Methyltransferase CicOMT10 mutant, preparation method, biological material and application
By performing amino acid mutations on the CicOMT10 enzyme, highly active methyltransferase mutants N179A and T316A were constructed, which solved the problem of low catalytic efficiency of existing methyltransferases and achieved the effect of highly efficient catalytic conversion of eriodictyol to hesperetin.
Patent Information
- Application Number
- CN202510907125.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-02
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2045-07-02
AI Technical Summary
The catalytic efficiency of existing methyltransferases is limited and cannot meet the needs of industrial production.
By mutating the 179th and/or 238th amino acids of the CicOMT10 enzyme, its hydrophobicity and steric hindrance were changed, and high-activity methyltransferase mutants N179A and T316A were constructed.
The catalytic efficiency of methyltransferase is significantly improved, and it can efficiently catalyze the conversion of eriodictyol into hesperetin.
Smart Images

Figure CN120591230A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of mutation or genetic engineering, and in particular to a methyltransferase CicOMT10 mutant, a preparation method, a biomaterial and an application. Background Art
[0002] There are many types of methylated modifications in natural products. Methylation can significantly improve the water solubility, stability, and bioactivity of natural products. It is also a key step in the production of various important natural products and a significant source of medicinal natural products.
[0003] Hesperetin is a natural flavonoid compound primarily derived from the peel and young fruit of Citrus plants (such as sweet oranges and lemons) in the Rutaceae family. It is produced by the hydrolysis of hesperidin. It exhibits a wide range of biological activities, including antioxidant (scavenging peroxynitrite ions), anti-inflammatory (inhibiting inflammatory mediators such as TNF-α and IL-6, with a greater effect than hesperidin), lipid-lowering (inhibiting cholesterol-forming enzymes), cardiovascular protection (reducing vascular permeability and preventing thrombosis), and anti-tumor (inhibiting gene mutations). In the pharmaceutical field, it is used in stomachic and expectorant medications and as an adjuvant in anti-tumor treatments. In the food industry, it is added to beverages as a natural antioxidant (such as the American health product "Vitality 50"). Its antioxidant properties are used in cosmetics (such as Clarins Night Cream) to delay aging. Industrial production typically uses an aqueous method to extract hesperidin through high-temperature hydrolysis. In recent years, microbial synthesis has improved its efficiency. Research focuses on functional development (such as chronic disease prevention and treatment) and formulation optimization (microencapsulation to improve absorption) to promote its innovative applications in functional foods and pharmaceuticals. Biologically catalyzed methylation modification is mainly completed by methyltransferase, but the catalytic efficiency of methyltransferase is limited and the production efficiency is low. Summary of the Invention
[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a methyltransferase CicOMT10 mutant, a preparation method, a biomaterial and an application.
[0005] To achieve the above object, the technical solution adopted by the present invention is: In the first aspect, the present invention provides a methyltransferase CicOMT10 mutant, wherein the methyltransferase CicOMT10 mutant is mutant N179A or mutant T316A; the mutant N179A is obtained by mutating the asparagine at position 179 of the CicOMT10 enzyme as shown in the amino acid sequence of SEQ ID NO.1 to alanine, and the mutant T316A is obtained by mutating the threonine at position 316 of the CicOMT10 enzyme as shown in the amino acid sequence of SEQ ID NO.1 to alanine.
[0006] Natural methyltransferase enzyme activity is insufficient, and its reaction environment is often difficult to meet the optimal conditions of natural enzyme. Along with the correlation technologies such as molecular biology and genetic engineering gradually mature, protein sequence is edited and revised, and the interpretation of enzyme catalysis mechanism and the design of guidance enzyme can be strengthened. Therefore, the present invention, by bioinformatics techniques such as molecular docking and mutation free energy prediction of protein and substrate, builds the mutation library of methyltransferase, provides a kind of high-energy methyltransferase mutant, to solve the problem of methyltransferase activity deficiency.
[0007] The present invention selects amino acids 164 and 238 in the active pocket of the CitOMT enzyme. After the amino acids at positions 164 and / or 238 are mutated to alanine with a strongly hydrophobic side chain and weak steric hindrance, the catalytic efficiency of the methyltransferase can be greatly improved.
[0008] Preferably, the amino acid sequence of the mutant N179A is shown in SEQ ID NO: 3.
[0009] Preferably, the amino acid sequence of the mutant T316A is shown in SEQ ID NO:5.
[0010] In a second aspect, the present invention provides a biomaterial for the methyltransferase CicOMT10 mutant described in the first aspect, wherein the biomaterial comprises any one of the following B1) to B6): B1) a nucleic acid molecule encoding the methyltransferase CicOMT10 mutant according to any one of claims 1 to 3; B2) an expression cassette, said expression cassette comprising the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) and / or the expression cassette described in B2); B4) a recombinant microorganism, the recombinant microorganism comprising the nucleic acid molecule described in B1), the expression cassette described in B2, and / or the recombinant vector described in B3; B5) A recombinant cell, comprising the nucleic acid molecule described in B1), the expression cassette described in B2), and / or the recombinant vector described in B3).
[0011] Preferably, the nucleic acid molecule described in B1) comprises any one of the following coding genes: The nucleotide sequence encoding the mutant N179A gene is shown in SEQ ID NO: 4; The nucleotide sequence encoding the mutant T316A gene is shown in SEQ ID NO: 6.
[0012] In a third aspect, the present invention provides a method for preparing the methyltransferase CicOMT10 mutant in the first aspect, characterized in that it comprises the following steps: S1, connecting the gene encoding the CicOMT10 enzyme to the vector plasmid to obtain a recombinant plasmid; S2. Designing and utilizing site-directed mutagenesis primers to amplify the full length of the plasmid using the recombinant plasmid as a template, and performing enzyme digestion to obtain a mutant product; wherein the site-directed mutagenesis primers are used to perform targeted mutagenesis on at least one of the asparagine at position 179 and the threonine at position 316 of the CicOMT10 enzyme; S3. Transform the mutant product into host cells, screen and induce the host cells to express the methyltransferase CicOMT10 mutant.
[0013] Preferably, the nucleotide sequence of the gene encoding the CicOMT10 enzyme is shown in SEQ ID NO: 2.
[0014] Preferably, in step S2, the nucleotide sequence of the primer set for mutating asparagine at position 179 of the CicOMT10 enzyme to alanine is as shown in SEQ ID NOs: 7-8; and / or, The nucleotide sequences of the primer set for mutating the threonine at position 316 of the CicOMT10 enzyme to alanine are shown in SEQ ID NOs: 9-10.
[0015] Preferably, the vector plasmid is pET28a plasmid, and the host cell is Escherichia coli.
[0016] In a fourth aspect, the present invention provides use of the methyltransferase CicOMT10 mutant in the first aspect in the preparation of hesperetin.
[0017] Preferably, the methyltransferase CicOMT10 mutant is used to catalyze the conversion of eriodictyol into hesperetin.
[0018] Compared with the prior art, the present invention has the following beneficial effects: A methyltransferase mutant of the present invention, based on the CicOMT10 enzyme, mutates the amino acid at position 179 or 316 to alanine with a strongly hydrophobic side chain and weak steric hindrance, thereby being able to convert eriodictyol into hesperetin while significantly improving the catalytic efficiency of the methyltransferase. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 Schematic diagram of the conversion of eriodictyol to homoeriodictyol.
[0020] Figure 2 This is the docking simulation diagram of CitOMT enzyme with eriodictyol and SAM.
[0021] Figure 3 This is a comparison of the catalytic efficiency of wild-type and mutant CitOMT enzymes in converting eriodictyol to homoeriodictyol.
[0022] Figure 4 The HPLC results of wild-type and mutant whole cells of CitOMT enzyme catalyzing the conversion of eriodictyol to homoeriodictyol are shown. DETAILED DESCRIPTION
[0023] The present invention is further described below with reference to the accompanying drawings and specific examples. Experimental methods in the following examples, where specific conditions are not specified, generally follow conventional experimental conditions or those recommended by the manufacturer. Unless otherwise specified, all reagents used in the examples are commercially available. For molecular biology experimental methods not specifically described in these examples, refer to the Molecular Cloning Experiment Guide. Example 1
[0024] This example uses Alphafold3 to simulate the three-dimensional structure of the wild-type methyltransferase and perform molecular docking with the substrate. Through molecular docking, the conformational relationship between the enzyme and the substrate is accurately predicted, and relevant mutation targets are efficiently obtained. Pythia is used to predict the mutation free energy and screen out key mutants.
[0025] Refer to the glycosyl transfer mechanism of eriodictyol to hesperetin, such as Figure 1 shown.
[0026] The three-dimensional structural model of CicOMT10 enzyme was constructed and molecular docking was performed with its substrates eriodictyol and S-adenosylmethionine. Figure 2 As shown. Both eriodictyol and S-adenosylmethionine (SAM) are located in the active pocket of the CicOMT10 enzyme. The methyl group of S-adenosylmethionine is close to eriodictyol, about 3 angstroms away. Among them, the asparagine at position 179 of the enzyme is located in the pocket of the eriodictyol substrate. Mutating it to alanine can reduce the contact steric hindrance between the substrate and the enzyme and increase the volume of the catalytic pocket, thereby improving the catalytic efficiency. At the same time, its threonine at position 316 is located in the channel outside the pocket. Mutating it to alanine can increase the channel volume, increase hydrophobicity and thus improve the catalytic efficiency. Example 2
[0027] Construction of plasmid pET28a-CicOMT10 The steps for constructing a vector containing the methyltransferase sequence of citrus peel are as follows: The methyltransferase gene with the nucleotide sequence of SEQ ID NO: 2 was ligated to the pET-28a plasmid to obtain the plasmid pET28a-CicOMT10; and the plasmid was transformed into Escherichia coli BL21 (DE3).
[0028] The resulting recombinant strain was named BL21(DE3) / pET28a-CicOMT10. The recombinant enzyme strain was used to express the CicOMT10 enzyme having the amino acid sequence shown in SEQ ID NO: 1. Example 3
[0029] Construction of pET28a-CicOMT10 mutant strain 1. Construction of mutant enzyme vector by whole plasmid PCR Step 1) extracting a small amount of the plasmid pET28a-CicOMT10 obtained in Example 2; Step 2) Design mutagenesis primers. The primers include a 15 bp overlap region and a 15 bp extension region. The mutation sites are designed in the overlap region. The mutation sites include single point mutations at Asn179 and Thr316.
[0030] Step 3) Perform PCR amplification of the entire plasmid using plasmid pET28a-CicOMT10 as a template. The PCR system is shown in Table 1: Table 1 Whole plasmid PCR amplification system 2×PrimeSTAR® Max DNA Polymerase 12.5μL pET-28a-CicOMT10 plasmid 1 μL Primer-F 0.5μL Primer-R 0.5μL <![CDATA[ddH2O]]> 25 μL The primers Primer-F and Primer-R are PCR upstream primers and downstream primers designed accordingly according to different mutation sites. The specific primer information is shown in Table 2.
[0031] Table 2 Primers for PCR amplification of single-point mutation plasmids Primer name Sequence (5'-3') (underlined mutant genes) SEQ ID NO. N179A-F GAATGCAGCCGATTACCATGGCAAAGATCTAAGATT 7 N179A-R GGTAATCGGCTGCATTCATCCCATAGGCCTTG 8 T316A-F GGAAAGTGCCTGCAAAATGATGAAGTTTGCCG 9 T316A-R TTTTGCAGGCACTTTCCATTGCATCATTGAAAA 10 Among them, the primer pair N179A-F and N179A-R were used to obtain the mutant enzyme N179A. The amino acid sequence of the mutant N179A was SEQ ID NO: 3, and the nucleotide sequence was SEQ ID NO: 4.
[0032] Primer pair T316A-F and T316A-R were used to obtain mutant T316A. The amino acid sequence of mutant T316A is SEQ ID NO: 5, and the nucleotide sequence is SEQ ID NO: 6.
[0033] PCR amplification program: pre-denaturation at 98°C for 5 min; cycle setting: denaturation at 98°C for 15 s, annealing at 62°C for 30 s, extension at 72°C for 1.5 min, 30 cycles; final extension at 72°C for 10 min; after the reaction, the PCR product was recovered using a kit.
[0034] Step 4) Enzyme digestion to remove the template DNA, and then perform enzyme digestion on the PCR product. The enzyme digestion system is shown in Table 3: Table 3 Enzyme digestion system for whole plasmid PCR products QuickCut DpnⅠ 1 μL PCR products ≤1 μg 10×QuickCut Buffer 3μL <![CDATA[ddH2O]]> Make up to 30 μL The above enzyme digestion system was placed in a 37°C metal bath for digestion for 1 hour. After the reaction was completed, the enzyme digestion product was recovered using a kit.
[0035] 2. Sequencing to verify whether the mutant enzyme strain is successfully constructed The enzyme-digested products were transformed into Escherichia coli BL21 (DE3) competent cells, cultured inverted at 37°C overnight, and the pseudo-positive transformants were picked for sequencing verification. The mutant enzyme-expressing strains BL21 (DE3) / pET-28a-CicOMT10-N179A and BL21 (DE3) / pET-28a-CicOMT10-T316A were successfully obtained. Example 4
[0036] Determination of catalytic efficiency of CicOMT10 and its mutant enzymes in whole-cell reactions 1. Enzyme protein induction of CicOMT10 and its mutant enzyme recombinant strains The strains BL21(DE3) / pET-28a-CicOMT10-N179A and BL21(DE3) / pET-28a-CicOMT10-T316A obtained in Example 3 were streaked and activated on LB plates containing Kan (100 μg / mL). After inverted culture at 37°C overnight, a single colony was picked and inoculated into 1 mL of LB liquid medium containing Kan and cultured at 37°C, shaking at 200 rpm for 12-16 hours. The overnight culture seed solution was inoculated into 100 mL of fresh LB liquid medium containing Kan at a 1% inoculum size and cultured at 37°C, shaking at 200 rpm for 2-3 hours until the OD600 reached 0.6-0.8. IPTG was then added to a final concentration of 0.1 mM, and the culture was cooled to 20°C and cultured at 150 rpm for 18 hours to induce protein expression.
[0037] 2. Whole-cell reaction of CicOMT10 and its mutant enzymes After protein induction, collect the cells by centrifugation at 8000 rpm for 5 min at 4°C, weigh the wet weight of the cells, and prepare the corresponding mother liquor concentrations as shown in the table below. At the same time, prepare the mother liquor concentrations of eriodictyol, Tris-HCl (pH 7.5), and SAM mother liquor.
[0038] The reaction system was configured according to Table 4 below, and the reaction conditions were: 30° C., 200 rpm, 2 h.
[0039] All samples were run in parallel three times. After 24 h, 500 μL of DMSO solution was added to terminate the reaction. The supernatant was collected and filtered after 1 min at 12,000 rpm and then detected by HPLC.
[0040] Table 4 Reaction system Reagents mother liquor Final concentration 500μL system Eriochoride 20mM 1mM 25 μL CicOMT10 bacterial liquid 50mg / mL 5mg / mL 50 μL SAM 200mM 2.5mM- 6.25 μl Tris-HCl buffer pH 7.5 Supplement 500 μl 3. Detection method of hesperetin HPLC was used for quantitative analysis of hesperetin. The chromatographic conditions were as follows: High performance liquid chromatograph: Agilent 1100 Series.
[0041] Column: Diamonsil® 5 μm C18 (250 mm x 4.6 mm x 5 μm).
[0042] Detector: VWD detector, detection wavelength 290nm.
[0043] Mobile phase ratio and elution conditions: flow rate 1 mL / min; column temperature 30°C; injection volume 10 μL; gradient elution system as shown in Table 5: Table 5 HPLC elution system time A% (acetonitrile) B% (acetic acid) 0min 34 66 20min 34 66 4. Results Analysis like Figure 3 and Figure 4 As shown, when eriodictyol was used as substrate for whole-cell catalysis, the whole-cell catalytic efficiency of BL21(DE3) / pET-28a-CicOMT10-N179A was 1.88 times that of the wild-type strain (BL21(DE3) / pET-28a-CicOMT10-WT); The whole-cell catalytic efficiency of BL21(DE3) / pET-28a-CicOMT10-T316A was 2.26 times that of the wild-type strain.
[0044] According to the test results, mutants N179A and T316A have a higher affinity for eriodictyol and can effectively bind to the substrate for catalysis, thereby improving the catalytic efficiency of the specific conversion of eriodictyol to hesperetin.
[0045] In summary, the present invention synthesized mutants N179A and T316A through genetic engineering, and then verified through experiments that they have a higher affinity for eriodictyol, can effectively bind to the substrate for catalysis, and improve the catalytic efficiency of the specific conversion of eriodictyol to hesperetin, and can be used for the preparation of hesperetin.
[0046] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A methyltransferase CicOMT10 mutant, characterized in that The methyltransferase CicOMT10 mutant is mutant N179A or mutant T316A; the mutant N179A is obtained by mutating the asparagine at position 179 of the CicOMT10 enzyme as shown in the amino acid sequence of SEQ ID NO.1 to alanine, and the mutant T316A is obtained by mutating the threonine at position 316 of the CicOMT10 enzyme as shown in the amino acid sequence of SEQ ID NO.1 to alanine.
2. The methyltransferase CicOMT10 mutant according to claim 1, wherein The amino acid sequence of the mutant N179A is shown in SEQ ID NO:
3.
3. The methyltransferase CicOMT10 mutant according to claim 1, wherein The amino acid sequence of the mutant T316A is shown in SEQ ID NO:
5.
4. A biomaterial for producing the methyltransferase CicOMT10 mutant according to any one of claims 1 to 3, characterized in that: The biological material includes any one of the following B1) to B6): B1) a nucleic acid molecule encoding the methyltransferase CicOMT10 mutant according to any one of claims 1 to 3; B2) an expression cassette, said expression cassette comprising the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) and / or the expression cassette described in B2); B4) a recombinant microorganism, the recombinant microorganism comprising the nucleic acid molecule described in B1), the expression cassette described in B2, and / or the recombinant vector described in B3; B5) A recombinant cell, comprising the nucleic acid molecule described in B1), the expression cassette described in B2), and / or the recombinant vector described in B3).
5. The biomaterial according to claim 4, wherein B1) The nucleic acid molecule comprises any one of the following encoding genes: The nucleotide sequence encoding the mutant N179A gene is shown in SEQ ID NO: 4; The nucleotide sequence encoding the mutant T316A gene is shown in SEQ ID NO:
6.
6. A method for preparing the methyltransferase CicOMT10 mutant according to any one of claims 1 to 3, characterized in that: The following steps are involved: S1, connecting the gene encoding the CicOMT10 enzyme to the vector plasmid to obtain a recombinant plasmid; S2. Design and use site-directed mutagenesis primers to amplify the full length of the plasmid using the recombinant plasmid as a template, and obtain the mutant product by enzyme digestion; The site-directed mutagenesis primers are used to perform directed mutagenesis on at least one of the asparagine at position 179 and the threonine at position 316 of the CicOMT10 enzyme; S3. Transform the mutant product into host cells, screen and induce the host cells to express the methyltransferase CicOMT10 mutant.
7. The method for preparing a methyltransferase CicOMT10 mutant according to claim 5, wherein The nucleotide sequence of the gene encoding the CicOMT10 enzyme is shown in SEQ ID NO:
2.
8. The method for preparing the methyltransferase CicOMT10 mutant according to claim 5, wherein In step S2, the nucleotide sequences of the primer set for mutating asparagine at position 179 of the CicOMT10 enzyme to alanine are shown in SEQ ID NOs: 7-8; and / or, The nucleotide sequences of the primer set for mutating the threonine at position 316 of the CicOMT10 enzyme to alanine are shown in SEQ ID NOs: 9-10.
9. Use of the methyltransferase CicOMT10 mutant according to any one of claims 1 to 3 in the preparation of hesperetin.
10. The use according to claim 9, characterized in that The methyltransferase CicOMT10 mutant is used to catalyze the conversion of eriodictyol into hesperetin.
Citation Information
Patent Citations
Spray-dried dispersions, formulations, and polymorphs of (s)-5-amino-3-(4-((5-fluoro-2-methoxybenzamido)methyl)phenyl)-1-(1,1,1-trifluoropropan-2-yl)-1h-pyrazole-4-carboxamide
CA3224985A1
Aspartate dehydrogenase mutant and application thereof
CN116286702A
Rhamnose glycosyl transferase mutant and application of rhamnose glycosyl transferase mutant in preparation of NHDC
CN118652868A
Methyltransferase mutant high-throughput screening method, methyltransferase mutant and application
CN119752832A
Genes and uses thereof to modulate secondary metabolite biosynthesis
WO2003097790A2