Talaromyces purpurogenum D01 and application thereof

By isolating and fermenting the purple fungus D01, the problems of high irritation and poor stability of existing antibacterial agents are solved, providing an efficient and safe natural antibacterial agent for use in cosmetics, food and daily chemical products, achieving significant antibacterial and preservative effects.

CN120624231AActive Publication Date: 2025-09-12GUANGZHOU AIZHUO BIOTECHNOLOGY CO LTD

Patent Information

Application Number
CN202511106213.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-08
Publication Date
2025-09-12
Estimated Expiration
2045-08-08

AI Technical Summary

Technical Problem

Existing antibacterial agents have the problems of high irritation or insignificant antibacterial effect, which limits their application in cosmetics, food and daily chemical products. In addition, natural antibacterial agents have poor stability and are difficult to meet market demand.

Method used

Talaromyces purpureogenus D01 was isolated and purified, and antibacterial active substances were prepared by fermentation. The natural antibacterial agent with high antibacterial activity was obtained by ethyl acetate extraction and rotary evaporation concentration.

Benefits of technology

The fermentation product of Talaromyces purpurogenum D01 has significant antibacterial and antiseptic effects on a variety of bacteria and fungi, and remains active under high temperature conditions. It is suitable for food, health products and daily chemical products, providing excellent antibacterial and antiseptic properties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624231A_ABST
    Figure CN120624231A_ABST
Patent Text Reader

Abstract

The invention relates to a talaromyces purpureogenus strain D01 and application of the talaromyces purpureogenus strain D01, and belongs to the technical field of microorganisms. The talaromyces purpurogenus D01 disclosed by the invention is preserved in Guangdong Microbial Culture Collection Center, and the preservation number of the talaromyces purpurogenus D01 is GDMCC NO.66458. The strain is obtained by separating and purifying soil samples near exits of Guangzhou Taitai and subway stations, and tests show that bacteriostatic active substances generated by fermentation of the strain have good bacteriostatic effects on burkholderia cepacia, staphylococcus aureus, pseudomonas putida, pseudomonas aeruginosa, escherichia coli and candida albicans. And the antibacterial active substance has high temperature resistance and excellent preservative effect, can be used as an antibacterial preservative raw material to be applied to the fields of food, health care products or daily chemical products and the like, and has wide application prospects and important conversion research values.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to purple-producing T. purpurogenum D01 and applications thereof. Background Art

[0002] Antimicrobial agents are often added to foods, health supplements, and daily chemical products to ensure stable product quality and safety. For example, cosmetics contain numerous nutrients that provide favorable conditions and environments for the growth and reproduction of microorganisms. To prevent contamination by bacteria, molds, yeasts, and other microorganisms during their shelf life, one or more antimicrobial agents are added to inhibit microbial proliferation and ensure that the product does not deteriorate due to contamination. Selecting the appropriate antimicrobial system, while considering both antimicrobial efficacy and environmental safety, as well as interference with other ingredients in the product, is a key research and development priority.

[0003] However, traditional antibacterial agents are highly irritating. For example, in cosmetics, some antibacterial agents may irritate the skin. In severe cases, they may cause clogged pores or chronic poisoning of the mucous membranes, leading to skin allergic dermatitis, or photosensitivity reactions, and even cancer risks. Natural antibacterial agents have the problem of not being effective enough. For example, the active ingredients of plant-based antibacterial agents have poor stability, and plant essential oil antibacterial agents cannot be dissolved in water where bacteria are easily grown. These problems limit the application of natural preservatives.

[0004] In summary, there are various problems with antibacterial agents in the existing technology. Currently, natural products obtained through microbial fermentation have bactericidal functions. As natural antibacterial agents, they have excellent antibacterial effects and are mild and non-irritating. Therefore, in order to meet the broad market application prospects of natural antibacterial agents, it is urgent to isolate and obtain microorganisms that produce high antibacterial active substances, which is of great significance to the development of food, health products, daily chemical products and other fields. Summary of the Invention

[0005] The present invention aims to overcome the shortcomings of the prior art and provide a strain of Talaromyces purpurogenus D01 that produces a highly antibacterial active substance. The strain was isolated and purified from a soil sample near the exit of Guangzhou Taihe subway station and has been deposited in the Guangdong Provincial Microbial Culture Collection with a deposit number of GDMCC NO.66458.

[0006] In the first aspect, the present invention provides a purple-producing tularensis ( Talaromyces purpureogenus )D01, the bacteria was deposited in the Guangdong Provincial Microbiological Culture Collection Center on June 4, 2025, with the deposit number GDMCC NO.66458, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0007] In a second aspect, the present invention provides the use of the purple-producing T. vitripennis D01 described in the first aspect in the preparation of antibacterial active substances.

[0008] In a third aspect, the present invention provides a method for preparing an antibacterial active substance produced by fermentation of Talaromyces purpurogenus D01 according to the first aspect, comprising the following steps: S1. Seed liquid culture: Pick the culture block containing the bacterial colony and add it to PDB liquid culture medium to obtain seed liquid; S2, solid fermentation: the seed liquid is evenly coated on the solid fermentation medium for fermentation; S3. After the fermentation is completed, the cells and culture medium are collected, crushed, and ultrasonic-assisted extraction is performed by adding an equal volume of ethyl acetate. The extraction is allowed to stand at room temperature to obtain an extract; S4. Collect the extract and filter it, and then perform rotary evaporation concentration on the filtrate to obtain the antibacterial active substance.

[0009] Preferably, in step S1, the culture temperature is 26-30° C., the culture speed is 160-200 rpm, and the culture time is 12 h-18 h.

[0010] Preferably, in step S2, the fermentation temperature is 26-30° C., and the fermentation time is 5-7 days.

[0011] Preferably, in step S3, the ultrasonic power is 100-800w, the ultrasonic time is 5-30min, and the extraction time at room temperature is 1-3h.

[0012] Preferably, the steps of ultrasonic-assisted extraction with ethyl acetate and extraction at room temperature in step S3 are repeated 2-3 times.

[0013] In a fourth aspect, the present invention provides a product comprising the purple-producing fungus D01 described in the first aspect.

[0014] In a fifth aspect, the present invention provides a use of the purple-producing Talaromyces D01 described in the first aspect in the preparation of food, health products or daily chemical products, wherein the purple-producing Talaromyces D01 described in the first aspect is fermented to prepare antibacterial active substances, and then the antibacterial active substances are used to prepare food, health products or daily chemical products.

[0015] In a sixth aspect, the present invention provides use of the antibacterial active substance prepared by the method described in the third aspect in the preparation of food, health products or daily chemical products.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The inventors of the present application isolated and purified purple-producing fungus D01 from a soil sample near the exit of Guangzhou Taihe subway station.

[0017] 1. The results of the antibacterial test showed that the purple-producing fungus D01 in the present invention had a good antibacterial effect on Burkholderia cepacia, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Escherichia coli and Candida albicans, and the diameters of the inhibition zones were all greater than 14 mm.

[0018] 2. The heat resistance test results show that the antibacterial active substance produced by the purple blue fungus D01 in the present invention still has good antibacterial performance after being treated at 80°C or 60°C for 40 minutes, indicating that the antibacterial active substance prepared in the present invention has high temperature resistance.

[0019] 3. Antiseptic test results showed that the antibacterial active substance produced by the purple-producing T. purpurogenum strain D01 of the present invention had excellent antiseptic effects against Burkholderia cepacia, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Escherichia coli, and Candida albicans. The antibacterial active substance showed a downward trend in the viable bacterial counts of both the bacterial and fungal groups after 6 hours of exposure. After 7 days of exposure, the viable bacterial counts of all test groups were no more than 100 CFU / mL. After 14 to 28 days of exposure, the viable bacterial counts of both the bacterial and fungal groups were 0, indicating that the test groups passed the test and had excellent antiseptic effects. Therefore, the antibacterial active substance produced by the fermentation of the purple-producing T. purpurogenum strain D01 can be used as an antibacterial and antiseptic raw material. It has excellent antiseptic properties when used in the preparation of food, health products, or daily chemical products, and has broad application prospects and important translational research value.

[0020] Biomaterial Deposit A strain of purple tularensis D01 was classified and named Talaromyces purpureogenus , was deposited in the Guangdong Provincial Microbiological Culture Collection Center on June 4, 2025, with the deposit number GDMCC NO.66458, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the colony morphology of the purple-producing fungus D01; Figure 2 is the phylogenetic tree of T. purpurogenum D01; Figure 3 This is an antibacterial effect diagram of the antibacterial active substance ① produced by T. purpurogenum D01 in Example 4; wherein S represents Staphylococcus aureus, C represents Candida albicans, B represents Pseudomonas aeruginosa, P represents Pseudomonas putida, H represents Burkholderia cepacia, and E represents Escherichia coli. DETAILED DESCRIPTION

[0022] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0023] Unless otherwise specified, other materials and reagents used in the examples can be obtained from commercial sources.

[0024] The culture medium involved in the present invention is: PDA medium: 20 g / L glucose, 10 g / L potato extract, 10 g / L yeast extract, 20 g / L agar, distilled water, natural pH.

[0025] PDB liquid medium: 20 g / L glucose, 5 g / L potato extract powder, distilled water, natural pH.

[0026] Solid fermentation medium: PDA medium.

[0027] Red Bengal medium: 5 g / L peptone, 10 g / L glucose, 1 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate, 20 g / L agar, 0.033 g / L Red Bengal dye, pH 6.0.

[0028] All the above culture media must undergo a sterilization step, with the sterilization conditions being 121°C for 20 min.

[0029] Example 1: Strain separation and purification Soil samples were collected near the exit of Guangzhou Taihe subway station. 10 g of the collected soil sample was weighed, added to 90 mL of sterile water, and cultured at room temperature with shaking at 150 rpm for 30 min. Afterwards, the supernatant was aspirated and the strains were isolated using a 10-fold gradient dilution method. 100 μL of the supernatant was diluted 10 times. -3 , 10 -4 , 10 -5 , 10 -6 The dilutions were spread onto Rose Bengal plates and incubated at 28°C until colonies were observed. Single colonies with distinct morphological characteristics and good growth were selected and repeatedly isolated and purified using the plate streak method to obtain purified strains, which were then numbered and recorded. The purified strains were inoculated into 30% glycerol solution and stored at -80°C.

[0030] Example 2 Strain Identification Morphological characteristics: After the strain is cultured in PDA medium at 28°C for 4-6 days, dark green spores form on the front of the colony, and the surface of the colony is velvety (such as Figure 1 Under an optical microscope, typical broom-like branches can be seen, which are closely arranged and have septate hyphae. Conidia are spherical or ellipsoidal.

[0031] Identification by molecular biology methods: 18S rRNA identification was performed. The genomic DNA of purple-producing fungus D01 was extracted as a template according to the operating instructions of the fungal genomic DNA extraction kit, and its 18S rRNA was obtained by PCR amplification using universal primers (NS1: 5'-GTAGTCATATGCTTGTCTC-3' (SEQ ID NO.2), FUNG: 5'-ATTCCCCGTTACCCGTTG-3' (SEQ ID NO.3)). Subsequently, BGI was commissioned to sequence the sequence information (SEQ ID NO.1), and the sequence information obtained by sequencing was compared and homology analyzed in the NCBI database, and the phylogenetic tree was constructed using MEGA 12 software; the phylogenetic tree is shown in the figure below. Figure 2 As shown, the results showed that strain D01 and Talaromyces purpureogenus The strains were clustered in the same branch, with a homology of more than 97%. Combined with their morphological characteristics, the strain D01 was identified as a purple-producing tularensis, and was classified and named Talaromyces purpureogenus .

[0032] The 18S rRNA sequence of the strain is shown in SEQ ID NO.1: CCTATTCCCCGGTATACGTTGCCACCATGGTAGGCCACTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGAACCATCGCCGGCGCAAGGCCATGCGATTCGTGAAGTTATTATGAATCACCAAGGAGCCCCGAAGGGCATTGGTTTTTTATCTAATAAATACACCCCTT CCGAAGTCGGGGTTTTGCGCATGTATTAGCTCTAGAATTACCACAGGTATCCATGTAGTAGGGTACTATCAAATAAACGATAACTGATTTAATGAGCCATTCGCAGTTTCACAGTAAAAGAGTGCTTATACTTAGACATGCATGGCTTAATCTTTGAGACAATTTTTATGACTACAG.

[0033] Example 3 Preparation of antibacterial active substances The preparation method of the antibacterial active substance ① specifically comprises the following steps: S1. Seed liquid culture: Use an inoculation needle to pick an area of ​​1 cm on the subculture plate. 2 The square culture block containing D01 colonies was added to 200 mL of PDB liquid culture medium and cultured at 180 rpm and 28°C for 16 h to obtain seed solution.

[0034] S2. Solid fermentation: Take 4% (volume / mass ratio) of the seed liquid and evenly spread it on the dried solid fermentation medium, blow dry, and ferment at 28°C for 6 days.

[0035] S3. After the fermentation is completed, the cells and culture medium are collected, crushed, and an equal volume of ethyl acetate is added. Ultrasonic-assisted extraction is performed at an ultrasonic power of 400 W for 15 min, and then the extraction is allowed to stand at room temperature for 2 h to obtain an extract; S4. Collect the extract and repeat the ultrasonic-assisted extraction and room temperature extraction steps in step S3 three times. Filter the obtained ethyl acetate extract, and concentrate the filtrate by rotary evaporation until the solvent is completely removed to obtain the antibacterial active substance ①.

[0036] Antibacterial active substance ②: Compared with the preparation steps of antibacterial active substance ①, the only difference is that in step S3, after the fermentation is completed, the surface mycelial spore layer is scraped with a scraper to obtain the spore mycelial part and the culture medium part, the culture medium part is crushed and then added with an equal volume of ethyl acetate for extraction (i.e., only the culture medium is collected for ethyl acetate extraction). The remaining steps and parameters are the same as those of antibacterial active substance ①.

[0037] Antibacterial active substance ③: Compared with the preparation steps of antibacterial active substance ①, the only difference is that the purple basket fungus ZCMU-Z6 with the preservation number: CCTCC NO: M 20211369 (donated by Zhejiang Chinese Medical University) is used instead of D01 to prepare the antibacterial active substance through seed liquid culture, solid fermentation and other steps. The other steps and parameters are the same as those of antibacterial active substance ①.

[0038] Antibacterial active substance ④: Compared with the preparation steps of antibacterial active substance ①, the only difference is that purple blue fungus D2 with a preservation number of GDMCC NO.66320 (disclosed in the patent document CN120349902A, which is the applicant's own strain) is used instead of D01 to prepare the antibacterial active substance through seed liquid culture, solid fermentation and other steps. The remaining steps and parameters are the same as those of antibacterial active substance ①.

[0039] Example 4 Antibacterial Test Test substances: The antibacterial active substances ①-④ prepared in Example 3 were dissolved in methanol to a test solution with a concentration of 10 mg / mL for antibacterial experiments.

[0040] Indicator bacteria: Burkholderia cepacia, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Escherichia coli and Candida albicans; The specific steps of the antibacterial test are as follows: The test used a double-layer agar diffusion method. 10 mL of sterilized 1% water agar medium was poured into a sterile plate and placed in an Oxford cup after solidification. 200 μL of indicator bacteria solution was added to 20 mL of nutrient agar medium at about 50°C and mixed evenly. The final concentration of the indicator bacteria was 3×10 6 CFU / mL, pour the mixed nutrient agar medium containing indicator bacteria into a sterile plate; after the nutrient agar medium is completely solidified, remove the Oxford cup, add 200 μL of the test substance to each well, and the blank control group uses an equal amount of methanol instead of the test substance. The plate is placed at 36°C for 24 hours, and the fungus is placed at 28°C for 72 hours, and the diameter of the inhibition zone is measured; among them, three parallel experiments are set for each indicator bacteria, and each inhibition zone is measured in three directions, and the data are presented as the average value.

[0041] The test results are as follows Figure 3 As shown in Table 1, the diameters of the inhibition zones of the antibacterial active substance ① against Burkholderia cepacia, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Escherichia coli and Candida albicans were 19.01 mm, 14.24 mm, 22.58 mm, 23.50 mm, 19.45 mm and 17.09 mm, respectively, indicating that the fermentation product of T. purpurogenum D01 has a good antibacterial effect; and the antibacterial active substance ② has almost the same antibacterial activity as that of the antibacterial active substance ① against the above-mentioned indicator bacteria. The applicant further used the spore hyphae portion obtained after fermentation to prepare an antibacterial active substance according to the method described in Example 3 and conducted an antibacterial experiment according to Example 4. The results showed that the antibacterial active substance prepared using only the spore hyphae portion had no obvious antibacterial effect on the above-mentioned six indicator bacteria (the results are not shown in Table 1). Therefore, it can be seen that the antibacterial active substance in the present invention is mainly an extracellular compound released into the culture medium by T. purpurogenum D01 during the fermentation process.

[0042] Combined with the antibacterial effects of antibacterial active substances ①-④ in Table 1 on Burkholderia cepacia, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Escherichia coli and Candida albicans, it can be seen that not all purple-producing fungi have antibacterial effects on the above 6 bacteria. The purple-producing fungi D01 isolated and obtained in the present invention can be fermented to produce active substances with good antibacterial properties.

[0043] Table 1 Antibacterial test data indicator bacteria Blank control Antibacterial active substances① Antibacterial active substances② Antibacterial active substances ③ Antibacterial active substances ④ Burkholderia cepacia - 19.01 18.18 - 21.26 Staphylococcus aureus - 14.24 14.04 - - Pseudomonas putida - 22.58 21.92 - 15.19 Pseudomonas aeruginosa - 23.50 23.15 - 19.57 Escherichia coli - 19.45 19.08 - 17.35 Candida albicans - 17.09 16.63 12.64 - Note: Unit: (mm), “-” means no obvious antibacterial activity.

[0044] Example 5 Heat resistance test Test substance: antibacterial active substance ① prepared in Example 3; Treatment of test substance: dissolve the antibacterial active substance ① in methanol to a concentration of 10 mg / mL to prepare a test solution for heat resistance test; The test substances were treated at 80°C and 60°C for 40 min, respectively, and then cooled to room temperature. Antibacterial tests were performed according to the method of Example 4. An equal amount of methanol was used instead of the test substance in the control group. Three parallel experiments were performed in each group, and the data are presented as the average value. Indicator bacteria: Only Candida albicans was used for the experiment.

[0045] The experimental results show that after the antibacterial active substance ① was treated at 80°C and 60°C for 40 minutes, an antibacterial test was performed according to the antibacterial test steps described in Example 4. The experimental results show that the diameters of the inhibition zones of the antibacterial active substance ① for Candida albicans after the above two treatment methods are almost consistent with the results in Table 1, and the inhibition zone diameters are 17.36 mm and 16.91 mm, respectively, indicating that the antibacterial active substance produced by the purple-blue fungus D1 has high temperature resistance.

[0046] Example 6 Anticorrosion Test Test substance: The antibacterial active substance ① prepared in Example 3 was dissolved in 1,2-butanediol to a test solution with a mass fraction of 5%; The test substance is added to the cosmetics as a natural preservative, and the preservative test is conducted with reference to the well-known microbial challenge test methods of the Cosmetic, Toiletries and Fragrance Association (CTFA) and the United States Pharmacopoeia. The specific test steps are as follows: First, 12 portions of preservative-free facial mask liquid were prepared according to the basic formula and randomly divided into four groups, with three portions of facial mask liquid in each group. The test substance group was added with antibacterial active substance ① produced by the purple-producing Talaromyces strain D01 so that the mass fraction of the test substance in the facial mask liquid was finally 0.5%. The blank control group was added with 1,2-butylene glycol in an equal amount to the test substance. The test bacteria Escherichia coli, Staphylococcus aureus, Pseudomonas putida, Pseudomonas aeruginosa, Burkholderia cepacia, and Candida albicans in the logarithmic growth phase were diluted to 4×10 9 CFU / mL, the mixed bacterial solution was added to the sample, and the bacterial group made the final concentration of bacteria in the mask solution 4×10 7 CFU / mL, the fungus group made the final concentration of fungi in the mask liquid 4×10 6CFU / mL, after being mixed evenly, the bacteria group was cultured in a 36℃ incubator, and the fungus group was cultured in a 28℃ incubator; according to the total colony count test method in Chapter 5 Microbiological Test Methods in the 2015 Edition of Cosmetics Safety Technical Specifications, the number of viable bacteria was determined 6h, 7d, 14d, and 28d after inoculation to judge the preservative efficacy of the cosmetics; the judgment standard is: when each sample is inoculated with bacteria, the number of surviving bacteria is reduced to no more than 0.1% of the initial concentration on the 7th day, and then gradually decreases, and no sterile growth is achieved on the 28th day; the preservative is effective and passes the test; otherwise, the preservative is ineffective and fails the test.

[0047] The antiseptic test results are shown in Table 2 (data presented as mean values). After 6 hours of exposure, the viable bacterial counts in both the bacterial and fungal groups showed a downward trend. After 7 days of exposure, the viable bacterial counts in all test groups were below 100 CFU / mL. From 14 to 28 days, the viable bacterial counts in both the bacterial and fungal groups were zero, indicating that the test groups passed the test and exhibited excellent antiseptic properties. This suggests that the antibacterial active substances produced by the fermentation of T. purpurogenum strain D01 can be used as antibacterial and antiseptic raw materials, exhibiting excellent antiseptic properties when used in the preparation of foods, health products, or daily chemical products, and possess broad application prospects and significant translational research value.

[0048] Table 2 Anticorrosion test data

[0049] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A strain of purple-producing fungus ( Talaromyces purpureogenus ) D01, characterized in that, Its deposit number is GDMCC NO.66458.

2. Use of the purple-producing fungus D01 as claimed in claim 1 in the preparation of antibacterial active substances.

3. A method for producing antibacterial active substances by fermenting the purple-producing Talaromyces D01 according to claim 1, characterized in that: The following steps are involved: S1. Seed liquid culture: Pick the culture block containing the bacterial colony and add it to PDB liquid culture medium to obtain seed liquid; S2, solid fermentation: the seed liquid is evenly coated on the solid fermentation medium for fermentation; S3. After the fermentation is completed, the cells and culture medium are collected, crushed, and ultrasonic-assisted extraction is performed by adding an equal volume of ethyl acetate. The extraction is allowed to stand at room temperature to obtain an extract; S4, collecting the extract, filtering, and performing rotary evaporation concentration on the filtrate to obtain the antibacterial active substance.

4. The method according to claim 3, characterized in that In step S1, the culture temperature is 26-30° C., the culture speed is 160-200 rpm, and the culture time is 12 h-18 h.

5. The method according to claim 3, characterized in that In step S2, the fermentation temperature is 26-30° C. and the fermentation time is 5-7 days.

6. The method according to claim 3, characterized in that In step S3, the ultrasonic power is 100-800w, the ultrasonic time is 5-30min, and the extraction time at room temperature is 1-3h.

7. The method according to claim 3, characterized in that The ethyl acetate ultrasonic-assisted extraction and room temperature static extraction steps in step S3 are repeated 2-3 times.

8. A product, characterized in that It comprises the purple-producing fungus D01 as described in claim 1.

9. The use of the purple-producing Talaromyces D01 according to claim 1 in preparing food, health products or daily chemical products, characterized in that: The purple-producing Talaromyces D01 according to claim 1 is used to ferment and prepare antibacterial active substances, and the antibacterial active substances are used in the preparation of food, health products or daily chemical products.

10. Use of the antibacterial active substance prepared by the method according to claim 3 in the preparation of food, health care products or daily chemical products.

Citation Information

Patent Citations

  • Talaromyces purpurogenum D2 and application thereof

    CN120349902A

  • Dimeric tetrahydro Xanthone compounds and preparation method and application thereof

    CN110746446A

  • Cyclic peptide compounds as well as preparation method and application thereof

    CN112300243A

Cited By

  • Talaromyces purpurogenum as well as fermentation supernatant and application thereof

    CN121109150A