M) were calculated.

[0079] PET imaging shows:

[0080] Metabolic status: 68 The radioactive signal of Ga-SYL3C was mainly concentrated in the kidney. After 5 minutes, the kidney signal continued to decrease, while the radioactive concentration in the bladder continued to increase, indicating that the aptamer was mainly metabolized by the kidney. 68 Ga-DTN and 68 The radioactive signals of Ga-DTN-SYL3C were mainly concentrated in the liver and kidneys. After 30 minutes, the liver and kidney signals gradually decreased (mainly in the kidneys), indicating that both were metabolized by the kidneys and liver, mainly in the kidneys.

[0081] According to the dynamic curve of kidney and heart uptake, 68 Ga-SYL3C, 68 Ga-DTN and 68The half-lives of Ga-DTN-SYL3C in the kidney were 6.62±2.13min, 9.45±4.14min and 21.65±6.77min, respectively, and the half-lives in the heart were 5.13±1.59min, 9.19±2.88min and 16.00±2.04min, respectively.

[0082] After DTN conjugation, the in vivo circulation time of SYL3C was extended by an average of 2.5 times.

[0083] Outline the region of interest of the image at 1 hour: 68 Ga-SYL3C, 68 Ga-DTN, 68 The uptake values ​​of Ga-DTN-SYL3C in tumors were 0.43±0.23%ID / g, 0.39±0.16%ID / g, and 1.59±0.55%ID / g, respectively. 68 Ga-DTN-SYL3C has the best tumor imaging effect.

[0084] It can be seen that the DTN coupling strategy can effectively prolong the circulation time of the aptamer in vivo and enhance the targeted uptake of the tumor site. 68 The Ga-DTN-SYL3C probe has higher value in dynamic PET imaging of EpCAM-positive colorectal cancer than the aptamer alone.

[0085] In addition, PET was used to accurately quantify the improvement effect of DTN coupling on the pharmacokinetics of the aptamer. The results showed that the biodistribution results were consistent with the dynamic PET delineation results: 1h time point 68 Ga-SYL3C, 68 Ga-DTN and 68 The uptake values ​​of Ga-DTN-SYL3C were 0.27±0.22%ID / g, 0.32±

[0086] 0.16%ID / g and 0.89±0.30%ID / g, T / M were 1.49, 0.92 and 1.87 respectively; T / B were 0 / 84, 0.53 and 1.75 respectively.

[0087] Example 5: Biosafety Verification

[0088] H&E staining: healthy mice injected 68 After 1 hour of Ga-DTN-SYL3C, the main organs (heart, liver, spleen, lung, and kidney) were taken for pathological sectioning. The radioactivity of the experimental group was 100 μ Ci (n=3); the control group was the PBS group (n=3), and the tissue structure was observed to see if it was abnormal. The results showed that compared with the PBS group, the injection 68The tissue structures of the heart, liver, spleen, kidney, lung and other major organs of Ga-DTN-SYL3C healthy mice were normal, and no obvious pathological changes such as cell damage, inflammatory infiltration or tissue necrosis were observed. 68 Ga-DTN-SYL3C did not cause obvious toxic reactions to the major organs of healthy mice in the short term, demonstrating good biosafety.

[0089] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various variations or modifications within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A method for preparing a radioactive probe based on a DTN-SYL3C conjugate, characterized in that: The steps include: Synthesis of S1 and DTN-SYL3C S1.

1. DTN framework construction: Two of the four single chains of DTN were modified with T20 chains and DBCO groups, respectively, and then self-assembled to construct the T20-DTN-DBCO nanostructure through a one-step annealing method; S1.2 Aptamer Coupling: The azide-modified SYL3C aptamer was directionally coupled to the T20-DTN-DBCO nanostructure at a 1:1 molar ratio using click chemistry to obtain the T20-modified DTN-SYL3C conjugate, which was then purified by agarose gel electrophoresis. S2. Radiolabeling S2.1, 68 Ga elution: elution to obtain 68 GaCl3 solution, adjust pH to 4.0-4.5; S2.2, NOTA chelation: To pH = 4.0-4.5 68 An appropriate amount of NOTA-A20 was added to the GaCl3 solution and purified by PD-10 column to obtain 68 Ga-NOTA-A20; S2.

3. Complementary pairing markers: 68 Ga-NOTA-A20 and T20-DTN-SYL3C are complementary to each other through base pairing, and the obtained 68 Ga-DTN-SYL3C probe.

2. The method for preparing a radioactive probe based on a DTN-SYL3C conjugate according to claim 1, wherein: The four single chains of DTN are: S1： ATTGCTGTATTGGCTCTGGTGATGATGCGTTAAAGGATCTCGTATAGCAGCTCAGTCCACTCGAAC T20-S2: TTTTTTTTTTTTTTTTTTTCATAGTCAATAACGCATCACCAGAGCCAAATGACGACATCTGTGCGATGAAACCTAGCAGACC DBCO-S3: DBCO-GAGATCCTATGACTATGGGTCTGCTAGGTACAGTCTGTCGCTTATGCACTAGAGCTGCTATAC T20-S4: TTTTTTTTTTTTTTTTTTTGTCGTCAAACAGCAATGTTCGAGTGGACAAGTGCATAAGCGACAGACTGATCATCGCACAGA.

3. The method for preparing a radioactive probe based on a DTN-SYL3C conjugate according to claim 1, wherein: The step S1.1 specifically includes the following steps: Each DTN single chain powder was dissolved in ultrapure water and centrifuged to prepare a concentration of 100 μ The M solution was set aside, and each single strand was added to the TM buffer in a ratio of 1:1:1:1 and mixed. A gradient annealing program was performed: 95°C for 10 min → linearly cooled to 4°C for 20 min to obtain DBCO-modified DNA tetrahedron, namely T20-DTN-DBCO nanostructure.

4. The method for preparing a radioactive probe based on a DTN-SYL3C conjugate according to claim 3, wherein: The TM buffer system is: 10 mM Tris-HCl, 5 mM MgCl2, pH 8.

0.

5. The method for preparing a radioactive probe based on a DTN-SYL3C conjugate according to claim 1, wherein: In step S1.2, the specific process of directional coupling is as follows: Using click chemistry, 100 μ The MAzide-SYL3C single chain and T20-DTN-DBCO were mixed and shaken at a molar ratio of 1:1 and reacted in a metal bath at 29°C and 400 rpm for 2 h to generate the T20-DTN-SYL3C complex. The reaction system was filtered through a 30 kDa ultrafiltration tube to remove unbound single-chain small molecules and then purified by agarose gel electrophoresis-gel recovery method.

6. The method for preparing a radioactive probe based on a DTN-SYL3C conjugate according to claim 1, wherein: In step S2.1, 68 Ge / 68 The radioactivity of 3 mCi / mL was obtained by eluting with 0.1 M HCl in the Ga generator. 68 For GaCl3 solution, adjust the pH to 4.0-4.5 using 0.5 M sodium acetate.

7. The method for preparing a radioactive probe based on a DTN-SYL3C conjugate according to claim 1, wherein: In step S2.2, NOTA-A20 and 68 GaCl3 was reacted at 37°C and 400 rpm for 30 min.

8. The method for preparing a radioactive probe based on a DTN-SYL3C conjugate according to claim 1, wherein: In step S2.3, 68 Ga-NOTA-A20 and T20-DTN-SYL3C were subjected to base complementary pairing reaction at 37°C and 400 rpm for 10 minutes.

9. Use of a radioactive probe prepared by the method for preparing a radioactive probe based on a DTN-SYL3C conjugate according to any one of claims 1 to 8 in dynamic PET imaging of EpCAM-positive colorectal cancer.