Engineered macrophage, and pharmaceutical composition and application thereof

Abstract

The invention discloses an engineered macrophage and a pharmaceutical composition and application thereof, and CCM3 expression in the engineered macrophage is inhibited, so that the engineered macrophage is polarized towards the M2 direction or the engineered macrophage is an M2 type macrophage. Besides, the invention further develops a temperature-sensitive cell-loaded hydrogel preparation which can promote polarization of macrophages in the M2 direction by inhibiting expression of signal molecules CCM3 on adhesion spots, and the temperature-sensitive cell-loaded hydrogel preparation can promote bone defect immune osteogenesis through local injection.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, specifically to engineered macrophages, pharmaceutical compositions containing the same, and uses thereof, and particularly to a pharmaceutical composition for promoting macrophage immune osteogenesis by inhibiting the expression of CCM3 molecules on focal adhesions. Background Art

[0002] Macrophages, primarily differentiated from monocytes, are a crucial component of the immune system. They phagocytose foreign invaders and also regulate tissue homeostasis. Unlike other terminally differentiated cells, macrophages possess a high degree of plasticity, enabling them to perform diverse functions. Macrophages can be categorized as either M1 or M2, depending on their pro-inflammatory or anti-inflammatory states. In conditions such as obesity and rheumatoid arthritis, macrophages often polarize toward the M1 pathway. In this scenario, they primarily secrete a range of proinflammatory cytokines, including IL-6, CCR7, TNF-α, and iNOS, which have been identified as key mediators and drivers of chronic inflammatory and autoimmune diseases. Conversely, when macrophages polarize toward the M2 pathway, they secrete anti-inflammatory factors such as CD206, IL-10, ARG-1, and YM-1, which are involved in tissue repair. Therefore, inducing macrophages toward the M2 pathway is crucial in the immune microenvironment of fractures.

[0003] Fracture healing is a very slow process, typically progressing through stages of hematoma organization, callus formation, and callus hardening and reshaping. With traditional fixation alone, complete healing takes nine months to a year and a half. In recent years, rigid internal fixation has accelerated healing by allowing direct healing of the fracture ends, bypassing callus healing. However, bony healing still requires at least three months, and complete healing to the point of normal function requires at least six months. During this period, patients are required to wear protective gear that restricts their movements, significantly impacting their daily lives.

[0004] Immune osteogenesis is a method of accelerating fracture healing by artificially changing the immune microenvironment of the fracture ends. Usually, macrophages can be induced to polarize toward M2 to secrete a variety of factors that promote bone tissue repair, thereby accelerating fracture healing. This method is equivalent to adding promoters to traditional fracture healing, which can effectively shorten the fracture healing time and facilitate patients to resume daily activities as soon as possible. However, in order to achieve the purpose of repair, macrophage M2 polarization requires artificial induction. The traditional experimental method is to use IL-4 inducing factor to polarize experimental macrophages to M2 type in vitro, but IL-4 is rarely used for in vivo injection because although it is an anti-inflammatory factor, it has many targets in the body, which may disrupt immune homeostasis, accelerate tumor progression, and may aggravate allergic diseases such as asthma.

[0005] In addition, some special metal or polymer materials and drugs have been developed to polarize macrophages toward M2. However, these methods all present certain problems. First, after implantation, the materials typically do not degrade, leading to a series of problems. For example, if a non-degradable solid material is implanted in a defect, the material's space-occupying effect will prevent the defect from healing. Second, the use of drugs to induce macrophage polarization is often temporary. Once the drug enters the body, it is metabolized, and macrophages can be regulated and polarized for a short period of time. However, after the blood drug concentration decreases, the plasticity of the macrophages causes them to return to the M0 state, losing their ability to regulate osteogenesis. Long-term use of drugs to promote macrophage polarization is unrealistic and harmful to health. Furthermore, drugs often cause macrophages in other parts of the body to polarize simultaneously, which is very dangerous, especially for patients with allergic diseases such as asthma.

[0006] The information in the background technology is only intended to illustrate the general background of the invention and should not be regarded as an admission or any form of suggestion that this information constitutes the prior art known to a person of ordinary skill in the art. Summary of the Invention

[0007] To solve at least some of the technical problems in the prior art, the present invention provides a solution that can stably maintain macrophages in the M2 state, thereby effectively promoting immune osteogenesis around the defect. Specifically, the present invention includes the following contents.

[0008] In a first aspect of the present invention, a use of a CCM3 inhibitor in the preparation of a drug for immune osteogenesis (particularly a drug for promoting macrophage immune osteogenesis) is provided, wherein the CCM3 inhibitor comprises an agent that inhibits the expression of the CCM3 gene and / or reduces the amount of CCM3 protein.

[0009] In certain embodiments, according to the use of the present invention, the CCM3 inhibitor is selected from at least one of the following: (1) Agents that inhibit the transcriptional activity of the CCM3 gene; (2) agents that inhibit the transcription level of CCM3 mRNA; (3) agents that promote CCM3 mRNA degradation; (3) siRNA or shRNA targeting the CCM3 gene; (4) agents that inhibit the translation of CCM3 mRNA; (5) a reagent that specifically recognizes the guide nucleic acid of the CCM3 gene and cleaves it to reduce its expression level; (6) agents that reduce CCM3 protein activity; (7) Competitive binding with CCM3 and FAK for Paxillin.

[0010] In certain embodiments, according to the use of the present invention, the CCM3 inhibitor comprises an anti-CCM3 antibody.

[0011] In certain embodiments, according to the use of the present invention, the CCM3 inhibitor can polarize the macrophages toward M2 or polarize the macrophages into M2 macrophages, thereby promoting immune osteogenesis.

[0012] A second aspect of the present invention provides an engineered macrophage, wherein the expression of CCM3 in the engineered macrophage is inhibited, so that the macrophage is polarized toward M2 or the macrophage is polarized into an M2 macrophage.

[0013] The third aspect of the present invention provides a pharmaceutical composition for promoting bone repair, comprising the above-mentioned engineered macrophages and an optional pharmaceutically acceptable carrier.

[0014] In certain embodiments, according to the pharmaceutical composition for promoting bone repair of the present invention, the carrier comprises gel.

[0015] In a fourth aspect, the present invention provides a method for regulating macrophage polarization in vitro, wherein the regulation includes polarizing the macrophages in the M2 direction or polarizing the macrophages into M2 macrophages, and the method includes the steps of contacting and culturing the macrophages in vitro with a CCM3 inhibitor, wherein the CCM3 inhibitor includes an agent that inhibits the expression of the CCM3 gene and / or reduces the amount of CCM3 protein.

[0016] A fifth aspect of the present invention provides a method for screening a compound useful for improving or promoting bone repair, comprising: 1) measuring the expression of the CCM3 gene and / or the amount of the CCM3 protein from the model to obtain a first measurement value; 2) administering the compound to be tested to the model; 3) measuring the expression of the CCM3 gene and / or the amount of the CCM3 protein in macrophages of a sample collected from the model after administration of the test compound to obtain a second measurement value; 4) comparing the first measurement value and the second measurement value; 5) when the first measured value is higher than the second measured value, i.e., CCM3 gene expression in the macrophages is in an inhibited state, the test compound is screened as a compound useful for improving or promoting bone repair; When the first measurement value is equal to or lower than the second measurement value, that is, the CCM3 gene expression in the macrophages is in a non-inhibited or activated state, the compound is screened as a compound that is useless for improving or promoting bone repair.

[0017] In certain embodiments, according to the method for screening compounds useful for improving or promoting bone repair according to the present invention, the model comprises an animal model or a cell model.

[0018] In the present invention, CCM3 is a signaling molecule located on focal adhesions that can competitively inhibit Paxillin with FAK, leading to a shift in intracellular mechanical signals. The effect of CCM3 on macrophages is still unclear. The pharmaceutical composition and method of the present invention can safely and locally promote macrophage polarization and accelerate immune osteogenesis. In addition, the present invention has also developed a thermosensitive cell-laden hydrogel formulation that can inhibit CCM3 expression and promote macrophage polarization in the M2 direction, which can promote immune osteogenesis in bone defects through local injection. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 A map of the vector expressing sgRNA is shown.

[0020] Figure 2 Schematic diagram of the results of PCR verification of lentiviral knockdown.

[0021] Figure 3 Laser confocal microscopy was used to observe the fluorescence expression of CD206 molecules after CCM3 gene knockdown.

[0022] Figure 4 The results of qPCR detection of M2 marker expression are shown.

[0023] Figure 5 MicroCT images of CCM3 knockdown cell-laden hydrogels implanted into bone defects 4 weeks later.

[0024] Figure 6 Degradation rates for an exemplary carrier, F127DA, are shown. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described in the present invention are only for describing particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges in the present invention, it should be understood that the upper and lower limits of the ranges and each intermediate value therebetween are specifically disclosed. Each smaller range between any stated value or intermediate value within a stated range and any other stated value or intermediate value within the stated range is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0028] use One aspect of the present invention provides the use of an agent that inhibits CCM3 expression in the preparation of a medicament for promoting macrophage immune osteogenesis. The inventors have found that the use of a CCM3 inhibitor can reduce, reduce or inhibit the CCM3 gene expression of macrophages and / or reduce the amount of CCM3 protein, thereby polarizing macrophages in the M2 direction and maintaining an M2 state (M2 phase, i.e., macrophages are M2 type macrophages at this time). During this period, no other factor induction is required, and then the healing of bone defects can be accelerated in a short period of time. Preferably, after treating macrophages with a CCM3 inhibitor, the expression level of CD206 of the macrophages increases and / or the expression level of IL-10 and Arg1 molecules of the macrophages increases.

[0029] Unless otherwise specified, the "amount" used in the present invention to describe gene expression or protein includes both relative and absolute amounts.

[0030] In the present invention, the gene expression level or protein level of CCM3 and related markers (CD206, IL-10 and Arg1) can be determined by any method known in the art, without particular limitation. Those skilled in the art are familiar with how to determine the expression amount of related genes or the amount of related proteins, such as using antibodies that specifically bind to the above proteins, or probes for related genes, or primers designed to amplify the related genes.

[0031] In the present invention, CCM3 inhibitors include agents that inhibit the expression of the CCM3 gene and / or reduce the amount of CCM3 protein. Preferably, the agent includes a macromolecule or small molecule agent that can inhibit the expression of the CCM3 gene and / or reduce the amount of CCM3 protein. Examples of the macromolecule include, but are not limited to, nucleic acids (e.g., DNA or RNA), proteins, polypeptides, antibodies (including monoclonal antibodies, polyclonal antibodies, multispecific antibodies, or fragments thereof), etc. In certain specific embodiments, the macromolecule agent is an anti-CCM3 antibody. Examples of the small molecule include, but are not limited to, small molecule compounds, etc. It will be understood that any inhibitor capable of inhibiting CCM3 gene expression can be used in the present invention.

[0032] In the present invention, CCM3 inhibitors include, but are not limited to, agents that inhibit the transcriptional activity of the CCM3 gene, agents that inhibit the transcription level of CCM3 mRNA, agents that promote the degradation of CCM3 mRNA, siRNA or shRNA targeting the CCM3 gene, agents that inhibit the translation of CCM3 mRNA, and agents that specifically recognize the guide nucleic acid of the CCM3 gene and cleave it to reduce its expression level.

[0033] In a preferred embodiment, the CCM3 gene expression inhibitor used in the present invention includes a CRISPR / Cas9 system, interfering RNA, or antisense oligonucleotide, particularly an siRNA or sgRNA directed against or targeting CCM3. Although certain specific sequences are shown herein, those skilled in the art can design and obtain relevant nucleic acid sequences based on protein and gene databases and nucleic acid synthesis methods known in the art.

[0034] In the present invention, antisense oligonucleotides include DNA, RNA, or derivatives, analogs, or fragments thereof. Antisense oligonucleotides can inhibit the translation of SH3BGR mRNA protein by binding to specific CCM3 mRNA. The length of the antisense oligonucleotide can range from about 5 to about 150 nucleotides, without particular limitation.

[0035] In certain embodiments, the present invention uses an sgRNA targeting CCM3 as a preferred inhibitor. A non-limiting sequence of the sgRNA is as follows: AGGCATAGAAACCATGGAAG. When an sgRNA is used as an inhibitor, the CCM3 inhibitor of the present invention also includes a recombinant vector, such as a plasmid, containing the above-mentioned sgRNA. In the present invention, the expression vector can be a DNA vector, such as a viral vector or a plasmid, in particular a vector suitable for expressing nucleic acids in eukaryotic cells, especially mammalian cells. The expression vector can contain a promoter, an enhancer, or other regulatory elements. The promoter may or may not be cell type specific and can be a constitutive or inducible promoter. Viral vectors include, but are not limited to, adenoviruses, retroviruses, lentiviruses, or alphaviruses.

[0036] In the present invention, examples of other small molecule agents that can be used as the CCM3 gene expression inhibitor of the present invention can be any disclosed small molecule compound that inhibits CCM3, without particular limitation.

[0037] In the present invention, reducing CCM3 gene expression can adopt methods known in the art, such as constructing a lentiviral vector containing sgRNA, transfecting the vector into host cells, collecting the virus, adding virus solution to infect cells, etc.

[0038] Another aspect of the present invention provides a cell comprising the above-mentioned expression vector. The cell can be any eukaryotic cell, including but not limited to mammalian cells. The cell can be human, mouse, rat, dog, cat, cow, sheep, pig, goat, horse, or primate cells. The cell can be a differentiated cell or an undifferentiated cell. The present invention also provides a transgenic organism, including but not limited to a transgenic animal, which can comprise the above-mentioned expression vector.

[0039] Engineered macrophages The present invention further provides an engineered macrophage in which CCM3 expression is suppressed, causing the macrophage to polarize toward the M2 phase or the macrophage to be already in the M2 phase and remain in the M2 phase (i.e., M2 macrophage). In addition, the engineered macrophage of the present invention can be used as seed cells for bone repair.

[0040] In the present invention, the source of macrophages is not particularly limited, and can be macrophages derived from any tissue, including but not limited to macrophages derived from connective tissue, blood tissue, hematopoietic tissue (such as bone marrow), etc.

[0041] The preparation method of the engineered macrophages of the present invention is not particularly limited. In a preferred embodiment, the engineered macrophages are prepared by the following method: (1) Synthesize sgRNA targeting CCM3 and construct Lenti-CAS9-sgRNA-tag vector; (2) using the vector to construct a lentiviral plasmid containing the U6-sgRNA-EF1a-Cas9-FLAG-CMV-EGFP-P2A-puro element and perform transfection, and collecting the culture supernatant; (3) The supernatant was co-cultured with macrophages in vitro for lentiviral transfection.

[0042] The above method further includes verification of transfection effect.

[0043] Pharmaceutical composition for promoting bone repair Another aspect of the present invention provides a pharmaceutical composition for promoting bone repair, comprising the engineered macrophages described herein and an optional pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or excipient, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, that participates in the transport or delivery of a drug from one organ or part of the body to another organ or part of the body. Each carrier is "acceptable" if it is compatible with the other ingredients of the formulation and does not harm the patient. Some examples of pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives and analogs such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl lauryl ester; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; phosphate buffered saline; and other nontoxic and compatible substances used in pharmaceutical formulations. Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate, magnesium stearate, and polyoxyethylene-polypropylene oxide copolymers, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.

[0044] In certain embodiments, the carrier used is a gel, particularly a thermosensitive hydrogel. Preferred thermosensitive hydrogels are those that are liquid at low temperatures and gradually become viscous and colloidal as the temperature rises. Considering that the body's internal temperature is 37°C, the hydrogel remains in a gel state after injection into the defect and does not flow out of the defect, which facilitates the cells' ability to promote bone formation. Non-limiting examples of thermosensitive hydrogels that can be used in the present invention include acrylated polyethylene glycol-polypropylene glycol-polyethylene glycol triblock copolymers, block copolymers of poly (N-isopropylacrylamide) and polyethylene glycol, amphiphilic BAB triblock copolymers (PLGA-PEG-PLGA) composed of a hydrophilic block polyethylene glycol (PEG) and a hydrophobic block poly (lactide-glycolide) (PLGA), DAM-gel, polymers obtained from hydroxyethyl chitosan (HECTS) and sodium β-glycerophosphate (β-oleophosphate), polymers prepared by reacting polyethers with acrylic acid, acrylamide, or 2-acrylamido-2-methylpropanesulfonic acid acrylamide, and the like. In a specific embodiment, the present invention uses the polymer F127DA hydrogel prepared by reacting polyether (F127) with acrylamide as a carrier. It is understood that the gel system containing the above polymer, such as EFL-F127DA, gelatin and Pluronic ® F127 can also be used in the vector of the present invention.

[0045] It is understood that adherently cultured engineered macrophages or implanted cell suspensions derived therefrom can be used for defect repair. To facilitate three-dimensional cell proliferation, it is preferred to embed engineered macrophages on a biosafe scaffold. Therefore, scaffolds with any porous or network structure can be used in the present invention, without particular limitation.

[0046] It is understood that when a hydrogel is used as a component of the pharmaceutical composition of the present invention, the composition may further include an initiator, such as a photoinitiator. Examples of photoinitiators include, but are not limited to: benzoin and its derivatives (benzoin, benzoin dimethyl ether, benzoin ethyl ether, benzoin isopropyl ether, benzoin butyl ether); benzyls (diphenylacetophenone, α,α-dimethoxy-α-phenylacetophenone); alkyl phenones (α,α-diethoxyacetophenone, α-hydroxyalkyl phenone, α-aminoalkyl phenone); acylphosphine oxides (aroylphosphine oxide, bisbenzoylphenylphosphine oxide); benzophenones (benzophenone, 2,4-dihydroxybenzophenone, Michler's ketone); thioxanthones (thiopropoxythioxanthon, isopropylthioxanthon).

[0047] In the pharmaceutical composition of the present invention, the concentration of the gel in the composition can be 5%-50%, preferably 5%-40%, more preferably 5%-30%, and most preferably 5%. The ratio of engineered macrophages to gel is not particularly limited and can be adjusted as needed.

[0048] In the present invention, the pharmaceutical composition can be administered to a subject / patient in any suitable dosage form, and the mode of administration is not particularly limited. In the present invention, examples of the dosage form of the pharmaceutical composition include, but are not limited to, suspensions, solutions, creams, and gels, preferably gels.

[0049] Example 1. Knockdown of the CCM3 gene in macrophages Design the sgRNA target sequence for CCM3, synthesize single-stranded DNA oligo (PAGE purification), with restriction endonucleases at both ends, anneal to form double-stranded DNA, and connect to the Lenti-CAS9-sgRNA-tag vector. The ligated product was transformed using TOP10 competent cells, and positive clones were obtained by colony PCR and sequenced to obtain a lentiviral plasmid expressing the correct sgRNA sequence. The sequence of sgRNA is: AGGCATAGAAACCATGGAAG, the element sequence is U6-sgRNA-EF1a-Cas9-FLAG-CMV-EGFP-P2A-puro, and the vector map is shown in Figure 1 .

[0050] 2. Transfect the plasmid into 293T cells, harvest the virus-containing culture supernatant, filter and store at -80°C until use.

[0051] 3. Plate bone marrow-derived macrophages (BMDM) in the well plate 24 hours in advance.

[0052] 4. After 24 hours, add the CCM3 knockdown virus and viral enhancer to the well plate after BMDM adherence and transfect for 18 hours.

[0053] After 18 hours, replace the culture medium with fresh serum and continue culturing. After 72 hours, cells will show green fluorescence under a microscope, indicating successful lentiviral transfection.

[0054] 6. PCR verification of lentiviral knockdown results, see Figure 2 , indicating that the CCM3 gene was successfully knocked down.

[0055] CCM knockdown cells were complexed with F127DA hydrogel to construct cell-laden injectable hydrogel.

[0056] 1. Take 10 ml of PBS and add it to the brown bottle containing 0.005 g of photoinitiator.

[0057] 2. Dissolve in 50℃ water bath for 15 minutes.

[0058] 3. Dissolve 1g of F127DA powder in the photoinitiator solution to make a 10% solution.

[0059] 4. Ultrasonicate at 4°C for 15 minutes until the powder is completely dissolved.

[0060] 5. Mix 10 ml of the CCM3 knockdown cell suspension with the F127DA hydrogel solution at room temperature to obtain an injectable cell-laden hydrogel with a concentration of 5%.

[0061] The macrophage polarization after CCM3 knockdown was verified as follows: 1. Plate the CCM3 knockdown macrophages onto laser confocal microplates.

[0062] 2. Fix with neutral formaldehyde for 10 minutes.

[0063] 3. Punch with 0.5% Triton for 5 minutes.

[0064] 4. Block with 3% BSA for 20 minutes.

[0065] 5. Incubate with CD206 antibody at 4°C overnight.

[0066] 6. After CCM3 gene knockdown, the fluorescence expression of CD206 molecules was observed under laser confocal microscopy and the fluorescence intensity was calculated. The results are as follows: Figure 3 .

[0067] 7. RNA from macrophages after CCM3 knockdown was extracted using the Trizol method and reverse transcribed into cDNA.

[0068] 8. qPCR was used to detect the expression of M2 markers. The results were as follows: Figure 4 .

[0069] The results showed that compared with the non-knockdown group, the expression of M2 polarization markers CD206, IL-10, and Arg-1 in macrophages were upregulated after CCM3 knockdown, indicating that macrophages were polarized toward M2.

[0070] Then, the effect of CCM3 knockdown macrophages in bone defect repair was verified as follows: 1. Mice were anesthetized by intraperitoneal injection and femoral defect (1 mm) was created.

[0071] 2. Inject 200 μl of cell-loaded hydrogel into the defect and light-cure for 30 seconds.

[0072] After 3 and 4 weeks, the femurs of the mice were harvested and microCT images were taken to compare the repair of the femoral defects.

[0073] Set up a control experiment as follows: 1. Mix the BMDM suspension without gene knockdown with F127DA hydrogel.

[0074] 2. Construct a mouse femoral defect (1mm) model.

[0075] 3. Inject the mixed colloid into the mouse bone defect and light cure for 30 seconds.

[0076] 4. After 4 weeks, the femur was taken and microCT was taken. The results are shown in Figure 5 .

[0077] The results showed that the defect healing effect was the best in the CCM3 knockdown group, while the macrophage-loaded hydrogel without gene knockdown could not accelerate bone repair at the defect.

[0078] Test Case This test example is the F127DA degradation experiment used in the examples.

[0079] 1. Place the light-cured F127DA hydrogel into a filter and immerse it in PBS at 37°C.

[0080] 2. Measure the quality of F127DA and filter every 24 hours.

[0081] 3. Calculate the degradation rate and draw a curve showing the degradation rate changing with time. The results are as follows: Figure 6 .

[0082] The results showed that F127DA could be almost completely degraded within 1 month.

[0083] Although the present invention has been described with reference to exemplary embodiments, it should be understood that the invention is not limited to the disclosed exemplary embodiments. Various modifications and variations may be made to the exemplary embodiments of the present specification without departing from the scope or spirit of the present invention. The scope of the claims is to be given the broadest interpretation so as to encompass all such modifications and equivalent structures and functions.

Claims

1. Use of a CCM3 inhibitor in the preparation of a drug for immune osteogenesis, characterized in that: The CCM3 inhibitors include agents that inhibit the expression of the CCM3 gene and / or reduce the amount of CCM3 protein.

2. The use according to claim 1, characterized in that The CCM3 inhibitor is selected from at least one of the following substances: (1) Agents that inhibit the transcriptional activity of the CCM3 gene; (2) agents that inhibit the transcription level of CCM3 mRNA; (3) agents that promote CCM3 mRNA degradation; (3) siRNA or shRNA targeting the CCM3 gene; (4) agents that inhibit the translation of CCM3 mRNA; (5) a reagent that specifically recognizes the guide nucleic acid of the CCM3 gene and cleaves it to reduce its expression level; (6) agents that reduce CCM3 protein activity; (7) Competitive binding with CCM3 and FAK for Paxillin.

3. The use according to claim 2, characterized in that The CCM3 inhibitors include anti-CCM3 antibodies.

4. The use according to any one of claims 1 to 3, characterized in that The CCM3 inhibitor can polarize the macrophages toward M2 or polarize the macrophages into M2 macrophages, thereby promoting immune osteogenesis.

5. An engineered macrophage, characterized in that: The expression of CCM3 in the engineered macrophages is inhibited, so that the macrophages are polarized toward M2 or polarized into M2 macrophages.

6. A pharmaceutical composition for promoting bone repair, characterized in that: The invention comprises the engineered macrophage according to claim 5 and an optional pharmaceutically acceptable carrier.

7. The pharmaceutical composition for promoting bone repair according to claim 6, characterized in that: The carrier comprises a gel.

8. A method for regulating macrophage polarization in vitro, characterized in that: The regulation includes polarizing macrophages in the M2 direction or polarizing macrophages into M2 macrophages. The method includes the steps of contacting and culturing a CCM3 inhibitor with macrophages in vitro, wherein the CCM3 inhibitor includes an agent that inhibits the expression of the CCM3 gene and / or reduces the amount of CCM3 protein.

9. A method for screening compounds useful for improving or promoting bone repair, characterized in that: include: 1) measuring the expression of the CCM3 gene and / or the amount of the CCM3 protein from the model to obtain a first measurement value; 2) administering the compound to be tested to the model; 3) measuring the expression of the CCM3 gene and / or the amount of the CCM3 protein in macrophages of a sample collected from the model after administration of the test compound to obtain a second measurement value; 4) comparing the first measurement value and the second measurement value; 5) when the first measured value is higher than the second measured value, i.e., CCM3 gene expression in the macrophages is in an inhibited state, the test compound is screened as a compound useful for improving or promoting bone repair; When the first measurement value is equal to or lower than the second measurement value, that is, the CCM3 gene expression in the macrophages is in a non-inhibited or activated state, the compound is screened as a compound that is useless for improving or promoting bone repair.

10. The method for screening a compound useful for improving or promoting bone repair according to claim 9, characterized in that: The models include animal models or cell models.

Images