Molecular marker for identifying body color character of jellyfish and application of molecular marker
By using SNP molecular markers and primer pairs related to jellyfish body color, combined with PCR amplification and Sanger sequencing, the problem of jellyfish body color screening was solved, and rapid and accurate jellyfish body color identification and breeding guidance were achieved, which is suitable for detection in multiple growth stages and parts.
Patent Information
- Application Number
- CN202510849630.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-24
- Publication Date
- 2025-09-05
AI Technical Summary
Existing technologies make it difficult to efficiently screen and identify the body color traits of jellyfish, resulting in the degradation of jellyfish germplasm, long breeding cycles, and a lack of high-quality seedlings.
By developing SNP molecular markers related to jellyfish body color, using specific primer pairs for PCR amplification and Sanger sequencing, the jellyfish genotype is analyzed to distinguish between red and blue body colors, and a simple kit is designed for detection.
It achieves rapid and accurate screening of jellyfish body color, shortens the breeding cycle, provides a basis for genetic mechanism research, is simple to operate and low-cost, and is suitable for detection at different growth stages and parts.
Smart Images

Figure BDA0005464463410000041 
Figure HDA0005464463430000011 
Figure HDA0005464463430000012
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of molecular markers, in particular to a molecular marker for identifying the body color traits of jellyfish and application thereof. Background Art
[0002] Jellyfish are a marine aquatic animal used for both medicinal and edible purposes. They boast high protein, rich essential amino acids, and low cholesterol, and are also rich in various bioactive substances, including collagen, polysaccharides, and polyunsaturated fatty acids. Due to their rapid growth, short culture cycle, and strong environmental adaptability, jellyfish have become a key economic aquaculture species in my country's coastal waters. my country is the only country in the world that practices jellyfish aquaculture. Currently, jellyfish aquaculture in my country faces challenges such as genetic degradation, frequent diseases, and a shortage of high-quality seedlings. Accelerating the selection and breeding of high-quality jellyfish is a top priority to address these issues.
[0003] Single nucleotide polymorphism refers to the variation of DNA sequence caused by mutation of a single nucleotide in the whole genome sequence. SNP is widely used in breeding, trait linkage analysis and biodiversity research due to its characteristics such as easy detection and statistics and automated analysis. The association analysis of SNP sites with important traits to obtain SNP markers closely related to traits is an important means of modern aquatic animal molecular breeding technology and plays an important role in the genetic breeding of aquatic economic animals. The jellyfish cultured in ponds are mainly red and blue, and red and blue jellyfish account for more than 98% of the number of cultured jellyfish. Therefore, the present invention aims to detect red and blue jellyfish individuals as early as possible at the genotype level by exploring SNP molecular markers for red and blue body colors of jellyfish, shorten the jellyfish body color breeding and selection cycle, and provide technical guidance for the selection of jellyfish varieties and the study of body color genetic mechanisms. Summary of the Invention
[0004] In order to solve the above problems, the present invention provides a molecular marker for identifying the body color traits of jellyfish and its application. This method can efficiently screen jellyfish red and blue body colors through SNP molecular markers, thereby breeding excellent jellyfish strains.
[0005] The present invention is achieved through the following technical solutions:
[0006] A molecular marker for identifying the body color trait of jellyfish. The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1. The 301st nucleotide of the sequence is a SNP site, and its base is A or T.
[0007] SEQ ID NO.1: Note: The shaded area is the 301st nucleotide, which is the SNP site.
[0008] The present invention provides a primer pair for detecting the SNP molecular marker associated with the body color of jellyfish as described above, wherein the sequences of the primer pair are:
[0009] SEQ ID NO.2: 5'-GGTCTCCATCAGCTGCATGGC-3';
[0010] SEQ ID NO. 3: 5'-GTCGCCAATGGGAGCCAAC-3'.
[0011] The present invention provides a kit for SNP molecular markers associated with jellyfish body color as described above, and the kit comprises the primer pair as described above.
[0012] The present invention provides a method for detecting the SNP molecular marker associated with the body color of jellyfish as described above, the method comprising: using the genomic DNA of the jellyfish as a template, performing a PCR amplification reaction using the above primer pair to obtain a PCR product, performing Sanger sequencing on the obtained PCR product, and determining the genotype based on the sequencing peak graph.
[0013] The method specifically comprises the following steps: (1) extracting genomic DNA of the jellyfish to be tested; (2) obtaining the target fragment to be tested by PCR amplification; (3) sequencing the PCR product to obtain the nucleotide sequence and peak diagram of the sample to be tested; and (4) performing SNP analysis to screen the jellyfish body color by using the nucleotide genotype at the 196th position of the amplified sequence.
[0014] Furthermore, the PCR amplification reaction system is: 10 μL of KOD premix, 1 μL of each of 10 μM forward and reverse primers, 1 μL of 200 ng / μL jellyfish DNA template to be tested, and 7 μL of enzyme-free sterile water, with a final volume of 20 μL.
[0015] Furthermore, the reaction conditions of the PCR amplification are: pre-denaturation at 98°C for 30s, followed by 35 cycles, including: denaturation at 98°C for 10s, annealing at 59°C for 20s, extension at 72°C for 30s, and finally extension at 72°C for 5min.
[0016] Furthermore, if a single peak appears in the peak graph, it is a homozygous genotype; if double peaks appear, it is a heterozygous genotype.
[0017] Furthermore, the homozygous genotype is AA type and TT type, and the heterozygous genotype is AT type.
[0018] Furthermore, the AA genotype individuals are blue jellyfish individuals, the TT genotype individuals are red jellyfish individuals, and the AT genotype individuals include both blue jellyfish individuals and red jellyfish individuals.
[0019] The SNP molecular marker, primer pair or kit of the present invention is mainly used for jellyfish body color trait improvement breeding and jellyfish body color genetic mechanism research.
[0020] Technical Effects
[0021] The present invention provides a molecular marker for identifying the body color traits of jellyfish and its application. Compared with the prior art, the present invention has the following significant effects:
[0022] 1. The present invention analyzes the SNP sites of jellyfish body color through PCR amplification and Sanger sequencing, and performs body color screening based on the association between different genotypes and traits, which can distinguish jellyfish individuals with different body colors at the genotype level; using the above-mentioned SNP molecular markers to screen jellyfish body color is conducive to early identification of jellyfish body color, shortening the jellyfish body color breeding cycle, laying the foundation for the study of the genetic mechanism of jellyfish body color traits, and has great potential application value and scientific research value.
[0023] 2. The present invention uses SNP molecular markers to screen jellyfish body color, which has the advantages of simple operation, low cost, high genetic stability, convenient detection and statistics, and easy automation; the primers designed by the present invention have high specificity and high sensitivity, and can quickly and accurately complete sample amplification, thereby efficiently and quickly distinguishing jellyfish individuals with different body colors. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 This is the gel electrophoresis diagram of the PCR amplified fragment in Example 1.
[0025] Figure 2 This is the SNP site peak diagram in Example 1. DETAILED DESCRIPTION
[0026] In order to further illustrate the technical means and effects adopted by the present invention to achieve the predetermined purpose of the invention, the specific implementation methods, structures, features and effects of the present invention are described in detail below in conjunction with the accompanying drawings and preferred embodiments.
[0027] Example 1 Body color identification of jellyfish with different body colors
[0028] (1) Acquisition of template DNA
[0029] Sixty red and blue jellyfish individuals were randomly obtained, and the umbrella tissues were collected. The genomic DNA of the umbrella tissues of jellyfish was extracted using the Tiangen Marine Animal Tissue Genome Extraction Kit (TIANGEN, Tiangen Biochemical Technology Co., Ltd.). The quality of the jellyfish genomic DNA was detected by 1% agarose gel electrophoresis, and the concentration (ng / μL) and purity (A260 / A280) of the jellyfish genomic DNA were detected by NanoDrop2000 spectrophotometer.
[0030] (2) PCR amplification and sequencing
[0031] PCR amplification was performed on genomic DNA of 60 jellyfish using the detection primers disclosed in the present invention (F: 5'-GGTCTCCATCAGCTGCATGGC-3'; R: 5'-GTCGCCAATGGGAGCCAAC-3'). The reaction system is shown in Table 1, and the reaction procedure is shown in Table 2.
[0032] Table 1 PCR amplification reaction system
[0033] Reagent name volume KOD enzyme (PCRMasterMix) 10 μl Genomic DNA (100-200 ng / μl) 1 μl Upstream primer (10 μM) 1 μl Downstream primer (10 μM) 1 μl Enzyme-free sterile water 7 μl
[0034] Table 2 PCR detection reaction procedure
[0035]
[0036] Prepare 1% agarose gel, take 2 μl of PCR product for electrophoresis, stabilize the voltage at 200 V, and observe the electrophoresis results under ultraviolet light. Figure 1 The remaining 18 μl of PCR product was sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing.
[0037] (3) Result analysis
[0038] The sequencing peak graph shows that the above jellyfish samples obtained three peak graph results. The 196th position of the first part of the jellyfish amplified sequence is a single peak "T", and the genotype is determined to be TT type. According to the present invention, the body color of the jellyfish individual is determined to be red, which is consistent with the actual sample observation result. The sequencing peak graph shows that the 196th position of the second part of the jellyfish amplified sequence is a single peak "A", and the genotype is determined to be AA type. According to the present invention, the body color of the jellyfish individual is determined to be blue, which is consistent with the actual sample observation result. The 196th position of the third part of the jellyfish amplified sequence is a double peak "A / T", and the genotype is determined to be AT type. According to the present invention, the body color of the jellyfish individual is determined to be both red and blue, which is consistent with the actual sample observation result.
[0039] Example 2: Verification of body color markings of jellyfish oral arm tissues with different body colors
[0040] (1) Acquisition of template DNA
[0041] 0.2 g of oral arm tissue of the homozygous genotype red jellyfish and blue jellyfish samples were obtained from Example 1, and the jellyfish genomic DNA was extracted using the CTAB method. The quality of the jellyfish genomic DNA was detected by 1% agarose gel electrophoresis, and the concentration (ng / μL) and purity (A260 / A280) of the jellyfish genomic DNA were detected by NanoDrop2000 spectrophotometer.
[0042] (2) PCR amplification and sequencing
[0043] The jellyfish genomic DNA was amplified by PCR using the detection primers disclosed in the present invention (F: 5'-GGTCTCCATCAGCTGCATGGC-3'; R: 5'-GTCGCCAATGGGAGCCAAC-3'). The same PCR reaction system and conditions as in Example 1 were used. The amplified PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing.
[0044] (3) Result analysis
[0045] The sequencing peak plot showed a single peak "T" at position 196 of the red jellyfish amplified sequence, confirming the genotype to be TT. According to the present invention, the body color of this jellyfish individual was determined to be red, consistent with the actual sample source. The sequencing peak plot showed a single peak "A" at position 196 of the blue jellyfish amplified sequence, confirming the genotype to be AA. According to the present invention, the body color of this jellyfish individual was determined to be blue, consistent with the actual sample source.
[0046] Example 3: Feasibility verification of body color marking
[0047] (1) Acquisition of template DNA
[0048] 0.2 g of the fimbria and oral arm tissues of 5 juvenile stings with a diameter of 3 cm were randomly obtained. The genomic DNA of the juvenile stings was extracted using the CTAB method. The quality of the genomic DNA of the juvenile stings was detected by 1% agarose gel electrophoresis. The concentration (ng / μL) and purity (A260 / A280) of the genomic DNA of the juvenile stings were determined by NanoDrop2000 spectrophotometer.
[0049] (2) PCR amplification and sequencing
[0050] The genomic DNA of the young sting was amplified by PCR using the detection primers disclosed in the present invention (F: 5'-GGTCTCCATCAGCTGCATGGC-3'; R: 5'-GTCGCCAATGGGAGCCAAC-3'). The same PCR reaction system and conditions as in Example 1 were used. The amplified PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing.
[0051] (3) Result analysis
[0052] The sequencing peak plot showed a single peak "T" at position 196 in the amplified sequence of one juvenile sting, confirming the genotype as TT. Four juvenile stings showed double peaks at position 196, confirming the genotype as AT. According to the present invention, juvenile stings with the TT genotype were determined to have red body color, while those with the AT genotype were determined to have red or blue body color. The results for the fimbria and oral arms were consistent, demonstrating the feasibility of body color markers in juvenile stings.
[0053] Table 3 Application of the embodiment
[0054] Detection site Sample tissue Extraction kit Enzyme type Example 1 No. 196 Umbrella Organization Tiangen Marine Animal Kit KOD enzyme Example 2 No. 196 Oral arm tissue CTAB method KOD enzyme Example 3 No. 196 juvenile fimbria and oral arm tissue CTAB method KOD enzyme
[0055] Technical Extension Notes
[0056] 1. Organizational versatility:
[0057] Examples 2 and 3 used oral arm tissue, demonstrating that this method is applicable to gene detection in different parts of jellyfish, solving the problem of damage to individuals caused by traditional umbrella tissue sampling.
[0058] 2. DNA extraction method expansion:
[0059] Examples 2 and 3 use the classic CTAB method to extract jellyfish DNA for detection, which is suitable for large-scale primary screening and reduces application implementation costs.
[0060] 3. Can be applied to multiple growth stages of jellyfish:
[0061] Examples 2 and 3 used adult and juvenile stings as samples, respectively, demonstrating that the method can be flexibly adapted to multiple growth stages of jellyfish, thereby increasing the scope of application.
[0062] The above examples all follow the core technical route of "DNA extraction → specific PCR → sequencing typing → phenotypic association" and fully demonstrate the flexibility and practicality of the method of the present invention through tissue compatibility optimization and reagent adjustment.
[0063] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A molecular marker for identifying the body color traits of jellyfish and its application, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; the SNP molecular marker is located at the 301st position of the sequence shown in SEQ ID NO.1, and its base is A or T; the AA genotype individual at the 301st base position is a blue jellyfish individual; the TT genotype individual at the 301st base position is a red jellyfish individual. SEQ ID NO.1: AACGCCTCGGGGATGTCATAAAATACTTTAGCCTCCGATTAGTTTTATATGCATAGCAAGGAGGCAA ACTGCTGCGCAATTACTTCGAGTGAGCCACTATCAGCTGGTCTCCATCAGCTGCATGGCAACATTGTTCCACTCGTTGGCCCAAATATTATTCCCACTGTTCAAACTTCTTAACAAATCCATGGTAACTGCAT CATCCAGGCCGTCAAGGTCGCTGAGGCCACTCCCGCCATTATCGGTGACACTATTGCAGCCCGCCGGCGGAATCGATTCCTCCCAGTGAAAACGGCGAATCAATTAAACTATCGACTGAGGCTAAAGACGATTCG TCGATTATTGCCATTTGTGGCTTTTCTGTCTGGGATTGAGGCAGCCTCATTTTCGACAGTCCTAGGGAGAGTTCGTGCCTTCTTTAAATTCAAGTCACCATCACTTCCAAAAAAAGATGGCGTCAAATTCCTCC TCGCATTACTTTGCATTTCGTTGTTTAAAAACTTGGTTCTCATTTCTTTTAAATGGGCAAAAGGGGAGCCCCTGTTGGCTCCCATTGGCGACATGACAGACTGGGCCCCAATCTGGGAGGATAATGGTGCCGAA Note: The shaded area is the SNP site at nucleotide position 301.
2. The molecular marker for identifying the body color traits of jellyfish according to claim 1 and its application, characterized in that: The primer pair includes a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3; SEQ ID NO.2: 5'-GGTCTCCATCAGCTGCATGGC-3'; SEQ ID NO. 3: 5'-GTCGCCAATGGGAGCCAAC-3'.
3. The molecular marker for identifying the body color traits of jellyfish and its application according to claim 1, characterized in that: The kit comprises the primer pair according to claim 2.
4. The molecular marker for identifying the body color traits of jellyfish and its application according to claim 1, characterized in that: The method comprises: using the genomic DNA of the jellyfish to be tested as a template, performing a PCR amplification reaction using the primer pair described in claim 2 to obtain a PCR product, performing Sanger sequencing on the obtained PCR product, and determining the genotype according to the sequencing peak graph.
5. The molecular marker for identifying the body color traits of jellyfish and its application according to claim 1, characterized in that: The PCR amplification reaction system is: 10 μL of KOD premix, 1 μL of forward and reverse primers with a concentration of 10 μM, 1 μL of jellyfish DNA template with a concentration of 200 ng / μL, and 7 μL of enzyme-free sterile water, with a final volume of 20 μL.
6. The molecular marker for identifying the body color traits of jellyfish and its use according to claim 4, characterized in that: The reaction conditions of the PCR amplification were as follows: pre-denaturation at 98°C for 30s, followed by 35 cycles of denaturation at 98°C for 10s, annealing at 59°C for 20s, extension at 72°C for 30s, and finally extension at 72°C for 5min.
7. The molecular marker for identifying the body color traits of jellyfish and its use according to claim 4, characterized in that: If a single peak appears in the peak graph, it is a homozygous genotype; if double peaks appear, it is a heterozygous genotype.
8. The molecular marker for identifying the body color traits of jellyfish and its use according to claim 7, characterized in that: The homozygous genotypes are AA type and TT type, and the heterozygous genotype is AT type.
9. The molecular marker for identifying the body color traits of jellyfish and its use according to claim 8, characterized in that: The AA genotype individuals are blue jellyfish; the TT genotype individuals are red jellyfish; and the AT genotype individuals include both blue and red jellyfish.
10. The molecular marker for identifying the body color traits of jellyfish and its use according to claim 1, characterized in that: Use of the SNP molecular marker according to claim 1, the detection primer pair for the SNP molecular marker according to claim 2, the kit according to claim 3, or the detection method according to claim 4 in jellyfish breeding.