Construction and preparation of an NRPS gene, vector, and recombinant strain producing high levels of cyclic dipeptides.

By heterologously expressing the NRPS gene of the endophytic fungus Diaporthe sp. SYSU-MS4722 in Aspergillus oryzae, a recombinant strain Aspergillus oryzae-NRPS was constructed, solving the problem of low production efficiency of the cyclic dipeptide compound cyclo(Phe-Ala) and achieving high-efficiency production and high yield.

CN120623262BActive Publication Date: 2026-03-13ZUNYI MEDICAL UNIV ZHUHAI CAMPUS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510826169.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-19
Publication Date
2026-03-13
Estimated Expiration
2045-06-19

AI Technical Summary

Technical Problem

In the existing technology, the production of cyclo(Phe-Ala) cyclic dipeptide compounds mainly relies on chemical synthesis, which has high costs and environmental pollution problems. Extraction from microorganisms faces challenges such as low yield, difficult separation and poor reproducibility, and there is a lack of efficient production methods.

Method used

By performing whole-genome sequencing on the endophytic fungus Diaporthe sp. SYSU-MS4722, the NRPS core gene was identified and heterologously expressed in Aspergillus oryzae to construct the recombinant strain Aspergillus oryzae-NRPS. Synthetic biology techniques were used to activate the silenced gene, achieving efficient production of cyclo(Phe-Ala).

Benefits of technology

This study achieved a 20-fold increase in the yield of cyclo(Phe-Ala) to 110 mg/L, providing a method for the large-scale production of this compound and overcoming the limitations of traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120623262B_ABST
    Figure CN120623262B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of genetic engineering technology, specifically relating to the construction and preparation of an NRPS gene, a vector, and a recombinant strain that produces high-yield cyclic dipeptides. This invention identifies an NRPS core gene from the sea squirt-derived fungus Diaporthesp. SYSU-MS4722, and uses this gene with Aspergillus oryzae as a heterologous expression host to construct a recombinant strain. The cyclic dipeptide natural product cyclo(Phe-Ala) was successfully isolated, with a yield reaching 110 mg / L, which is 20 times higher than the reported yield of cyclo(Phe-Ala) from the marine bacterium Pseudomonas putida. Therefore, the Aspergillus oryzae recombinant strain of this invention can be used for the efficient preparation of the cyclic dipeptide compound cyclo(Phe-Ala), and has significant application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the construction and preparation of an NRPS gene, a vector, and a recombinant strain that produces high levels of cyclic dipeptides. Background Technology

[0002] Cyclic dipeptides have become an important target for drug development in recent years due to their significant pharmacological activities in antibacterial, anticancer, and immunomodulatory fields. These compounds are typically synthesized using nonribosomal peptide synthases (NRPSs), complex multi-enzyme complexes that can directly polymerize amino acids into peptide chains without ribosome mediation. Furthermore, due to the high specificity and structural diversity of NRPSs, specific enzymatic catalytic mechanisms can efficiently synthesize cyclic peptides, noncyclic peptides, and some natural products with antibiotic, anticancer, and immunomodulatory activities.

[0003] Cyclo (Phe-Ala), or cyclo(phenylalanine-alanine), is an important cyclic dipeptide compound that has attracted much attention due to its various pharmacological effects in organisms. Furthermore, this class of compounds is widely used in marine fouling control due to its significant anti-diatom attachment activity. Currently, the production of cyclo (Phe-Ala) mainly relies on two methods: chemical synthesis, which can efficiently synthesize this type of compound, but its application is limited by high cost, complex operating procedures, and environmental pollution; and direct extraction from microorganisms. However, direct extraction of cyclo (Phe-Ala) from microorganisms currently faces problems such as low content, difficulty in isolation and extraction, and poor reproducibility. For example, the reported yield of cyclo (Phe-Ala) in the marine bacterium *Pseudomonas putida* is only 5 mg / mL (Marine bacterium *Pseudomonas putida* contains active ingredients against diatom attachment, *Acta Microbiologica Sinica*, 2013, 53: 825-831). In addition, microorganisms are unable to express the target product under laboratory culture conditions because most of their biosynthetic genes are silent, which greatly limits the extraction and separation of such compounds.

[0004] In contrast, synthetic biology strategies, by introducing exogenous silenced genes into a model host, can activate relevant biosynthetic genes, effectively expressing the target product and increasing yield, thus avoiding the limitations of traditional methods. However, there are currently no reports on the biosynthetic genes of cyclo(Phe-Ala), leaving a lack of efficient methods for its production. Therefore, discovering the biosynthetic genes of this compound and constructing high-yield recombinant strains of cyclo(Phe-Ala) through genetic engineering using synthetic biology techniques is particularly important. This approach can not only overcome the bottlenecks of traditional chemical synthesis and microbial extraction but also significantly improve the production efficiency of cyclo(Phe-Ala), providing a new solution for the large-scale production of this compound and opening up new directions for the development of related peptide drugs. Summary of the Invention

[0005] To overcome the shortcomings of the prior art, this invention provides an NRPS gene for the biosynthesis of the cyclic dipeptide compound cyclo(Phe-Ala). This NRPS gene is derived from the endophytic fungus *Diaporthe* sp. SYSU-MS4722, and its full-length sequence is 6984 bases, as shown in SEQ ID No:1. It encodes a protein containing 2276 amino acids, approximately 251.4 kDa in size, as shown in SEQ ID No:2. Furthermore, by constructing a recombinant strain *Aspergillus oryzae*-NRPS containing the NRPS gene using *Aspergillus oryzae* as a heterologous expression host, high-yield production of the cyclic dipeptide compound cyclo(Phe-Ala) is achieved, providing a new solution for the large-scale production of this compound.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] This invention discloses the application of the NRPS gene in the production of cyclo(Phe-Ala) cyclic dipeptide compounds. The nucleotide sequence of the NRPS gene is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID No:2.

[0008] Preferably, the NRPS gene is derived from an endophytic fungus of sea squirt. Diaporthe sp .SYSU-MS4722, the aforementioned Diaporthe sp .SYSU-MS4722 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on February 26, 2025, with accession number GDMCC NO: 65940.

[0009] The present invention also provides a recombinant vector for producing cyclo(Phe-Ala) cyclic dipeptide compounds, wherein the recombinant vector contains an NRPS gene, the nucleotide sequence of which is shown in SEQ ID NO:1 and the amino acid sequence of which is shown in SEQ ID No:2.

[0010] Preferably, the recombinant vector used is pTAex3.

[0011] The present invention also provides a recombinant bacterium for producing cyclo (Phe-Ala) cyclic dipeptide compounds, wherein the recombinant bacterium contains the above-described recombinant vector.

[0012] Preferably, the starting strain of the recombinant bacteria is Aspergillus oryzae. Aspergillus oryzae, Obtained by introducing the recombinant vector as described in claim 3 or 4. 。

[0013] More preferably, the method for constructing the recombinant bacteria is as follows: first, the NRPS gene shown in SEQ ID NO:1 is assembled with the linearized vector pTAeX3 into a recombinant plasmid, and then the plasmid is transfected into Aspergillus oryzae. Aspergillus oryzae After screening in protoplasts using a selection medium, the resulting recombinant strains were passaged in a sorbitol-free selection medium to obtain stable recombinant strains. Aspergillus oryzae- NRPS, the screening medium contains 0.2% NH4Cl, 0.1% (NH4)2SO4, 0.05% KCl, 0.05% NaCl, 0.1% KH2PO4, 0.05% MgSO4·7H2O, 0.002% FeSO4·7H2O, 2% glucose, 1.2 M sorbitol, 0.01% adenine, 0.15% methionine, and 1.2% agar.

[0014] More preferably, the amplification primers for the NRPS gene shown in SEQ ID NO:1 are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0015] Preferably, Aspergillus oryzae Aspergillus oryzae The method for preparing protoplasts is as follows: using lysis buffer to prepare Aspergillus oryzae. Aspergillus oryzae Incubate at 30°C for 3-5 hours; the lysis buffer contains 1% Yatalase, 0.6 M (NH4)2SO4, 50 mM maleic acid, and pH=5.5.

[0016] More preferably, the recombinant plasmid was transfected into the protoplasts of Aspergillus oryzae using a PEG-4000-mediated method.

[0017] This invention also provides a method for high-yield production of cyclo(Phe-Ala) cyclic dipeptide compounds, comprising the following steps:

[0018] S1. After culturing the above-mentioned recombinant bacteria in DPY medium to obtain seed culture, the seed culture is then transferred to CD medium for induced expression.

[0019] The DPY medium contains 2% dextrin, 1% polypeptone, 0.5% yeast extract, 0.5% KH2PO4, and 0.05% MgSO4·7H2O; the CD medium contains 3% NaNO3, 0.2% KCl, 0.05% MgSO4·7H2O, 0.1% KH2PO4, 0.002% FeSO4·7H2O, 1% polypeptide, and 2% starch, and has a pH of 5.5.

[0020] S2. The culture medium after induction of expression was extracted with ethyl acetate, and the solvent was recovered to obtain the total extract. Then, the extract was eluted with a gradient of petroleum ether / ethyl acetate to obtain two fractions, Fr1 and Fr2. The Fr2 fraction was purified by semi-preparative high performance liquid chromatography to obtain the compound cyclo(Phe-Ala).

[0021] This invention, through the Diaporthe sp. Whole-genome sequencing was performed on SYSU-MS4722, and the antiSMASH gene, a fungal secondary metabolite, was analyzed. Through a series of bioinformatics analyses, a silenced NRPS gene was identified, and then Aspergillus oryzae was used to... Aspergillus oryzae As a heterologous expression host, a recombinant strain containing the NRPS gene was constructed. A. oryzae- NRPS. The recombinant strain was fermented in CD medium, followed by extraction with methanol and ethyl acetate. The solvent was recovered under reduced pressure to obtain a total extract. The total extract was mixed with silica gel, loaded onto a wet column, and eluted with a gradient of petroleum ether and ethyl acetate (10:2, 0:1) to obtain two fractions, Fr1 and Fr2. A blank was used to analyze the fractions. Aspergillus oryzae As a control, fraction Fr2 was analyzed by reversed-phase HPLC with acetonitrile-water at a volume ratio of 30:70 as the mobile phase, and the compound cyclo(Phe-Ala) was obtained by multiple separation and purification.

[0022] Preferably, the seed culture temperature is 28℃ and the time is 2-3 days. Magnetic beads are added during the culture process to prevent the bacteria from clumping together. The induction temperature is 30℃ and the time is 4-6 days.

[0023] Compared with the prior art, the beneficial effects of the present invention are:

[0024] This invention utilizes synthetic biology techniques to synthesize a fungus derived from sea squirts.Diaporthe sp Whole-genome sequencing and bioinformatics analysis were performed using SYSU-MS4722 to identify the NRPS core gene of a cyclic dipeptide compound cyclo(Phe-Ala). Then, Aspergillus oryzae was used... Aspergillus oryzae As a heterologous expression host, construct recombinant strains Aspergillus oryzae -NRPS, and successfully isolated the cyclic dipeptide natural product cyclo(Phe-Ala), with a yield reaching 110 mg / L. Compared to previously reported marine bacteria Pseudomonas_putida The yield of cyclo(Phe-Ala) in the recombinant strain constructed in this invention. Aspergillus oryzae - The yield of this compound was increased 20-fold in NRPS. Therefore, the recombinant Aspergillus oryzae strain constructed in this invention can be used for the efficient preparation of the cyclic dipeptide compound cyclo(Phe-Ala), and has important application value. Attached Figure Description

[0025] Figure 1 Recombinant strain Aspergillus oryzae - Electrophoresis gel image of the NRPS fragment of the target gene in NRPS;

[0026] Figure 2 Recombinant strain Aspergillus oryzae- HPLC chromatograms of NRPS metabolites;

[0027] Figure 3 This is the UV absorption spectrum of compound cyclo(Phe-Ala) (the horizontal axis represents wavelength, and the vertical axis represents absorption intensity).

[0028] Figure 4 The compound cyclo(Phe-Ala) 1 H NMR spectrum;

[0029] Figure 5 The compound cyclo(Phe-Ala) 13 C10 NMR spectrum. Detailed Implementation

[0030] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0031] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0032] Example 1: Identification of cyclic dipeptide biosynthesis genes and construction of recombinant strains

[0033] A fungus derived from sea squirts Diaporthe sp. SYSU-MS4722 (from the sea squirt of Da'ao Bay, Shenzhen, Guangdong Province, China) Styela plicata The strain isolated from the fungus and deposited at the Guangdong Provincial Microbial Culture Collection Center on February 26, 2025 (accession number GDMCC NO: 65940) underwent whole-genome next-generation sequencing. The sequencing results were then uploaded to the fungal version of AntiSMASH (https: / / fungismash.secondarymetabolites.org / #! / start) for analysis. Combined with bioinformatics analysis using NCBI and other methods, a core gene of NRPS (full-length sequence of 6984 bases, sequence shown in SEQ ID NO:1; encoding a protein of 2276 amino acids, approximately 251.4 kDa, amino acid sequence shown in SEQ ID No:2) was found to have 30% similarity to the core gene of the cyclic peptide compound vicibactin. This suggests that the strain may produce the cyclic peptide compound cyclo(Phe-Ala). Furthermore, previous systematic chemical composition analysis of SYSU-MS4722 revealed that this strain does not produce any cyclic peptide compounds, indicating that this gene is not expressed under laboratory culture conditions and is a silenced gene.

[0034] Nucleotide sequence of the NRPS gene (SEQ ID NO:1):

[0035]

[0036] The amino acid sequence of the NRPS gene (SEQ ID NO:2):

[0037]

[0038] Based on this, a four-deficient Aspergillus oryzae was further employed. Aspergillus oryzae ( Aspergillus oryzae NSARI originated from Professor Ikuro's research group at the University of Tokyo, Japan. Its preparation method can be found in the following literature: Feng JieJin, Jun-ichi Maruyama, Praveen Rao Juvvadi, Manabu Arioka, Katsuhiko Kitamoto, Development of a novel quadruple auxotrophic host transformation system by argB gene disruption using adeA gene and exploiting adenineauxotrophy in Aspergillus oryzae (FEMS Microbiology Letters, Volume 239, Issue 1, October 2004, Pages 79-85.) was used as a host for heterologous expression to activate the silenced NRPS gene. First, the NRPS gene in strain SYSU-MS4722 was amplified in vitro by PCR [upstream and downstream primers: F: CTCCGAATTCGAGCTCGGTACCCCTGATCCTCGACTGAGACAT (SEQ ID NO:3); R: CGAGCTACTACAGATCCCCGGGTGGATGGATCTGAAATCAATGGC (SEQ ID NO:4)] to obtain the target NRPS gene. Then, the linearized vector pTAex3 was digested with KpnI (the preparation method of this plasmid can be found in the literature: Plasmid preparation literature: Feng Jie Jin, Jun-ichi Maruyama, Praveen Rao Juvvadi, Manabu Arioka, Katsuhiko Kitamoto, Developmentof a novel quadruple auxotrophic host transformation system by argB gene disruption using adeA gene and exploiting adenine auxotrophy in Aspergillus oryzae(See FEMS Microbiology Letters, Volume 239, Issue 1, October 2004, Pages 79-85.), and the NRPS gene was constructed into the vector pTAex3 to obtain the target plasmid pTAex3-NRPS. Then, Aspergillus oryzae was prepared by incubating with lysis buffer (1 wt% Yatalase, 0.6 M (NH4)2SO4, 50 mM maleic acid, pH 5.5; solvent: water) at 30°C for 4 hours at a ratio of 2 g of bacterial cells to 10 mL of lysis buffer. Aspergillus oryzae The protoplasts were then transfected with the target plasmid pTAex3-NRPS into four-deficient Aspergillus oryzae using a PEG-4000-mediated method. Aspergillus oryzae The protoplasts were then cultured at 30°C for 5 days on a selection medium (0.2% NH4Cl, 0.1% (NH4)2SO4, 0.05% KCl, 0.05% NaCl, 0.1% KH2PO4, 0.05% MgSO4·7H2O, 0.002% FeSO4·7H2O, 2% glucose, 1.2 M sorbitol, 0.01% adenine, 0.15% methionine, 1.2% agar). The resulting recombinant strain was then subcultured twice on a selection medium without sorbitol. Aspergillus oryzae- NRPS and blank A. oryzae PCR amplification of a partial NRPS fragment in Aspergillus oryzae, the results are as follows: Figure 1 As shown, this indicates that the recombinant strain Aspergillus oryzae- NRPS was successfully built.

[0039] Example 2: Fermentation of recombinant Aspergillus oryzae strains and isolation, preparation, and yield analysis of cyclic dipeptide compounds.

[0040] Stable recombinant strains Aspergillus oryzae-NRPS were inoculated in DPY medium (2% dextrin, 1% polypeptone, 0.5% yeast extract, 0.5% KH2PO4, 0.05% MgSO4·7H2O) and cultured at 30°C and 180 rpm for 3 days. Then, they were inoculated into 200 mL of DPY medium and cultured for another 2 days as a seed culture. The seed culture was then transferred to 1 L of CD medium (0.3% NaNO3, 0.2% KCl, 0.05% MgSO4·7H2O, 0.1% KH2PO4, 0.002% FeSO4·7H2O, 1% polypeptide, 2% starch, pH 5.5) and cultured at 30°C and 220 rpm for 5 days. At room temperature, the culture medium induced by expression was extracted with ethyl acetate at a 1:1 volume ratio for 10 min. After solvent recovery, 1 g of total extract was obtained. The total extract was mixed with 100-200 mesh silica gel at a 1:1.5 mass ratio, and loaded onto a column using a wet method. Elution was performed with a petroleum ether-ethyl acetate gradient (10:2, 0:1) to obtain two fractions, Fr1 and Fr2. During the testing process, a four-deficient Aspergillus oryzae was utilized. Aspergillus oryzae NSARI was used as a blank control, and reversed-phase HPLC analysis of the Fr2 fraction was performed using acetonitrile-water at a volume ratio of 30:70. The results showed that, compared to the blank control... Aspergillus oryzae The Fr2 fraction showed a significant additional UV absorption peak, and the compound cyclo(Phe-Ala) was finally obtained by HPLC enrichment. The yield was calculated to be 110 mg / L using the external standard method. The structural formula of compound cyclo(Phe-Ala) is shown below:

[0041] .

[0042] The HPLC, UV-Vis, and NMR spectra of compound cyclo(Phe-Ala) are as follows: Figures 2 - 5 As shown in Table 1, the NMR data of compound cyclo(Phe-Ala) illustrate the use of recombinant strains in this invention. Aspergillus oryzae- NRPS did indeed produce the cyclic dipeptide natural product cyclo(Phe-Ala), with a yield as high as 110 mg / L, compared to previously reported marine bacteria. Pseudomonas_putida The yield of mesocyclo(Phe-Ala) (5 mg / L, see the literature "Zhu Jiansheng, et al. Marine bacteria") Pseudomonas putida It contains active ingredients that resist diatom adhesion. Acta Microbiologica Sinica 53.8 (2013): 825-831.”), recombinant strain Aspergillus oryzae- The yield of this compound in NRPS increased 20-fold, providing a new solution for the mass production of this type of compound.

[0043] Table 1. Compound cyclo(Phe-Ala) 1 H NMR and 13 C NMR data

[0044]

[0045] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. The application of an NRPS gene in the production of cyclo(Phe-Ala) cyclic dipeptide compounds, characterized in that, The nucleotide sequence of the NRPS gene is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The NRPS gene is derived from an endophytic fungus of sea tunicates. Diaporthe sp .SYSU-MS4722, the aforementioned Diaporthe sp .SYSU-MS4722 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on February 26, 2025, with accession number GDMCC NO: 65940.

3. A recombinant vector for producing cyclo(Phe-Ala) cyclic dipeptide compounds, characterized in that, The recombinant vector contains the NRPS gene, the nucleotide sequence of which is shown in SEQ ID NO:

1.

4. The recombinant vector for producing cyclo(Phe-Ala) dipeptide compounds according to claim 3, characterized in that, The recombinant vector used is pTAex3.

5. A recombinant bacterium for producing cyclo(Phe-Ala) cyclic dipeptide compounds, characterized in that, The recombinant bacteria contain the recombinant vector as described in claim 3 or 4, and the starting strain is Aspergillus oryzae. Aspergillus oryzae, Obtained by introducing the recombinant vector as described in claim 3 or 4. 。 6. The recombinant bacteria for producing cyclo(Phe-Ala) dipeptide compounds according to claim 5, characterized in that, The recombinant bacteria were constructed as follows: the NRPS gene shown in SEQ ID NO:1 was first assembled with the linearized vector pTAeX3 into a recombinant plasmid, which was then transfected into Aspergillus oryzae. Aspergillus oryzae After screening in protoplasts using a selection medium, the resulting recombinant strains were passaged in a sorbitol-free selection medium to obtain stable recombinant strains. Aspergillus oryzae- NRPS, the screening medium contains 0.2% NH4Cl, 0.1% (NH4)2SO4, 0.05% KCl, 0.05% NaCl, 0.1% KH2PO4, 0.05% MgSO4·7H2O, 0.002% FeSO4·7H2O, 2% glucose, 1.2 M sorbitol, 0.01% adenine, 0.15% methionine, and 1.2% agar.

7. The recombinant bacteria for producing cyclo(Phe-Ala) dipeptides according to claim 6, characterized in that, Aspergillus oryzae Aspergillus oryzae The method for preparing protoplasts is as follows: using lysis buffer to prepare Aspergillus oryzae. Aspergillus oryzae Incubate at 30°C for 3-5 hours; the lysis buffer contains 1% Yatalase, 0.6 M (NH4)2SO4, 50 mM maleic acid, and pH=5.

5.

8. A method for high-yield production of cyclo(Phe-Ala) cyclic dipeptide compounds, characterized in that, Includes the following steps: S1. After culturing the recombinant bacteria according to any one of claims 5-7 in DPY medium to obtain seed culture, the seed culture is then transferred to CD medium for induced expression. The DPY medium contains 2% dextrin, 1% polypeptone, 0.5% yeast extract, 0.5% KH2PO4, and 0.05% MgSO4·7H2O; the CD medium contains 3% NaNO3, 0.2% KCl, 0.05% MgSO4·7H2O, 0.1% KH2PO4, 0.002% FeSO4·7H2O, 1% polypeptone, and 2% starch, and has a pH of 5.

5. S2. The culture medium after induction of expression was extracted with ethyl acetate, and the solvent was recovered to obtain the total extract. Then, the extract was eluted with a gradient of petroleum ether / ethyl acetate to obtain two fractions, Fr1 and Fr2. The Fr2 fraction was purified by semi-preparative high performance liquid chromatography to obtain the compound cyclo(Phe-Ala).

9. The method for high-yield production of cyclo(Phe-Ala) cyclic dipeptide compounds according to claim 8, characterized in that, The seed culture was incubated at 28℃ for 2-3 days, with magnetic beads added during the incubation process to prevent the bacteria from clumping together. The induction temperature was 30℃ for 4-6 days.