Application of MYC1 gene in tomato plant dwarfing

Abstract

The invention relates to the field of plant molecular biology, in particular to a gene for controlling stem diameter and height of a tomato plant and application of the gene, the gene is an MYC1 gene, and the MYC1 gene is a nucleotide sequence capable of coding the following protein (a) or (b): (a) a protein composed of an amino acid sequence shown in SEQ ID NO: 2; and (b) a protein which is derived from (a) and has the same enzyme activity, wherein one or more amino acid sequences are substituted, deleted or added into the amino acid sequence in (a). The gene can control the stem diameter and height of a tomato plant, and by increasing the expression quantity of the MYC1 gene in the tomato plant, the stem of the tomato plant can be thickened, the internode spacing of the tomato plant can be shortened, and the tomato plant can be shortened. Furthermore, the stem diameters and heights of different plants and the subsequent cultivation of varieties with different stem diameters and heights can be controlled through a subsequent cloning technology.

Description

Technical Field

[0001] The present invention relates to the field of plant molecular biology, and in particular to a gene for controlling the stem thickness and height of a tomato plant and an application thereof. Background Art

[0002] Tomatoes are one of the most widely cultivated and important vegetable crops in the world, beloved by producers and consumers for their wide adaptability, high yield, rich nutrition, and versatility. Tomato plant stem diameter and height have long been key areas of focus in modern crop breeding. Thicker stems improve the plant's mechanical resistance, making it suitable for simple, trellis-free cultivation. Controlling plant height, a crucial component of ideal plant architecture, has received widespread attention and, crucially, is directly correlated with tomato yield.

[0003] Currently, research on plant stem diameter has primarily focused on Arabidopsis thaliana and woody plants, while relatively little research has been conducted on tomato stem diameter. To date, many genes regulating tomato stem diameter and height remain undiscovered, hindering the development of a comprehensive genetic regulatory network for these traits and hindering the advancement of targeted genetic engineering to improve desirable plant traits. Summary of the Invention

[0004] The present invention discovered that by overexpressing the tomato MYC1 gene, compared with wild-type plants, the stems of transgenic tomato plants became significantly thicker, the plant height was significantly reduced, and a visually obvious dwarf phenotype appeared.

[0005] One of the purposes of the present invention is to protect the use of the MYC1 gene in dwarfing tomato plants, wherein the MYC1 gene is a nucleotide sequence capable of encoding the following (a) or (b) protein: (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; (b) a protein derived from (a) with the same enzymatic activity, in which the amino acid sequence in (a) is substituted, deleted, or one or more amino acid sequences are added.

[0006] Furthermore, the nucleotides in the MYC1 gene coding region are selected from any one of the following (a) or (b): (a) a DNA sequence having a nucleotide sequence as shown in SEQ ID NO: 1; (b) a nucleotide sequence having more than 90% homology with the DNA sequence in (a) and encoding the above-mentioned protein.

[0007] The second purpose of the present invention is to protect the use of primers for detecting the above-mentioned tomato MYC1 gene in screening and cultivating dwarf tomato plants.

[0008] The third object of the present invention is to protect biological materials containing the above-mentioned tomato MYC1 gene, which include expression vectors, engineered bacteria, transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs.

[0009] Furthermore, the engineered bacteria are Escherichia coli and Agrobacterium.

[0010] A fourth object of the present invention is to protect a method for cultivating dwarf tomato plants, which method is to overexpress the above-mentioned tomato MYC1 gene.

[0011] Furthermore, the method includes the following steps: (1) constructing an overexpression vector of the MYC1 gene; (2) transferring the overexpression vector into Agrobacterium and then infecting tomato explants; (3) screening the infected tomato explants to grow callus tissue, and further cultivating to obtain dwarf tomato plants.

[0012] Furthermore, the backbone vector of the overexpression vector is a pHellsgate8 vector.

[0013] Furthermore, the overexpression vector is constructed as follows: using cDNA reverse-transcribed from total RNA of tomato tissue as a template, amplification primers are used to amplify the MYC1 gene to obtain a target gene fragment; the target gene fragment is connected to a linearized pHellsgate8 vector, and the overexpression vector is obtained after transformation.

[0014] Furthermore, the upstream primer sequence of the amplification primer is shown as SEQ ID NO.3, and the downstream primer sequence is shown as SEQ ID NO.4.

[0015] Compared with the existing technology, the core of the present invention lies in: by overexpressing the MYC1 gene, it was found that this gene is related to the height of tomato plants. The stems of the overexpressed plants became significantly thicker, the plant height was significantly reduced, and a visually obvious dwarf phenotype appeared. This has important theoretical significance and practical application value for cultivating ideal tomato varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The relative expression levels of the MYC1 gene in the transgenic plants and AC wild-type plants in Example 3 are detected. Figure 2 The plant height statistics of the transgenic plants and AC wild plants in Example 3; Figure 3 The statistical results of the distance between the 2-3 inflorescences of the transgenic plants and the AC wild plants in Example 3; Figure 4 The statistical results of stem diameter between 2-3 inflorescences of transgenic plants and AC wild plants in Example 3; Figure 5 The phenotypes of the transgenic plants and AC wild-type plants in Example 3 are shown. DETAILED DESCRIPTION

[0017] The present invention discovered that by overexpressing the tomato MYC1 gene, compared with wild-type plants, the stems of transgenic tomato plants became significantly thicker, the plant height was significantly reduced, and a visually obvious dwarf phenotype appeared.

[0018]

[0019] The amino acid sequence (SEQ ID NO.2) is as follows:.

[0020] The present invention will be described in further detail below in conjunction with specific embodiments so that those skilled in the art can more clearly understand the present invention. The following embodiments are only used to illustrate the present invention, but are not limited to limiting the scope of the present invention. Based on the specific embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work belong to the protection scope of the present invention.

[0021] In the examples of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; in the examples of the present invention, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art. In the examples of the present invention, the raw materials used are all conventional commercial products.

[0022] Example 1 Construction of MYC1 gene overexpression vector

[0023] The construction of the MYC1 gene overexpression vector included the following steps: Using primers FW: CATTGGAGAGGACACGCTCGAGCTTCAATTTAATTGAATGACGGACT (shown in SEQ ID NO. 3) and RV: TCTCATTAAAGCAGGACTCTAGAGCTCACTAGGGACATAATTTCATCG (shown in SEQ ID NO. 4), the MYC1 gene was cloned using cDNA reverse-transcribed from total RNA from various tissues of the cultivated tomato cultivar Ailsa Craig (AC, purchased from the Tomato Genetics Center TGRC (https: / / tgrc.ucdavis.edu / )) as a template to obtain the target fragment. The PCR amplification system is shown in Table 1 below, and the amplification procedure is shown in Table 2 below: Table 1

[0024] Table 2

[0025] After amplification, the target fragment was recovered by gel excision.

[0026] The pHellsgate8 vector (an existing plant vector, a gift from CSIRO Plant Industry) was double-digested with X-hoI and X-baI, and the linearized vector was recovered from the gel. The recovered target fragment and linearized vector were then subjected to homologous recombination. The concentrations of the insert and linearized vector were adjusted. The optimal amount of linearized vector used was 0.02 times the number of base pairs of the linearized vector, and the optimal amount of insert used was 0.04 times the number of base pairs of the insert. The required volume can be calculated based on the amount used and the measured concentration. To a 10 μL system, add 2 μL of 5X CE II Buffer, 1 μL of Exnase II, the calculated insert, and the linearized vector. Make up the remaining volume with ddH2O. After adding all reaction solutions in order, gently pipette to mix thoroughly. Then, place the reaction in a PCR machine at 37°C and 30 min for homologous recombination.

[0027] The ligation product was transformed into Escherichia coli, and the Escherichia coli single clone with the correct sequencing result was expanded. The plasmid was extracted using a DNA miniprep kit to obtain the MYC1 gene overexpression vector MYC1-pHellsgate8.

[0028] Example 2 Genetic transformation of MYC1 gene overexpression vector

[0029] The specific steps for genetic transformation of the MYC1 gene overexpression vector are as follows: the constructed, sequenced, recombinant vector is transferred into competent Agrobacterium (C58) for later use. Cotyledonary explants of tomato cultivars AC are infected with Agrobacterium containing the MYC1-pHellsgate8 vector. The infected explants are cultured in the dark and screened until callus forms. The calli are subcultured until growth points develop, which are then transferred to rooting medium. Rooted plants are then transplanted to nutrient soil for growth. PCR detection using sequencing primers indicates that the PCR product bands match the length of the MYC1 gene, indicating a positive transgenic line.

[0030] In Examples 1 and 2, plant-positive detection, E. coli-positive detection, and Agrobacterium-positive detection were all performed using taq-PCR. Positive plants and clones were detected using a primer pair (SEQ ID NO. 7 and SEQ ID NO. 4), and positive clones were sequenced using a sequencing primer pair (SEQ ID NO. 7 and SEQ ID NO. 8). The upstream primer sequence of the sequencing primers was: ACGCACAATCCCACTATCCTTC (shown in SEQ ID NO. 7); the downstream primer sequence was: CGGTAAGGATCTGAGCTACACAT (shown in SEQ ID NO. 8). The taq-PCR detection system is shown in Table 3 below, and the reaction procedure is shown in Table 4 below: Table 3

[0031] Table 4

[0032] The DNA extraction method for plant tissues was as follows: 0.2 g of young leaves from seedlings were placed in 2 mL of EP, and about 750 µL of CTAB extraction solution (with β-mercaptoethanol) was added and ground, and then placed in a 65°C water bath for 50 min; after the water bath, about 750 µL of 24:1 (volume ratio of chloroform and isoamyl alcohol) was added to the centrifuge tube, mixed by inversion, and centrifuged at 10,000 r / min for 10 min; 500 µL of the supernatant was transferred to a new 1.5 mL EP tube, and an equal volume of isopropanol (stored in a -20°C refrigerator) was added, gently mixed, placed in a -20°C refrigerator for 10 min, and centrifuged at 12,000 r / min for 10 min; the supernatant was discarded, and 800 µL of 75% alcohol was added to wash the precipitated DNA, which was centrifuged briefly to remove excess alcohol, and the DNA was dried in a fume hood until translucent; 300 µL of Add ddH2O (the amount added can be adjusted according to different uses) to dissolve the DNA and store at 4°C until use.

[0033] Example 3 MYC1 gene expression test

[0034] (1) Detection of expression levels in transgenic positive plants The young shoot tip tissue of the transgenic plant was taken for RNA extraction. The RNA extraction method is as follows: after grinding with liquid nitrogen, about 0.2 g of sample was taken into a 2.0 mL centrifuge tube that had been frozen in liquid nitrogen, 1 mL of Trizol was added, and the tube was inverted and allowed to stand for extraction for 5 minutes; 200 μL of chloroform was added, and the tube was vigorously inverted for extraction for 15 seconds, and then placed at room temperature for 3 minutes; centrifuged at 4°C and 12000 r / min for 15 minutes; 400 μL of supernatant was transferred to a new 1.5 ml centrifuge tube (the amount of supernatant to ensure RNA purity can be appropriately reduced), an equal volume of ice-cold isopropanol (stored in a -20°C refrigerator) was added, and the tube was gently inverted to mix, and then placed at -20°C for 10 minutes; centrifuged at 4°C and 12000 r / min for 10 minutes; the supernatant was discarded, 1 mL of 75% ethanol (diluted with DEPC water) was added to suspend the precipitate; centrifuged at 12000 r / min for 1 minute Discard the supernatant (repeat steps 6 and 7 once more to improve the purity of the extracted RNA). Place the centrifuge tube in a fume hood to air-dry for 5-10 min. Dissolve the tube in approximately 40 µL (adjust according to the amount of RNA extracted) of DEPC water. Detect RNA quality by agarose gel electrophoresis and determine RNA concentration by absorbance spectrometry. Store at -80°C until ready for use.

[0035] The expression level of the MYC1 gene in the positive transgenic lines (MYC1-OE-10, MYC1-OE-14, and MYC1-OE-15) was detected. The expression level detection steps include RNA extraction, reverse transcription, and gene expression level detection. The RNA reverse transcription steps are as follows: 1) Remove genomic DNA and prepare the mixture shown in Table 5 in an RNase-free centrifuge tube. Pipette to mix thoroughly, centrifuge, and place in a PCR instrument at 42°C for 2 minutes.

[0036] Table 5

[0037] 2) First-strand cDNA synthesis: Add 2 μL of 10X RT Mix and 2 μL of HiScript II Enzyme Mix to the mixture from the previous step. Pipette to mix thoroughly, centrifuge, and place in a PCR instrument. Set the reaction schedule to: 50°C for 15 min; 85°C for 2 min. After the reaction is complete, the product can be used directly in qPCR reactions or stored at -20°C.

[0038] 3) Determination of relative expression of MYC1: The relative expression of MYC1 was determined using the SYBR mix system as shown in the following table. The internal reference gene Solyc11g005330 was selected. The relative expression of the gene was tested according to conventional detection methods in the field. The reaction system is shown in Table 6 below, and the SYBR mix system in Table 6 is shown in Table 7 below: Table 6

[0039] Table 7

[0040] In the table, Q_FW and Q_RV are the upstream primer and downstream primer of the expression detection primer, respectively. The expression detection primer of the internal reference gene Solyc11g005330 is: Q_FW: GTCCTCTTCCAGCCATCCA; Q-RV: ACCACTGAGCACAATGTTACCG.

[0041] The primers for detecting the expression of MYC1 gene are: Q_FW: GCCGTTTTTCAATCAAGAGTCAC (SEQ ID NO.5); Q_RV: CGACCCTCTCCGTTTATTCTTATC (SEQ ID NO. 6).

[0042] 4) Test results such as Figure 1 As shown, the relative expression level of the MYC1 gene in the tomato plants transformed with the MYC1-pHellsgate8 vector was significantly increased compared with the wild-type control (AC). The specific relative expression level test of the MYC1 gene is shown in Table 8.

[0043] Table 8 Detection results of relative expression of MYC1 gene

[0044] (2) Statistics of plant height and distance between 2-3 inflorescences of transgenic positive plants The plant height and the distance between 2-3 inflorescences of MYC1 gene overexpressing plants were statistically analyzed. The statistical results of tomato plant height are shown in Table 9 and Figure 2 As shown in Table 10 and Table 11, the statistical results of the 2nd and 3rd inflorescences of tomato plants are as follows: Figure 3 As shown in Table 11 and Table 12, the statistical results of stem diameter between 2 and 3 inflorescences of tomato plants are shown in Table 11 and Table 12. Figure 4 shown.

[0045] Table 9 Statistical results of tomato plant height

[0046] Table 10 Statistical results of the distance between the 2nd and 3rd inflorescences of tomato plants

[0047] Table 11 Statistical results of stem diameter between 2nd and 3rd inflorescence of tomato plants

[0048] From Tables 9 to 11 above and Figures 2 to 5 It can be seen that the stems of the plants with overexpression of MYC1 were significantly thicker and the plant height was significantly reduced compared with the control AC plants, and a visually obvious dwarf phenotype appeared.

[0049] It is important to note that the above embodiments are intended only to further illustrate and describe the technical solutions of the present invention and are not intended to further limit the technical solutions of the present invention. The methods of the present invention are merely preferred implementations and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. The application of MYC1 gene in dwarfing tomato plants is characterized by: The MYC1 gene is a nucleotide sequence capable of encoding the following (a) or (b) protein: (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; (b) A protein derived from (a) having the same enzymatic activity as that in (a) with one or more amino acid sequences substituted, deleted or added.

2. The use according to claim 1, characterized in that The nucleotides in the MYC1 gene coding region are selected from any one of the following (a) or (b): (a) the DNA sequence having a nucleotide sequence as shown in SEQ ID NO: 1; (b) A nucleotide sequence that has 90% or greater homology to the DNA sequence in (a) and encodes the protein of claim 1.

3. Use of the primers for detecting the tomato MYC1 gene of claim 1 in screening and cultivating dwarf tomato plants.

4. The biological material containing the tomato MYC1 gene according to claim 1, characterized in that: The biological materials include expression vectors, engineering bacteria, transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs.

5. The biomaterial according to claim 4, characterized in that The engineering bacteria are Escherichia coli and Agrobacterium.

6. A method for cultivating dwarf tomato plants, characterized in that: The method is to overexpress the tomato MYC1 gene described in claim 1.

7. The method for cultivating dwarf tomato plants according to claim 6, characterized in that: The following steps are involved: (1) constructing the MYC1 gene overexpression vector described in claim 1; (2) transferring the overexpression vector into Agrobacterium and then infecting tomato explants; (3) After the infected tomato plants are screened, callus tissue is grown, and dwarf tomato plants are obtained through further cultivation.

8. The method for cultivating dwarf tomato plants according to claim 7, characterized in that: The backbone vector of the overexpression vector is pHellsgate8 vector.

9. The method for cultivating dwarf tomato plants according to claim 8, characterized in that: The construction method of the overexpression vector is as follows: Using cDNA reverse transcribed from tomato tissue total RNA as a template, amplification primers were used to amplify the MYC1 gene to obtain the target gene fragment; The target gene fragment was connected to the linearized pHellsgate8 vector, and the overexpression vector was obtained after transformation.

10. The method for cultivating dwarf tomato plants according to claim 9, characterized in that: The upstream primer sequence of the amplification primer is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4.

Images