Coccidium drug resistance regulation gene and application thereof

Abstract

The invention discloses application of para aminobenzoic acid synthase and / or hydroxymethyl dihydropterin pyrophosphate kinase-dihydropterioic acid synthase in regulation and control of coccidium drug resistance, and through comparative analysis of whole transcriptome level, only in DZR strain, the para aminobenzoic acid synthase and / or hydroxymethyl dihydropterin pyrophosphate kinase-dihydropterioic acid synthase can be used for regulating and controlling coccidium drug resistance. A key rate-limiting enzyme coding gene of a folic acid biosynthetic pathway, namely para aminobenzoic acid synthase (EtpABAS), is specifically associated with the expression level of hydroxymethyl dihydropterin pyrophosphate kinase-dihydropteroic acid synthase (EtHPPK-DHPS), and the drug resistance of diclazuril is specifically associated with the expression level of the hydroxymethyl dihydropterin pyrophosphate kinase-dihydropteroic acid synthase (EtHPPK-DHPS). The invention reveals that the molecular mechanism of E.tenella for generating drug resistance to diclazuril is closely related to the folic acid synthesis pathway for the first time, and defines the core regulation effect of the key metabolic enzyme EtpABAS in the folic acid synthesis pathway in the process. Meanwhile, the invention provides a strategy for intervening generation of the drug resistance of the coccidiosis by regulating and controlling a folic acid metabolic pathway, a new theoretical basis and a new practice direction are provided for research, development and precise medication of novel anti-coccidiosis drugs, and the method has remarkable scientific value and industrial application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of protein regulation, and specifically relates to the application of para-aminobenzoate synthase (EtpABAS) and / or hydroxymethyldihydropterin pyrophosphate kinase-dihydropteroate synthase (EtHPPK-DHPS) in regulating coccidia drug resistance. Background Art

[0002] In modern large-scale poultry farming, coccidiosis is one of the key infectious diseases that restricts the healthy development of the industry and causes significant economic losses. The disease is caused by protozoan parasites of the genus Eimeria, of which Eimeria tenella is considered one of the most serious pathogenic species that endangers the poultry industry. The parasite completes its complex sexual and asexual development process within the host's intestinal epithelial cells, destroying the intestinal mucosal structure, causing infected chickens to experience growth retardation and reduced feed conversion rate. In severe cases, it can cause large-scale mortality in the flock. In addition, coccidian infection can induce disorders in the host's intestinal microecological system, weaken the intestinal barrier function, create conditions for secondary infection with opportunistic pathogens such as Salmonella and Escherichia coli, and further amplify the pathological effects. This not only seriously undermines farming efficiency, but also poses a potential threat to food safety and public health.

[0003] For a long time, anticoccidial drugs have been a core means of controlling the disease. Currently, clinically used anticoccidial drugs fall into two main categories: chemically synthesized drugs (such as diclazuril, clopidogrel, and nicarbazine), which primarily exert their anticoccidial effects by interfering with metabolic pathways such as purine / pyrimidine synthesis and mitochondrial function; and ionophore polyether antibiotics (such as maduramycin, salinomycin, and monensin), which achieve their inhibitory effects by disrupting the ion permeability of the coccidian cell membrane. However, due to the long-term overuse or monotherapy of anticoccidial drugs, particularly under aquaculture conditions lacking effective rotation and dosage control, the problem of drug resistance in coccidia has become increasingly prominent. Since the first discovery of a coccidia strain resistant to sulfonamides in 1954, resistance has emerged in nearly all commercially available anticoccidial drugs. In particular, the widespread prevalence of multidrug-resistant and cross-resistant strains in recent years has severely weakened the effectiveness of traditional control measures, even leading to a complete loss of efficacy in some areas. This has become a core technical bottleneck currently hindering the prevention and control of coccidiosis.

[0004] Research on the mechanisms of diclazuril resistance is still in its infancy, lacking the identification and validation of targeted molecular targets for resistance with clear mechanisms. Further exploration of the genes and metabolic networks closely associated with resistance will not only help elucidate the mechanisms of resistance but also provide theoretical foundations and technical support for the development of new anticoccidial drugs, the formulation of scientific drug use strategies, and the establishment of resistance monitoring methods.

[0005] Although some studies have attempted to screen proteins or molecular targets related to drug resistance through high-throughput technologies such as transcriptomics and proteomics, there are still many limitations: first, the expression differences of many screened proteins are inconsistent among different resistant strains, lack stability and universality, and are difficult to promote and apply as reliable drug resistance detection markers; second, many candidate proteins only remain at the differential expression level, lack in-depth functional annotation and verification, and cannot establish a clear connection with the drug action mechanism; third, current research mostly relies on conventional differential analysis methods, lacks targeted screening of specific metabolic pathways and multi-angle functional analysis, which makes it difficult to apply the results.

[0006] Therefore, there is an urgent need to identify drug-resistant target proteins with strong expression stability, clear mechanisms, and high functional specificity, analyze the molecular mechanism of coccidia resistance, provide a basis for the development of new drugs and the establishment of rapid detection methods for on-site coccidia resistance, and provide new strategies for coccidiosis prevention and control. To this end, this application uses a variety of technical means to study the molecular mechanism of E. tenella diclazuril resistance, focusing on analyzing the function of p-aminobenzoic acid synthase, a key enzyme in the folate synthesis pathway, in the formation of diclazuril resistance in chicken coccidia, clarifying its metabolic pathway, regulatory relationship, and application potential in the process of drug resistance regulation, and providing a solid theoretical basis for subsequent new drug development and drug resistance regulation and detection. Summary of the Invention

[0007] In order to solve the above problems, this application provides the following:

[0008] First, through laboratory drug screening and induction, the present invention successfully obtained E. tenella strains with stable resistance phenotypes to diclazuril (DZR), maduramycin (MRR), and salinomycin (SMR), and carried out comparative analysis at the whole transcriptome level with its homologous sensitive strain (DS) as a control. The results showed that only in the DZR strain, the expression levels of key enzymes in the folate biosynthesis pathway - para-aminobenzoate synthase (EtpABAS) and hydroxymethyldihydropterin pyrophosphate kinase-dihydropteroate synthase (EtHPPK-DHPS) were significantly downregulated, while similar changes were not observed in the MRR and SMR strains, suggesting that the folate metabolism pathway may be specifically associated with diclazuril resistance.

[0009] Furthermore, the present invention provides functional validation of two proteins, EtpABAS and EtHPPK-DHPS. Using molecular cloning, protein expression, polyclonal antibody preparation, IFA immunolocalization, antibody blocking experiments, and overexpression / knockout assays, the expression patterns and cellular localization of these two proteins during E. tenella development were clarified. The results showed that EtHPPK-DHPS and EtpABAS are highly expressed during the schizogony stage and are localized to the parasite's cytoplasm and cell membrane, suggesting their potential involvement in parasite cellular reproduction and invasion. Overexpression strains of EtpABAS and EtHPPK-DHPS, as well as knockout strains of EtpABAS, were constructed. Combined with in vitro and in vivo drug sensitivity experiments, EtpABAS overexpression significantly restored the sensitivity of the DZR strain to diclazuril, while EtpABAS knockout significantly enhanced diclazuril resistance. This confirms that EtpABAS plays a key role in regulating diclazuril resistance in E. tenella. This marks the first time that changes in coccidia resistance have been observed using gene editing. In contrast, while overexpression of EtHPPK-DHPS enhanced enzyme activity, the overexpression strain did not significantly affect the drug-resistant phenotype, suggesting that it may be more involved in metabolic regulation but not a decisive role in the development of diclazuril resistance.

[0010] The present study also systematically evaluated the reproductive capacity of different strains under conditions of folate deficiency and supplementation, confirming that the DZR strain is better able to utilize exogenous folate and its precursor, p-aminobamic acid (pABA). It is speculated that this strain activates exogenous salvage pathways to counteract the stress caused by impaired folate synthesis, thereby maintaining its survival under drug effects. Combined ELISA, qPCR, and absolute fluorescence quantitative PCR assays revealed that changes in the expression of EtpABAS and EtHPPK-DHPS significantly affect the activity of enzymes involved in folate metabolism and the accumulation of metabolites, further supporting their functional role.

[0011] In summary, the present invention clearly reveals for the first time the direct molecular association between E. tenella diclazuril resistance and the folate metabolic pathway, verifies EtpABAS as a core regulatory factor and potential molecular target, and provides a scientific basis and technical reserves for analyzing the molecular mechanism of coccidia resistance to diclazuril, the development of new anticoccidial drugs, and the rapid detection of coccidia resistance on site and the formulation of precise medication strategies.

[0012] Beneficial effects

[0013] The present invention reveals for the first time that the molecular mechanism by which E. tenella develops resistance to diclazuril is closely related to the folate synthesis pathway, and clarifies the core regulatory role of EtpABAS, a key metabolic enzyme in the folate synthesis pathway, in this process. For the first time, through overexpression and knockout technology, it was confirmed that the expression level of EtpABAS directly affects the sensitivity of the insect strain to the drug, and this feature is consistent in resistant strains of different concentrations and field isolated insect strains, with good stability and specificity. Compared with other differentially expressed proteins in resistant strains, the target molecule of the present invention has a clear functional positioning and mechanism support, can effectively distinguish between sensitive strains and diclazuril-resistant strains, and is suitable for constructing molecular detection of coccidia diclazuril resistance and evaluation of on-site drug use. At the same time, the present invention proposes a strategy to intervene in the development of coccidia resistance by regulating the folate metabolic pathway, which provides a new theoretical basis and practical direction for the research and development of new anticoccidial drugs and precision medication, and has significant scientific value and industrial application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Gene amplification of EtHPPK-DHPS and EtpABAS

[0015] Figure 2 Western blot analysis of the expression of EtHPPK-DHPS and EtpABAS recombinant proteins

[0016] Figure 3 Transcriptional analysis of EtHPPK-DHPS and EtpABAS genes at different developmental stages of sensitive strains

[0017] a: mRNA transcription levels of EtHPPK-DHPS and EtpABAS at different developmental stages; b: mRNA transcription levels of EtHPPK-DHPS and EtpABAS in the cecum of coccidia-infected chickens.

[0018] Gam: gametocyte; SM: second generation merozoite; SZ: sporozoite; SO: sporulated oocyst; UO: unsporulated oocyst Figure 4 Analysis of EtHPPK-DHPS and EtpABAS gene expression levels

[0019] SM: second generation merozoite; SZ: sporozoite; SO: sporulated oocyst; UO: unsporulated oocyst

[0020] Figure 5 Indirect immunofluorescence localization of EtHPPK-DHPS in different developmental stages of E. tenella

[0021] A: Distribution in sporozoites; B: Distribution in second-generation merozoites; C: Sporozoites infected with DF-1 cells for 2 hours; D: Trophozoites 24 hours after infection; E: Immature schizonts 48 hours after infection; F: Mature schizonts 72 hours after infection

[0022] Figure 6 Indirect immunofluorescence localization of EtpABAS in different developmental stages of E. tenella

[0023] A: Distribution in sporozoites; B: Distribution in second-generation merozoites; C: Trophozoites of DF-1 cells infected with sporozoites for 24 hours; D: Immature schizonts after 48 hours of infection; E: Immature schizonts after 60 hours of infection; F: Immature schizonts after 72 hours of infection

[0024] Figure 7 Inhibitory effects of anti-rEtHPPK-DHPS and anti-rEtpABAS-IgG on sporozoite invasion of DF-1 cells

[0025] A: Inhibitory effect of anti-rEtHPPK-DHPS-IgG on sporozoite invasion; B: Inhibitory effect of anti-rEtpABAS-IgG on sporozoite invasion; NA: IgG in healthy rabbit serum

[0026] Figure 8 Quantitative PCR verification of EtHPPK-DHPS and EtpABAS mRNA transcription levels in different insect strains

[0027] DS: sensitive strain; DZR: diclazuril-resistant strain; MRR: maduramycin-resistant strain; SMR: salinomycin-resistant strain;

[0028] 0.1-1ppm: diclazuril-resistant strains at different concentrations; D5-D9: diclazuril-resistant strains isolated in the field

[0029] Figure 9 Screening and identification of EtHPPK-DHPS homozygous overexpressing insect strains

[0030] a: Sporulated oocysts of EtHPPK-DHPS homozygous overexpressing strain; b: Western blot identification of EtHPPK-DHPS overexpression in coccidia; c: qPCR identification of EtHPPK-DHPS overexpression in coccidia

[0031] Figure 10 Construction and identification of EtpABAS homozygous overexpression strain

[0032] a: Sporulated oocysts of a homozygous EtpABAS overexpressing strain; b: Western blot analysis of EtpABAS overexpression in coccidia; c: qPCR analysis of EtpABAS overexpression in coccidia

[0033] Figure 11 Cecal lesion score (a), weight gain (b), and oocyst production (c) in the pathogenicity test of the overexpressing insect strain

[0034] Figure 12 CRISPR / Cas9-mediated mutation of the E. tenella EtpABAS gene

[0035] a: Fluorescence observation of sporulated oocysts; b: PCR amplification of the EtpABAS-gRNA targeting region; c: T clone with knockout of the genomic EtpABAS-gRNA targeting region; d: Mutant sequence detected after Cas9 cleavage

[0036] Figure 13 Western Blot Identification of Homozygous EtpABAS Gene Knockout Strains

[0037] a: Identification of the EtpABAS-KO strain; b: Identification of the parental EtHCYA strain

[0038] Figure 14 Cecal lesion score (a), weight gain (b), and oocyst production (c) of the EtpABAS-KO strain in pathogenicity test

[0039] Figure 15 ELISA detection of p-aminobenzoic acid (a), dihydropteroate synthase (b), dihydrofolate (c) and folic acid (d) levels in sensitive (DS) and resistant (DZR) strains

[0040] Figure 16 Effects of diclazuril (DIC) on metabolite levels in sensitive (DS) and resistant (DZR) strains

[0041] (a) pABA (para-aminobenzoic acid), (b) DHF (dihydrofolic acid), (c) Folic acid (folic acid) content changes

[0042] The black column is the supernatant, the gray column is the precipitate; CM is the control group, and CM+DIC is the diclazuril-treated group

[0043] Figure 17 Effects of drugs on cell invasion by sporozoites of different insect strains in vitro

[0044] a: Invasion rates of different insect strains under diclazuril treatment; b: Invasion inhibition rates of DS and DZR under diclazuril / maduramycin treatment

[0045] DS: sensitive strain; DZR: diclazuril-resistant strain

[0046] Figure 18 Effects of Diclazuril on the Development of E. tenella Sporozoites in Vitro

[0047] Dic: diclazuril; DS: sensitive strain; DZR: diclazuril-resistant strain

[0048] Figure 19 In vitro assay to examine the effect of folic acid on the sensitivity of E. tenella to diclazuril

[0049] DS: sensitive strain; DZR: diclazuril-resistant strain; HPPK-DHPS-OE: EtHPPK-DHPS overexpression strain; pABAS-OE: EtpABAS overexpression strain; pABAS-KO: EtpABAS gene knockout strain

[0050] Figure 20 Effects of pABA or sulfonamide on the sensitivity of E. tenella to diclazuril

[0051] Dic: diclazuril; Sulfa: sulfonamide; pABA: para-aminobenzoic acid; DS: sensitive strain; DZR: diclazuril-resistant strain

[0052] Figure 21 Effects of folic acid and pABA supplemented with sulfonamide on the development of coccidia under the action of diclazuril

[0053] Dic: diclazuril; Sulfa: sulfonamide; pABA: para-aminobenzoic acid; DS: sensitive strain; DZR: diclazuril-resistant strain. DETAILED DESCRIPTION

[0054] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0055] The present invention constructs a series of models of drug-sensitive and drug-resistant E. tenella strains, combining transcriptome screening, qPCR verification, biochemical functional experiments, and genetic engineering techniques to verify the direct correlation and causal relationship between the target protein and drug resistance. Unlike other differentially expressed proteins between drug-resistant and sensitive strains, the EtpABAS protein screened and identified in this invention exhibits high consistency and specificity in terms of functional mechanism, expression pattern, and drug response. For the first time in the field of coccidia, changes in drug resistance were observed using gene editing technology, clearly proposing it as a key regulatory factor in the development of coccidia resistance to diclazuril, with clear molecular target characteristics and application value.

[0056] The experimental chickens used in this study were provided by farms in Shanghai, China, and New Zealand white rabbits were purchased from Shanghai Tan Kah Kee Biotechnology Co., Ltd. All experimental animals were housed in a clean environment free of coccidia infection to ensure the reliability and reproducibility of experimental conditions.

[0057] The E. tenella strain used in the gene editing experiments was a sensitive strain (EtHCYA) stably expressing the Cas9 protein. The sensitive strain (DS) was originally isolated from a poultry farm in Shanghai (Resource Number: CAAS21111601) and serially passaged in the laboratory. This DS strain exhibited high sensitivity to commonly used anticoccidial drugs, including diclazuril, maduramycin, and salinomycin. Based on this, diclazuril-resistant (DZR), maduramycin-resistant (MRR), and salinomycin-resistant (SMR) strains were generated through long-term drug induction. Two-week-old SPF chickens free of coccidia infection were selected for the experiment. Diclazuril, maduramycin, or salinomycin at varying concentrations were added to their feed two days prior to inoculation with E. tenella to maintain and screen for drug-resistant strains.

[0058] Oocyst collection and processing followed standard procedures. Unsporulated oocysts (UO) were first collected and placed in a 2.5% potassium dichromate solution at 28°C for sporulation, resulting in sporulated oocysts (SO). Sporozoites (SZ) were then collected in vitro from the purified SO. Second-generation merozoites (SM) were isolated and purified from the cecal tissue of chickens 120 hours after infection. Gametocytes (Gam) were obtained using the same method 132 hours after infection.

[0059] The chicken embryo fibroblast cell line DF-1 used for in vitro culture was maintained in our laboratory. Cells were cultured in complete Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum, 100 U / mL penicillin / streptomycin, and 2.0 mM L-glutamine, or in a custom folic acid-free medium depending on experimental needs.

[0060] Example 1 Screening and identification of drug-resistant genes

[0061] Target gene cloning and recombinant protein expression

[0062] Specific primers were designed based on the open reading frames (ORFs) of EtHPPK-DHPS and EtpABAS in the ToxoDB database (EtHPPK-DHPS-F: GCGTGGATCCCCGGAATTCATGTTTCATTTAACCAGTCC (SEQ ID No. 1); EtHPPK-DHPS-R: CACGATGCGGCCGCTCGAGGCTGCTTTCCGCGGGAAACA (SEQ ID No. 2); EtpABAS-F: CGGTACCCTCGAGGGATCCATGGCCATTCAACACTCGAC (SEQ ID No. 3); EtpABAS-R: GACTGCAGGTCGACAAGCTTGGTGGCGCACCTGAGGAAAG (SEQ ID No. 4)). PCR amplification was performed using cDNA from SM-stage worms as a template using a high-fidelity DNA polymerase, and the full-length coding sequences of EtHPPK-DHPS (1923 bp) and EtpABAS (2094 bp) were successfully obtained ( Figure 1 The PCR product was purified by agarose gel recovery and ligated into the pGEM-T-easy vector. The competent cells were transformed to screen positive clones, which were then sequenced and verified by Sangon Biotechnology Co., Ltd.

[0063] After sequencing, the correct insert was confirmed and ligated into the pGEX-4T-1 and pCold-TF expression vectors, respectively, to construct the recombinant expression plasmids pGEX-4T-EtHPPK-DHPS and pCold-TF-EtpABAS. The plasmids were transformed into the Escherichia coli BL21(DE3) strain, and protein expression was induced with 1.0 mM IPTG. Bioinformatics analysis showed that the protein encoded by the open reading frame (ORF) of EtHPPK-DHPS has a theoretical molecular weight of approximately 64 kDa. When expressed in fusion with a glutathione S-transferase (GST, 26 kDa) tag, the expected recombinant protein has a molecular weight of approximately 90 kDa. Similarly, when the functional domain (1500 bp) of EtpABAS is expressed in fusion with a histidine tag (His, 43 kDa), the recombinant protein has a theoretical molecular weight of approximately 94 kDa. Western blot results showed that anti-SM polyclonal antibodies could specifically recognize the recombinant protein, and specific bands were detected in both the supernatant and the precipitate fractions, indicating that the recombinant protein was expressed in the form of soluble and inclusion bodies ( Figure 2 ).

[0064] Preparation and identification of polyclonal antibodies

[0065] Purified rEtHPPK-DHPS and rEtpABAS proteins were used to immunize New Zealand White rabbits to generate the corresponding polyclonal antibodies. Each rabbit received a subcutaneous injection of 200 μg of recombinant protein in an emulsion prepared at a 1:1 ratio with Freund's complete adjuvant for the first immunization. Subsequently, four booster immunizations were administered at 7-day intervals using the same antigen dose in Freund's incomplete adjuvant. Seven days after the final immunization, blood was collected and polyclonal antibody serum was isolated.

[0066] Indirect immunofluorescence localization (IFA)

[0067] The IFA assay was used to detect the expression and localization of EtHPPK-DHPS and EtpABAS in different developmental stages of E. tenella. 5 DF-1 cells were inoculated into a six-well plate with a cell slide, and 2 mL of complete medium was added and cultured in a 37°C cell culture incubator for 24 hours. Fresh E. tenella sporozoites (6×10 per well) were added. 5 Tenella parasites) were incubated in complete medium at 41°C for 2 hours before infecting DF-1 cells. Cell slides were collected at different times after infection. The cells were fixed with 4% paraformaldehyde for 30 minutes, permeabilized with 0.2% Triton X-100 for 10 minutes, and blocked with 5% BSA for 1 hour. The samples were incubated with primary antibodies (rabbit anti-rEtHPPK-DHPS or rabbit anti-rEtpABAS) (overnight at 4°C), washed, and incubated with secondary antibodies (Alexa Fluor 594-labeled goat anti-rabbit IgG) at room temperature for 1 hour. The nuclei were then stained with DAPI, and the fluorescence signal distribution was observed under a laser confocal microscope after sealing. The results showed that the EtHPPK-DHPS protein was widely distributed throughout the cytoplasm (except the refractile region) and cell membrane of the E. tenella sporozoite stage, and was also distributed throughout the body of the second-generation merozoites. After the sporozoites invaded DF-1 cells, EtHPPK-DHPS was still located in the entire body of the sporozoites. As the development progressed, it was evenly distributed throughout the schizont except for the nucleus ( Figure 5 Initially, EtpABAS protein is mainly concentrated at the top of the sporozoite. As the sporozoite invades and develops, EtpABAS protein is distributed throughout the entire structure of the insect body, including the cell membrane and cytoplasm ( Figure 6 ).

[0068] Antibody blocking experiment

[0069] 1) Purification of polyclonal antibody IgG: Polyclonal antibody IgG was purified using a Protein A+G Agarose kit, and the IgG concentration was measured using a BCA kit.

[0070] 2) Cell culture: DF-1 cells were cultured at 2×10 5 The cells were seeded into 24-well plates and cultured in DMEM containing 10% fetal bovine serum for 16 h.

[0071] 3) Antibody pretreatment: Fresh sporozoites of the DS strain were labeled with carboxyfluorescein diacetate succinimidyl ester and incubated with 50, 100, 200, 300, or 400 μg / mL anti-rEtHPPK-DHPS or rEtpABAS IgG for 2 h. An equal amount of normal rabbit IgG was used as a positive control. Sporozoites not treated with antibodies were also used as a positive control.

[0072] 4) Coccidia infection: Sporozoites (6×10 5 / well), cultured at 37°C for 6 hours;

[0073] 5) Flow cytometry: The 24-well plate was washed three times with PBS to remove uninvaded parasites. The cells were digested with 0.25% trypsin and collected. The invasion efficiency was quantitatively analyzed by flow cytometry.

[0074] 6) Data processing: The inhibition rate of each group was calculated based on the positive control. Invasion inhibition rate = (1-invasion rate of treated insects / invasion rate of normal insects) × 100%.

[0075] In the above results, we found that EtHPPK-DHPS and EtpABAS are distributed on the surface of the insect body. We speculate that they may be involved in the invasion of sporozoites into host cells. In order to explore the function of EtHPPK-DHPS and EtpABAS in the invasion of sporozoites into host cells, we used rabbit anti-rEtHPPK-DHPS-IgG and EtpABAS-IgG to perform in vitro inhibition experiments. Sporozoites were incubated with polyclonal antibody IgG at different concentration gradients of 50-400 μg / mL, and IgG in healthy rabbit serum was used as a control. The invasion rate of sporozoites after 8 hours of invasion of DF-1 cells was detected by flow cytometry. The results showed that compared with the negative control (rabbit serum IgG), anti-rEtHPPK-DHPS and anti-rEtpABAS IgG could significantly reduce the invasive ability of sporozoites to DF-1 cells in a dose-dependent manner, suggesting that the two proteins play a key role in the invasion process of coccidia ( Figure 7 ).

[0076] Western blot

[0077] To analyze the expression levels of EtHPPK-DHPS and EtpABAS proteins at different developmental stages of E. tenella DS strain, worms at different developmental stages were collected and whole proteins were extracted from worms at four developmental stages: unsporulated oocysts, sporulated oocysts, sporozoites, and second-generation merozoites of the susceptible strain of E. tenella. The cells were blocked with 5% skim milk for 2 hours. The primary antibodies were rabbit anti-EtHPPK-DHPS and EtpABAS polyclonal antibodies (1:200) with γ-Tubulin as an internal control. The cells were incubated at 37°C for 1 hour. The secondary antibodies were HRP-labeled goat anti-rabbit IgG diluted in PBS (1:10,000) and incubated at room temperature for 45 minutes. The results were analyzed using a Tanon chemiluminescence imaging system. The results showed that both EtHPPK-DHPS and EtpABAS were highly expressed in the second-generation merozoite stage, while the protein expression levels in other developmental stages were extremely low ( Figure 4 ),

[0078] qPCR

[0079] The mRNA transcript levels of EtHPPK-DHPS and EtpABAS at different developmental stages of E. tenella DS strains were evaluated by qPCR. First, total RNA was extracted from unsporulated oocysts, sporulated oocysts, sporozoites, second-generation merozoites, and gametophytes of the DS strain. cDNA was synthesized from 1 μg of total RNA using random primers, and relative expression levels were determined using 18S rRNA as a reference gene. Specifically, the primer sequences for EtHPPK-DHPS were EtHPPK-DHPS-F (TCCATGGGGACGAATTTGGG (SEQ ID No. 5)) and EtHPPK-DHPS-R (GCTCCGATGATCCACGTCAT (SEQ ID No. 6)), the primer sequences for EtpABAS were EtpABAS-F (TACTTCGCCTATGAGCTGCG (SEQ ID No. 7)) and EtpABAS-R (AGCAAACACCCACAGGGAAA (SEQ ID No. 8)), and the primer sequences for 18S rRNA were 18S-F (TGTAGTGGAGTCTTGGTGATTC (SEQ ID No. 9)) and 18S-R (CCTGCTGCCTTCCTTAGATG (SEQ ID No. 10)). 2-ΔΔ was used. C The t method was used to calculate changes in gene expression. The results showed that the mRNA transcription levels of EtHPPK-DHPS and EtpABAS were highest in the second-generation merozoite stage, followed by the gametophyte stage, and were lower in other developmental stages ( Figure 3 a).

[0080] To analyze the changes in gene expression at different time points after chickens were orally inoculated with 5 × 10 7 The mRNA transcript levels of EtHPPK-DHPS and EtpABAS in the cecum of DS strain 1 to 8 days after sporulation of oocysts. RNA was extracted from cecal samples using Trizol and reverse transcribed into cDNA. Dynamometric analysis was performed using qPCR, and 18S rRNA was used as an internal control to normalize gene expression. The results showed that the mRNA transcript levels of both genes were significantly upregulated in the cecum of the worm (schizogony stage) 3 to 4 days after infection ( Figure 3 b).

[0081] The results of transcriptomic analysis showed that the transcriptomic levels of EtHPPK-DHPS and EtpABAS in the second-generation merozoites of E. tenella DZR strain were significantly higher than those in DS strain, SMR strain and MRR strain. To further verify the expression differences of EtHPPK-DHPS and EtpABAS in different insect strains, we used 18S rRNA as an internal reference and used qPCR to analyze the mRNA transcription levels of EtHPPK-DHPS and EtpABAS in the second-generation merozoites of E. tenella DS strain, different drug-resistant strains, different concentrations of DZR strains, and DZR strains isolated in the field. The analysis results showed that compared with the DS strain of E. tenella, the mRNA transcription levels of EtHPPK-DHPS and EtpABAS in the DZR strain were significantly downregulated, while the transcription levels in the MRR strain and SMR strain were not significantly different ( Figure 8 a), which is consistent with the transcriptome sequencing data. Further studies have shown that as the concentration of diclazuril increases (0.1-1.0 ppm), the mRNA transcription levels of EtHPPK-DHPS and EtpABAS genes show a dose-dependent decrease ( Figure 8 b). In addition, the mRNA transcription levels of EtHPPK-DHPS and EtpABAS in multiple diclazuril-resistant insect strains (D5, D7, and D9) isolated from the field by the single oocyst isolation method were significantly lower than those in the DS strain ( Figure 8 c), indicating that the decreased expression of EtHPPK-DHPS and EtpABAS is closely related to the diclazuril resistance of E. tenella.

[0082] Construction of overexpression strains

[0083] The present invention is the first to construct a gene-overexpressing insect strain based on a drug-resistant strain, and verify the change of its drug resistance through in vivo and in vitro experiments.

[0084] Construction of overexpression plasmid

[0085] To construct an overexpression plasmid, we amplified the coding sequences of EtHPPK-DHPS and EtpABAS in previous experiments and inserted them into an overexpression vector with a Flag tag. The expression of EtHPPK-DHPS-Flag and EtpABAS-Flag was regulated by the 5' and 3' untranslated regions (UTRs) of the E. tenella Actin gene, while the DHFR (pyrimethamine drug selection cassette)-EYFP (enhanced yellow fluorescent protein) expression cassette was driven by the EtMic2 promoter. The specific steps are as follows:

[0086] 1) Design primers with Flag homology arms and amplify Flag-tagged gene fragments from the previously constructed EtHPPK-DHPS and EtpABAS prokaryotic expression recombinant plasmids;

[0087] 2) The 5' and 3' untranslated regions of the EtActin gene and the DHFR-EYFP expression cassette driven by the EtMic2 promoter (fragment 1) were amplified from the overexpression plasmid kindly provided by Professor Xun Suo of China Agricultural University;

[0088] 3) Amplify the T vector (fragment 2) with homology arms (containing the BamHI restriction site) from the constructed overexpression plasmid;

[0089] 4) Connect the fragments EtHPPK-DHPS-flag or EtpABAS-flag, fragment 1, and fragment 2 by homologous recombination to form the recombinant EtHPPK-DHPS-OE or EtpABAS-OE plasmid. Send positive single clones to Bio-Tech for sequencing.

[0090] The primer sequence information used in the experiment is shown in Table 1:

[0091] Table 1 List of PCR primers for overexpression plasmid construction

[0092]

[0093] Coccidia transfection and screening

[0094] 1) The monoclonal bacterial suspension with successful plasmid construction confirmed by sequencing was expanded and then the plasmid was extracted and linearized in large quantities using a large-scale plasmid extraction kit (endotoxin-free) according to the instructions.

[0095] 2) Transfection was performed using a LONZA4D-Nucleofector instrument, selecting program EO-114. Immediately after transfection, 200 μL of 1640 medium was added to the Nucleofector cup to protect the transfected sporozoites.

[0096] 3) Select 7-day-old chicks for inoculation and fast for 16 hours before inoculation. During inoculation, the transfected sporozoites were drawn up with a gavage needle and 2×10 6 The chicks were inoculated via the cloaca with a dose of 100 sporozoites. Ten hours after inoculation, 150 ppm pyrimethamine was provided in the water and feed.

[0097] 4) On the 7th day after chick inoculation, collect the first generation oocysts and observe the YFP in the population under a fluorescence microscope after sporulation. + Positive oocysts.

[0098] 5) There will be YFP + Positive populations were enriched in chickens with 250 ppm and 300 ppm pyrimethamine.

[0099] 6) Purification of drug-enriched oocysts, followed by flow cytometric sorting of the purified oocysts to screen for YFP + Positive worms.

[0100] 7) Monoclonal strains were isolated using a single oocyst method under a fluorescence microscope and identified after passage and amplification in chickens.

[0101] 8) To verify the expression of the target protein in the transgenic strain, total protein was extracted from the parent strain and the transfected OE strain. The strains were identified by Western blotting using a Flag tag antibody.

[0102] 9) We detected the mRNA transcription levels of EtHPPK-DHPS and EtpABAS in the screened overexpression strains by qPCR and compared them with the transcription levels in the parent strain (DZR strain). The qPCR template was the second-generation merozoite cDNA of the overexpression strain and the parent strain, and the 18S rRNA gene of E. tenella was used as an internal reference. The results showed that after the YFP+ positive rate reached more than 50% under drug and flow cytometric enrichment and sorting, we used a single oocyst isolation and purification method to finally obtain a homozygous overexpression strain of EtHPPK-DHPS-OE ( Figure 9 a). Western blot analysis results showed that the overexpression strain successfully expressed flag-tagged EtHPPK-DHPS ( Figure 9 b). qPCR analysis further confirmed that the transcription level of EtHPPK-DHPS in the overexpression strain was significantly increased compared with the maternal strain ( Figure 9 c), demonstrated the successful overexpression of EtHPPK-DHPS in the DZR strain.

[0103] Similarly, after the YFP+ positive rate of the EtpABAS overexpression population reached more than 50% under drug and flow cytometry enrichment and sorting, we successfully obtained the homozygous overexpression strain of EtpABAS-OE using the single oocyst isolation method ( Figure 10 a). Western blot analysis results showed that the overexpression strain was able to express flag-tagged EtpABAS, while the maternal strain had no corresponding band ( Figure 10 b). qPCR analysis further confirmed that the transcription level of EtpABAS in the EtpABAS-OE strain was significantly increased compared with the maternal strain ( Figure 10 c), demonstrated the successful overexpression of EtpABAS in the DZR strain.

[0104] In vivo experiments on overexpression strains

[0105] In vivo pathogenicity detection of overexpressing insect strains

[0106] Twenty-four 14-day-old chicks of similar weight were selected and divided into four groups (6 chicks in each group). Three groups were infected, and one group served as an uninfected control group. All chicks were fed normal feed. On the second day after grouping, each chicken in each infection group was orally inoculated with 5.0×10 sporulated oocysts. 3 Feces were collected daily for 6-8 days post-infection and OPG was calculated. On day 8 post-infection, all experimental chickens were individually weighed and sacrificed, and the weight gain rate of each group was calculated. Cecal lesions were also scored.

[0107] By comparing the differences between the overexpression strain and the maternal strain in terms of oocyst excretion, cecal lesions, and mortality after infection, the virulence changes of the overexpression strain are evaluated, which helps to understand the impact of gene overexpression on the pathogenicity and virulence of the strain.

[0108] Cecal lesion scoring:

[0109] Compared with the non-infected group, the severity of cecal lesions in all infected groups was significantly aggravated. However, there was no significant difference in cecal lesion scores between the EtHPPK-DHPS-OE group and the DZR group (P=0.7208), nor did the difference between the EtpABAS-OE group and the DZR group reach a significant level (P=0.9999) ( Figure 11 a) These results indicate that the overexpressing strain is slightly less pathogenic than the parent strain and does not significantly increase mortality.

[0110] Average weight gain of chicks:

[0111] The initial body weight and body weight on day 8 after infection of each chicken were measured during the infection experiment, and the average weight gain of each group of chickens during the entire experimental period was calculated. Compared with the mother strain group (DZR), the average weight gain of the overexpression groups (EtHPPK-DHPS-OE and EtpABAS-OE) decreased, but the differences did not reach a significant level (P>0.05). Specifically, the weight gain difference between the DZR group and the HPPK-DHPS-OE group was not significant (P=0.2034), and the weight gain difference between the EtpABAS-OE group and the DZR group was also not statistically significant (P=0.7062) ( Figure 11 b) Therefore, despite the body weight changes among the different groups, the pathogenicity of the overexpressing strain did not significantly affect the growth and development of the chicks compared with the mother strain group.

[0112] Oocyst production:

[0113] Fecal samples were collected from each group of chickens on days 6 to 8 after infection, and the average number of oocysts (OPG) per gram of feces was counted using the McMaster method to assess the infection intensity of different groups. The results showed that compared with the maternal strain DZR group, the oocyst output of the EtHPPK-DHPS overexpression strain (EtHPPK-DHPS-OE group) was significantly reduced, and the difference was statistically significant (P = 0.0053); similarly, the oocyst output of the EtpABAS overexpression strain (EtpABAS-OE group) was also significantly lower than that of the DZR group (P = 0.0101) ( Figure 11 c) This experiment found that the oocyst output of the overexpressing strain was significantly reduced compared to the parent strain group. This may be because overexpression disrupts the metabolic balance of the resistant strain, resulting in restricted growth and reproduction in vivo, or because overexpression interferes with key physiological functions of E. tenella, affecting the strain's developmental cycle and adaptability.

[0114] In vivo drug resistance detection of overexpressing insect strains

[0115] Forty-two 12-day-old chicks of similar weight were selected and divided into 7 groups (6 chicks in each group). Six groups were infected and one group was used as a control group. After grouping (12 days of age), the chicks were fed with feed mixed with the corresponding drugs until the end of the experiment. At 14 days of age, the chicks were gavage-inoculated with oocysts (5.0×10 4 Between days 6 and 8 post-infection, fecal samples were collected, OPG counts were performed, and the total number of oocysts in each group was calculated. On day 8 post-infection, the chickens' body weights were recorded, and their cecal lesions were examined.

[0116] To ensure the accuracy of the results, this experiment was repeated using different batches of chickens.

[0117] Methods and standards for determining drug resistance

[0118] The following four indicators were used to evaluate the drug resistance of the insect strains: percentage of optimal anticoccidial activity (POAA), reduction in lesion score (RLS), relative oocyst production (ROP), and anticoccidial index (ACI). Coccidian resistance was comprehensively assessed using these four indicators, with the criteria being -: sensitive, -:+: mildly resistant, -:++: moderately resistant, -:+++: completely resistant, and +:++++: severely resistant.

[0119] Results showed that the EtpABAS-overexpressing strain (EtpABAS-OE) regained sensitivity to diclazuril, with its ACI, POAA, RLS, and ROP levels returning to those of the sensitive strain. The EtHPPK-DHPS-overexpressing strain (EtHPPK-DHPS-OE) maintained a resistance phenotype comparable to that of the parental DZR strain. Furthermore, the effects of folic acid supplementation on the resistance of the DZR strain and the overexpressing strains showed that folic acid supplementation did not significantly alter the sensitivity of the parent strain (DZR strain) or the overexpressing strain to diclazuril (Table 2).

[0120] Table 2 Comprehensive drug resistance determination results 3

[0121]

[0122] Note: ――――: sensitive; ―――+: mildly resistant; ―++: moderately resistant; ―+++: completely resistant; ++++: severely resistant.

[0123] Construction of gene knockout strains

[0124] The present invention successfully constructed and obtained a homozygous insect strain with drug resistance-related gene knockout for the first time, and verified the change of its drug resistance through in vivo and in vitro experiments.

[0125] Construction of knockout plasmid

[0126] 1) Guide RNAs (gRNAs) for two genes were designed using the EuPaGDT website (http: / / grna.ctegd.uga.edu). The gRNAs in the YFP-KO template vector were replaced using the ClonExpress MultiS One Step Cloning Kit, which contains SnaBI restriction sites at both ends of the T vector. The primer sequences used are shown in Table 3:

[0127] Table 3 PCR primer list

[0128]

[0129] 2) After confirming the PCR-amplified target band by agarose gel electrophoresis, the target fragment is excised and recovered. The two target fragments are ligated and subsequently transformed into Top10 competent cells for culture. Single clones are selected and amplified in LB liquid medium, followed by PCR identification of positive clones. The bacterial culture of confirmed positive clones is sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing analysis to further verify the successful insertion of the gRNA and confirm the correctness of the plasmid construction.

[0130] 2.10.2 Coccidia transfection and screening

[0131] The knockout strain was derived from the sensitive EtHCYA strain, a stably expressing Cas9 strain, using the Nucleofector 2B instrument, using the EO-114 program. Transfected parasites were inoculated into the cloaca of chickens. After drug screening and flow cytometry screening, a knockout population with a high positive rate was obtained. The specific steps are as follows:

[0132] 1) The monoclonal bacterial suspension with successful plasmid construction confirmed by sequencing was expanded and then the plasmid was extracted and linearized in large quantities using a large-scale plasmid extraction kit (endotoxin-free) according to the instructions.

[0133] 2) Transfection was performed using a LONZA 4D-Nucleofector instrument, selecting program EO-114. Immediately after transfection, 200 μL of 1640 medium was added to the nucleofector cup to protect the transfected sporozoites.

[0134] 3) Select 7-day-old chicks for inoculation and fast for 16 hours before inoculation. During inoculation, the transfected sporozoites were drawn up with a gavage needle and 2×10 6 The chicks were inoculated via the cloaca with a dose of 100 sporozoites. Ten hours after inoculation, 150 ppm pyrimethamine was provided in the water and feed.

[0135] 4) 7 days after chick inoculation, collect the first generation oocysts and observe the presence of YFP in the population under a fluorescence microscope after sporulation. + mCherry + Double-positive oocysts.

[0136] 5) There will be YFP + mCherry + Positive populations were enriched in chickens with 250 ppm and 300 ppm pyrimethamine.

[0137] 6) The drug-enriched oocysts were then sorted by flow cytometry to screen for YFP + mCherry + Positive worms.

[0138] 7) Isolate the monoclonal strain using the single oocyst method under a fluorescence microscope. Ensure that each chick is infected with only one positive oocyst. Check the feces for oocysts on the 6th to 7th day after inoculation, and check if all oocysts are YFP after sporulation. + mCherry + Double-positive oocysts.

[0139] 8) To verify the expression level of the target protein in the transgenic strain, total protein was extracted from the wild-type and transfected KO strains. Western blotting was performed using the corresponding polyclonal antibody to identify the strains.

[0140] The results showed that the linearized EtHPPK-DHPS-OE and EtpABAS-OE fragments were successfully inserted into the EtHCYA strain genome and expressed mCherry+ red fluorescence. However, the mCherry+ positive rate of primary oocysts was relatively low, less than 10%. Subsequently, 300ppm pyrimethamine drug pressure combined with flow cytometry sorting and enrichment technology were used to sort the YFP+mCherry+ dual-fluorescent sporulated oocysts. Observation under a fluorescence microscope showed that the positive rate of the gene knockout population was significantly improved, reaching over 50%.

[0141] Genomic DNA was extracted from EtHPPK-DHPS-KO oocysts with a positive rate of 50% for YFP+mCherry+ dual fluorescence. PCR amplification of the gRNA-targeted region was performed, and the PCR products were recovered and sequenced. The results showed that in the EtHPPK-DHPS-KO mutant population, there was a base mutation close to the PAM sequence, but no base deletions or frameshifts were found in the EtHPPK-DHPS mutant population.

[0142] The positive rate of YFP+mCherry+ double fluorescence of EtpABAS-KO was 50% ( Figure 12 a) oocysts were used to extract genomic DNA, and PCR amplification was performed on the gRNA targeting region of the knockout group. The results showed that there were uniform target bands ( Figure 12 b). After the PCR product is recovered, T cloning and sequencing are performed ( Figure 12 c) The results showed that in the EtpABAS-KO mutant mixed population, there were base deletions of varying degrees at the end closer to the PAM sequence ( Figure 12d). From a knockout population with a 50% positive rate and identified base deletions, we successfully screened a homozygous YFP+mCherry+dual-fluorescence EtpABAS-KO strain using a single oocyst assay. Subsequent testing revealed that the genomic deletion in this strain was located in the coding region (225-235 bp, 10 bp in length), leading to premature translation termination and, ultimately, loss of the EtpABAS protein.

[0143] To verify the expression of EtpABAS in the homozygous EtpABAS-KO strain, the Western Blot method was used to detect and analyze the expression of EtpABAS in the EtpABAS-KO strain and the parent worm strain (EtHCYA) using the Anti-rEtpABAS polyclonal antibody as the specific primary antibody and the α-Tubulin monoclonal antibody as the internal reference primary antibody. The results showed that: α-Tubulin bands were observed in both the EtpABAS-KO strain and the EtHCYA strain, indicating that the protein samples of these two strains were normal and the results were reliable; the EtpABAS target band was detected in the EtHCYA strain, while EtpABAS was not recognized in the EtpABAS-KO strain, indicating the absence of EtpABAS protein in the knockout strain ( Figure 13 ).

[0144] In vivo experiments on gene knockout strains

[0145] In vivo pathogenicity detection of gene knockout strains

[0146] Eighteen 14-day-old chicks of similar weight were selected and divided into three groups (6 chicks in each group). Two groups were infected, and one group served as an uninfected control group. All chicks were fed normal feed. On the second day after grouping, each chicken in each infection group was orally inoculated with 5.0×10 sporulated oocysts. 3 Feces were collected daily for 6-8 days post-infection and OPG was calculated. On day 8 post-infection, all experimental chickens were individually weighed and euthanized, and the weight gain rate of each group was calculated. Cecal lesions were also scored. By comparing the gene-deficient strain with the maternal strain in terms of oocyst excretion, cecal lesions, and mortality after infection, the virulence of the gene-deficient strain was evaluated, which helps to understand the impact of the gene deletion on the pathogenicity and virulence of the strain.

[0147] Assessment of cecal lesions:

[0148] The results showed that there was no significant difference in the scores of cecal lesions between EtpABAS-KO and EtHCYA on the 8th day of infection (P=0.6867, Figure 14 a). This indicates that despite the EtpABAS gene being knocked out, the knockout strain has little effect on the severity of cecal lesions in chicks, especially in terms of intestinal bleeding and intestinal wall thickening.

[0149] Weight gain:

[0150] The initial weight of each chicken and the weight on the 8th day after infection were measured during the infection experiment, and the average weight gain of each group of chickens during the entire experimental period was calculated. The results showed that there was no significant difference between the mother strain group and the gene knockout group (P = 0.0761, Figure 14 b) This suggests that infection with the gene-deficient strain has limited impact on chick weight gain. While EtpABAS knockout may alter certain biological characteristics of the strain, its effect on host growth is minimal, at least within the short-term experimental period, with no significant weight changes observed.

[0151] Oocyst production:

[0152] During the experiment, fecal samples were collected from each group of chickens on the 6th to 8th day after infection, and OPG was counted to evaluate the infection intensity of different groups. The results showed that the oocyst production of the mother strain group was significantly higher than that of the gene knockout group (P = 0.0037, Figure 14 c) This difference suggests that the gene deletion may have affected the strain's reproductive ability.

[0153] In vivo drug resistance detection of gene knockout insect strains

[0154] Forty-two 12-day-old chicks of similar weight were divided into seven groups of six, six of which underwent infection, and one served as an uninfected control group. Starting at day 12 after grouping (at day 12), the chicks were fed a feed mixed with the corresponding drug until the end of the experiment. At day 14, they were gavage-inoculated with oocysts. Between days 6 and 8 after infection, fecal samples were collected, and OPG counts were counted. The total number of oocysts in each group was calculated based on the number of oocysts. On day 8 after infection, the chicks' weights were recorded, and their cecal lesions were examined.

[0155] In vivo resistance experiments were conducted in replicates using different batches of chickens. Four indicators were used to analyze the resistance of the strains: percent optimal anticoccidial activity (POAA), reduction in lesion score (RLS), relative oocysts (ROP), and anticoccidial index (ACI). The results showed that the EtpABAS-KO strain exhibited moderate resistance to 0.05 ppm diclazuril and remained susceptible to maduramicin, while the parent strain, EtHCYA, remained susceptible to both diclazuril and maduramicin (Table 4). Furthermore, it was found that supplementing the diet with folic acid, even when trace amounts of folic acid were already present, could partially restore E. tenella's sensitivity to diclazuril.

[0156] Table 4 Comprehensive drug resistance determination results

[0157]

[0158] Note: ――――: sensitive; ―――+: mildly resistant; ―++: moderately resistant; ―+++: completely resistant; ++++: severely resistant.

[0159] ELISA test

[0160] The enzyme activity and metabolite levels of the folate synthesis pathway in different strains of E. tenella were evaluated by ELISA. According to the kit instructions, ELISA kits for pABA, DHPS, DHF and folic acid were used to determine the enzyme activities and metabolite levels of the folate synthesis pathway in DS, DZR, EtHPPK-DHPS-OE, EtpABAS-OE and EtpABAS-KO strains. The results showed that compared with the DS strain, the level of pABA in the DZR strain was significantly decreased, which may be due to the reduced expression level of EtpABAS in the DZR strain; compared with the DZR strain, the pABA level in the EtpABAS-OE strain (overexpressing EtpABAS in DZR) was significantly higher than that in DZR, indicating that overexpression of EtpABAS promoted the accumulation of pABA ( Figure 15 a). In terms of DHPS enzyme activity, the DS strain had significantly higher enzyme activity than the DZR strain (P<0.05), which was consistent with the transcriptome and qPCR results. Compared with the DZR strain, the DHPS enzyme activity of the EtHPPK-DHPS-OE strain (overexpressing EtHPPK-DHPS in DZR) was significantly increased, indicating that overexpression of this gene enhanced the activity of DHPS ( Figure 15 b). In addition, there was no significant difference in dihydrofolate (DHF) between different strains, showing similar metabolic or enzyme activity levels ( Figure 15 c). In terms of folic acid levels, the concentrations of EtHPPK-DHPS-OE and DZR strains were slightly higher than those of other strains, while there was no significant difference between DS, EtpABAS-OE and EtpABAS-KO strains ( Figure 15 d).

[0161] In order to further study the effects of drugs on E. tenella folate metabolism, ELISA was used to detect enzyme activity and metabolite levels in the worm body and culture medium before and after the treatment with diclazuril. The sporozoites of the DS and DZR strains were resuspended in the culture medium, and the diclazuril-treated group (10 μg / mL) and the control group (no drug treatment) were added and incubated at 37°C for 12 hours. After incubation, the worm body and the culture medium were separated by centrifugation, and the worm body pellet was washed to remove the culture medium residue. Subsequently, the metabolites and enzyme activities in the culture medium and the worm body were detected respectively. The results showed that after the action of diclazuril, the DS and DZR strains showed significant differences in metabolites related to the folate synthesis pathway (pABA, DHF, Folic acid). The resistant strain (DZR) generally showed a decrease in metabolites in the culture medium and an increase in metabolites in the worm body, suggesting that it may adapt to drug pressure by enhancing the uptake or internal synthesis of key metabolites ( Figure 16 ).

[0162] In vitro experiments to detect the effects of diclazuril on the invasion of different E. tenella strains into DF-1 cells

[0163] 1) Drug preparation: Use dimethyl sulfoxide (DMSO) as solvent and deionized water as diluent to dissolve diclazuril and maduramycin to make fresh stock solutions of 1000 μg / mL.

[0164] 2) Cell culture: DF-1 cells were cultured at 2×10 5 The cells were seeded into 24-well plates and cultured in DMEM containing 10% fetal bovine serum at 37°C and 5% CO2 for 16 hours.

[0165] 3) Purification of sporozoites: Fresh sporozoites of the EtHPPK-OE-DZR, EtpABAS-OE-DZR, DZR, EtpABAS-KO, and DS strains were extracted and labeled with carboxyfluorescein diacetate succinyl ester dye, according to the instructions of the manufacturer's instructions, to remove the DZR and DS strains that did not autofluoresce.

[0166] 4) Drug Incubation: Labeled sporozoites were suspended in complete medium (10% FBS + 1% double-antibody). Dissolved diclazuril was added to the medium at concentrations of 0 μg / mL, 0.5 μg / mL, 1 μg / mL, 2.5 μg / mL, 5 μg / mL, and 10 μg / mL, respectively, and incubated with the sporozoites at 41°C for 3 hours. As controls, sporozoites of the DZR and DS strains were incubated with varying concentrations of maduramycin (1-10 μg / mL) for 3 hours.

[0167] 5) Cell invasion: After drug incubation, 600,000 sporozoites were added to a 24-well plate containing DF-1 cells at each well and infected at 41° C. and 5% CO 2 for 6 hours.

[0168] 6) Flow cytometry: After 6 hours of co-culture, the culture medium in the 24-well plate was aspirated and the cells were washed twice with PBS to remove uninvaded sporozoites. The cells were then digested with trypsin and resuspended in 200 μL of PBS. The invasion rate was measured by flow cytometry.

[0169] The results showed that under the action of different concentrations of diclazuril, the sporozoite invasion of all insect strains did not show significant changes ( Figure 17 a), which may be because diclazuril acts on the schizont stage, not the sporozoite stage. Maduramycin significantly inhibited the invasion of sporozoites, and the inhibition rate was dose-dependent, while there was no significant difference between the diclazuril treatment groups ( Figure 17 b).

[0170] In vitro experiments to examine the effects of diclazuril on the development of different E. tenella strains

[0171] 1) Drug preparation: Dissolve diclazuril in dimethyl sulfoxide (DMSO) as solvent and deionized water as diluent to a fresh stock solution of 10,000 μg / mL.

[0172] 2) Cell culture: DF-1 cells were cultured at 3×10 5 Cells were seeded into 6-well plates and cultured in DMEM containing 5% fetal bovine serum at 37°C and 5% CO2 for 16 hours.

[0173] 3) Sporozoite infection: Fresh sporozoites of the DZR and DS strains were extracted and added to a 6-well plate containing DF-1 cells at a volume of 900,000 per well.

[0174] 4) Washing: 24 hours after infection, aspirate the culture medium and add 1 mL of PBS to each well. Gently shake and aspirate the PBS. Repeat three times to wash away uninvaded sporozoites. Sporozoite invasion can be observed under an inverted microscope.

[0175] 5) Drug co-incubation: 2 mL of complete culture medium was added to each well, and diclazuril was added to the culture medium at concentrations of 0 μg / mL, 1 μg / mL, 2.5 μg / mL, 5 μg / mL, 10 μg / mL, and 20 μg / mL.

[0176] 6) Parasite Development: After adding the drug, continue culturing for 48 hours, i.e., 24 to 72 hours after infection, coccidia and the drug are co-cultured. After 72 hours of infection, the parasites develop into mature schizonts, which can be observed under a microscope.

[0177] 7) Absolute Fluorescence Quantification: Cells and coccidia within them were digested with trypsin, and genomic DNA from cells and coccidia under different treatments was extracted using a blood / cell / tissue genomic DNA extraction kit. Absolute fluorescence quantitative PCR (Absolute qPCR) was used, using the E. tenella 5S gene as an internal reference (5S-F: TCATCACCCAAAGGGATT; 5S-R: TTCATACTGCGTCTAATGCAC) and the pGEX-T Easy plasmid containing the 5S coding sequence as a standard to establish a standard curve. The copy number of coccidia under different treatments was determined. Data were statistically analyzed using GraphPad Prism 6 software.

[0178] The results showed that compared with the control group, 1-20 μg / mL of diclazuril significantly inhibited the reproduction level of DS strain, while high concentrations of diclazuril (10 and 20 μg / mL) inhibited the reproduction level of DZR strain ( Figure 18 ), the results showed that diclazuril mainly acts on the development and reproduction stage of coccidia, diclazuril has no effect on the schizogony of DZR strain in host cells, while the reproduction of DS strain will be significantly inhibited by low concentrations of diclazuril.

[0179] In vitro assay to examine the effects of folic acid / folic acid precursors on diclazuril resistance in different E. tenella strains

[0180] This invention is the first to evaluate the effects of diclazuril treatment and folic acid supply on the reproductive capacity of different strains of E. tenella through in vitro reproduction experiments. In the experiment, folic acid supply was controlled by setting different culture media. 4.0 mg / L folic acid was added to the normal culture medium according to the factory standard to simulate the physiological environment with sufficient folic acid, while folic acid-free culture medium was not added with folic acid to serve as a control under folic acid deficiency conditions. Diclazuril solution used dimethyl sulfoxide as solvent and deionized water as diluent to dissolve into a fresh stock solution of 10,000 μg / mL. First, DF-1 cells were cultured at 3×10 per well. 5The cells were inoculated into 6-well plates and cultured at 37°C and 5% CO2 for 16 hours. Then, sporozoites extracted from resistant and sensitive strains of E. tenella (including DZR, DS, EtHPPK-DHPS-OE, EtpABAS-OE and EtpABAS-KO) were used for infection at a rate of 900,000 per well. After 24 hours of infection, the non-invading sporozoites were removed by washing with PBS. Subsequently, diclazuril was added at a concentration of 10 μg / mL to culture medium containing folic acid and culture medium without folic acid, and a control group was set up for co-incubation for 48 hours. Finally, Absolute qPCR technology was used to extract genomic DNA from cells and parasites, and the effect of folic acid on diclazuril resistance and drug sensitivity was evaluated by comparing the parasite loads in different treatment groups.

[0181] In normal culture medium (+Folate), the addition of diclazuril (+Diclazuril) resulted in a significant decrease in parasite numbers in the DS strain compared to the drug-free control (-Diclazuril). However, the DZR and EtHPPK-DHPS-OE strains exhibited drug resistance, maintaining their numbers at high levels. In folic acid-free and drug-free culture medium (-Folate, -Diclazuril), the reproductive capacity of all three strains decreased significantly, suggesting that while coccidia can synthesize folate, environmental folate / folate precursor deficiencies can also affect their development. Furthermore, the EtHPPK-DHPS-OE strain showed the smallest decrease in parasite numbers, suggesting that folic acid deficiency may help the EtHPPK-DHPS-OE strain maintain basic reproductive capacity. After adding the drug to the folic acid-free medium (-Folate, +Diclazuril), the number of parasites in the DS, DZR, and EtHPPK-DHPS-OE strains decreased significantly, indicating that in a folic acid-free environment, diclazuril significantly inhibits the reproduction of coccidia, including the reproduction of drug-resistant strains ( Figure 19 a).

[0182] Compared with the drug-free group, after adding diclazuril to the folic acid-containing medium (+Folate, +Diclazuril), the number of worms in the DS strain decreased significantly, the DZR strain showed drug resistance, and the number of worms in the EtpABAS-OE strain also decreased significantly, suggesting that EtpABAS overexpression affects the resistance of the worm to diclazuril. Similarly, in the folic acid-free medium (-Folate, -Diclazuril), the number of worms in the three strains decreased, and after adding diclazuril (-Folate, +Diclazuril), the number of worms in the DS strain, DZR strain, and EtpABAS-OE strain decreased further ( Figure 19 b), indicating that diclazuril significantly inhibits the reproduction of coccidia.

[0183] From the EtpABAS-KO group ( Figure 19 Results from (c) show that after adding diclazuril to normal culture medium containing folic acid (+Folate, +Diclazuril), the DS strain showed a significant decrease in colonization, the DZR strain displayed resistance, and the EtpABAS-KO strain exhibited similar behavior to the DS strain. Compared to normal culture medium, colonization of all three strains in folic acid-free culture medium (-Folate, -Diclazuril) significantly decreased, with the EtpABAS-KO strain experiencing the most significant decrease. This suggests that knockout of the EtpABAS gene severely inhibits parasite reproduction under conditions of folic acid deficiency. Adding diclazuril to folic acid-free culture medium (-Folate, +Diclazuril) further decreased the colonization of all strains, indicating that folic acid deficiency impairs parasite reproduction under the influence of diclazuril.

[0184] 3.18 Effects of pABA or sulfonamide on the sensitivity of different E. tenella strains to diclazuril

[0185] To further investigate the impact of folic acid precursors on coccidia resistance, DS and DZR strains were incubated with varying concentrations of pABA (0, 20, 40, 80, and 100 μM) and sulfonamide (0, 20, 40, 80, and 100 μM) in combination with 10 μg / mL diclazuril. After 48 hours of incubation, parasite loads were measured using Absolute qPCR to assess the effects of pABA and sulfonamide on diclazuril susceptibility in the different treatment groups. To minimize interference with folic acid, all experiments were conducted in folic acid-free medium.

[0186] The results showed that, compared with the control group (NS), when there was no pABA or folic acid in the culture medium, the addition of diclazuril led to a significant decrease in the reproduction level of DS and DZR strains, with the DS strain decreasing more significantly ( Figure 20 a). However, in the presence of diclazuril, the addition of pABA also restored and enhanced parasite reproduction, and the higher the concentration, the greater the degree of recovery. In addition, at a concentration of 100 μM pABA, the DS strain still showed significant differences from the control group, while the DZR strain showed no significant difference from the control group at a concentration of 60 μM pABA, indicating that the DZR strain has a stronger ability to utilize pABA ( Figure 20 a). In contrast, sulfonamide (Sulfa) can competitively inhibit the utilization of the substrate pABA by DHPS. In this study, we observed that when diclazuril was present in the folic acid-free medium, the additional addition of sulfonamide further inhibited the reproductive capacity of the DS and DZR strains. It is worth noting that compared with the DS strain, the inhibitory effect of sulfonamide on the reproduction of the DZR strain showed a more significant dose-dependent relationship, that is, as the concentration of sulfonamide gradually increased, the parasite load of the DZR strain showed a significant downward trend ( Figure 20 b).

[0187] The present invention also investigates the effects of folic acid or pABA combined with sulfonamide on diclazuril resistance in different E. tenella strains. In the experiment, either normal culture medium or folic acid-free culture medium was used to investigate whether folic acid or pABA could compensate for the inhibitory effects of sulfonamide on E. tenella. By comparing the development of the insects in the different treatment groups, the compensatory effects of folic acid or pABA on diclazuril resistance in the presence of sulfonamide were evaluated.

[0188] turn out:

[0189] 1) Compensatory effect of exogenous folic acid on the combined action of diclazuril and sulfonamide ( Figure 21 a) The Folate group served as the control (normal culture medium containing folic acid, no drug); the Folate+Dic group served as normal culture medium supplemented with diclazuril (10 μg / mL); and the Folate+Dic+Sulfa group served as normal culture medium supplemented with both diclazuril (10 μg / mL) and sulfonamide (40 μM). For the DS strain, the Folate+Dic group showed a significant decrease in parasite counts compared to the control, indicating that diclazuril inhibits the growth of the DS strain. The Folate+Dic+Sulfa group showed an even greater decrease in parasite counts than the diclazuril alone, suggesting that the addition of sulfonamide further enhanced the inhibitory effect of diclazuril on the DS strain. For the DZR strain, the Folate+Dic group showed no significant difference in parasite counts compared to the control, demonstrating clear diclazuril resistance. The Folate+Dic+Sulfa group showed a significant decrease in parasite counts, indicating that the combination of sulfonamide and diclazuril inhibited the growth of the resistant strain. In comparison, after the addition of sulfonamide, the downward trend of DS strain was more significant than that of DZR strain.

[0190] 2) In the absence of folic acid, investigate whether pABA can replace folic acid to antagonize the inhibitory effect of sulfonamides ( Figure 21b) Four treatment conditions were established: the control group consisted of a folic acid-free culture medium with no drug intervention; the Dic group added diclazuril; the Dic+pABA group added diclazuril and pABA; and the Dic+pABA+Sulfa group added sulfonamide in addition to diclazuril and pABA. Results showed that compared with the control group, the DS strain significantly decreased in number after the addition of diclazuril, demonstrating sensitivity to diclazuril. However, the addition of pABA did not significantly affect the DS strain compared with the Dic group, indicating that pABA failed to reverse the inhibitory effect of diclazuril on the DS strain. The addition of sulfonamide also did not significantly affect the DS strain compared with the first two groups. Results for the DZR strain showed that, in a folic acid- and pABA-free environment, the addition of diclazuril caused a decrease in the DZR strain's reproductive level. Compared with the diclazuril-treated group, the addition of exogenous pABA significantly enhanced the drug-induced reproductive level. Furthermore, the Dic+pABA+Sulfa group experienced a significant decrease in number, indicating that sulfonamide can still effectively inhibit drug-resistant strains in the presence of pABA.

[0191] Overall, the combined drug experiments revealed that, in folic acid-containing medium, diclazuril reduced the proliferation of the DS strain but had no significant effect on the DZR strain. Furthermore, the addition of sulfonamide synergistically enhanced the inhibitory effect of diclazuril on both DS and DZR strains. Furthermore, under the influence of diclazuril, the addition of pABA enhanced the proliferation of the DZR strain, while sulfonamide, by interfering with the pABA utilization pathway, led to a more significant decrease in the proliferation of the DZR strain under drug treatment.

[0192] The above description of the embodiments is intended to facilitate understanding and use of the present invention by those skilled in the art. Those skilled in the art will readily be able to make various modifications to these embodiments and apply the general principles described herein to other embodiments without resorting to creative effort. Therefore, the present invention is not limited to the above-described embodiments. Any improvements or modifications made by those skilled in the art based on the principles of the present invention that do not depart from the scope of the present invention should be considered within the scope of protection of the present invention.

Claims

1. The use of para-aminobenzoate synthase (EtpABAS) and / or hydroxymethyldihydropterin pyrophosphokinase-dihydropteroate synthase (EtHPPK-DHPS) as molecular markers associated with diclazuril resistance of Eimeria tenella, wherein the association with diclazuril resistance means that the expression levels of EtpABAS and EtHPPK-DHPS are significantly downregulated in the diclazuril-resistant strain (DZR), indicating that the resistance of Eimeria tenella to diclazuril is increased.

2. A molecular marker that can quickly detect drug resistance of Eimeria, wherein the molecular marker is EtHPPK-DHPS and / or EtHPPK-DHPS, and the drug resistance is the resistance of Eimeria tenella to diclazuril.

3. A method for regulating the sensitivity of Eimeria tenella to diclazuril, characterized in that The method achieves the change of sensitivity to diclazuril by regulating the expression level of EtpABAS.

4. The method according to claim 3, wherein Increasing the expression of EtpABAS can significantly restore the sensitivity of the DZR strain to diclazuril, while knocking out EtpABAS can significantly enhance the strain's resistance to diclazuril.

5. Use of diclazuril and sulfonamide in the preparation of a pharmaceutical composition for synergistically inhibiting Eimeria tenella.

6. A primer pair for respectively amplifying the molecular marker according to claim 2.

7. The primer according to claim 6, wherein The primers are specifically: EtHPPK-DHPS-F: GCGTGGATCCCCGGAATTCATGTTTCATTTAACCAGTCC (SEQ ID No. 1); EtHPPK-DHPS-R: CACGATGCGGCCGCTCGAGGCTGCTTTCCGCGGGAAACA (SEQ ID No. 2); EtpABAS-F: CGGTACCCTCGAGGGATCCATGGCCATTCAACACTCGAC (SEQ ID No. 2) No. 3); EtpABAS-R: GACTGCAGGTCGACAAGCTTGGTGGCGCACCTGAGGAAAG (SEQ ID No. 4).

8. Use of the primers according to claim 6 or 7 in preparing a kit for rapidly detecting molecular markers of coccidia drug resistance.

9. The use according to claim 8, wherein the use is to determine the resistance of Eimeria tenella to diclazuril by PCR detection.

Images