Bacterial strain for preventing and / or treating ulcerative colitis, mixed probiotics and application of bacterial strain and mixed probiotics

Abstract

The invention provides a bacterial strain for preventing and / or treating ulcerative colitis, mixed probiotics and application of the bacterial strain and the mixed probiotics, and belongs to the technical field of microorganisms. The bacterial strain disclosed by the invention is Bifidobacterium longum ZJUCH (Bifidobacterium longum), and the preservation number of the bacterial strain is CCTCC (China Center for Type Culture Collection) NO: M 2025583. Experiments prove that the strain has the effect of improving the symptoms of ulcerative colitis. Meanwhile, mixed probiotics prepared by combining the bifidobacterium longum ZJUCH with bifidobacterium adolescentis and bifidobacterium pseudocatenuicola improve weight loss, DAI score increase and colon shortening caused by molding, and have the effect of preventing and / or treating ulcerative colitis.

Description

Technical Field

[0001] The present invention belongs to the technical field of microorganisms, and in particular relates to a bacterial strain for preventing and / or treating ulcerative colitis, a mixed probiotic and applications thereof. Background Art

[0002] Ulcerative colitis is a chronic, nonspecific intestinal disease of unknown etiology characterized by continuous, diffuse inflammatory changes in the colorectal mucosa. Its etiology is still unclear. In recent years, the incidence of ulcerative colitis has been increasing rapidly, and it has become a common and difficult-to-treat disease of the digestive system. Existing therapies are mainly aminosalicylic acid preparations, glucocorticoids, immunosuppressants and biological agents, all of which have certain efficacy, but have problems such as easy relapse after discontinuation of the drug and large side effects. Long-term use may aggravate intestinal barrier damage and seriously affect the patient's quality of life. At present, there is no cure for ulcerative colitis, and there is a clear risk of cancer. At present, probiotic-based intestinal disease treatment has good application prospects, but the effects of existing probiotic strains are mixed, and existing studies have limitations in the ability of a single strain to repair intestinal damage. Summary of the Invention

[0003] In view of this, the object of the present invention is to provide a strain, a mixed probiotic and its use for preventing and / or treating ulcerative colitis. The strain and mixed probiotic of the present invention improve the weight loss, increased DAI score and colon shortening caused by the ulcerative colitis model, and have the effect of preventing and / or treating ulcerative colitis.

[0004] In order to solve the above technical problems, the present invention provides the following technical solutions: The present invention provides a strain for preventing and / or treating ulcerative colitis, wherein the strain is Bifidobacterium longum ( Bifidobacterium longum )ZJUCH, the deposit number is CCTCC NO: M 2025583, and the deposit date is March 25, 2025.

[0005] The present invention provides a bacterial agent for preventing and / or treating ulcerative colitis, comprising a bacterial liquid of the strain.

[0006] The present invention provides a mixed probiotic for preventing and / or treating ulcerative colitis. The mixed probiotic comprises Bifidobacterium longum, Bifidobacterium adolescentis and Bifidobacterium pseudocatenulatum. The Bifidobacterium longum is Bifidobacterium longum ZJUCH, the preservation number of the Bifidobacterium adolescentis is ATCC 15703, and the preservation number of the Bifidobacterium pseudocatenulatum is ATCC 27919.

[0007] Preferably, the ratio of the viable cell counts of Bifidobacterium longum ZJUCH, Bifidobacterium adolescentis and Bifidobacterium pseudocatenulatum is 0.5-2:0.5-2:0.5-2, respectively.

[0008] The preparation method of the mixed probiotics of the present invention comprises the following steps: inoculating the Bifidobacterium longum ZJUCH, Bifidobacterium adolescentis and Bifidobacterium pseudocatenulatum into a bifidobacterium liquid culture medium for cultivation, then transferring the culture mixture into a Columbia blood agar plate for cultivation, adjusting the bacterial liquid concentration; and uniformly mixing the Bifidobacterium longum ZJUCH bacterial liquid: Bifidobacterium adolescentis bacterial liquid: Bifidobacterium pseudocatenulatum bacterial liquid in a volume ratio of 0.5-2:0.5-2:0.5-2.

[0009] Preferably, the culture is anaerobic culture.

[0010] Preferably, the culture time is 12-72 hours and the temperature is 35-39°C.

[0011] Preferably, the concentration of the adjusted bacterial solution is 1×10 8 -1×10 10 CFU / mL.

[0012] Preferably, the reagent used to adjust the bacterial liquid concentration is a pH 7.2-7.4 phosphate buffer solution.

[0013] The present invention provides use of the strain, the bacterial agent, the mixed probiotics, or the mixed probiotics obtained by the preparation method in preparing a product for preventing and / or treating ulcerative colitis.

[0014] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides a Bifidobacterium longum ( Bifidobacterium longum ) ZJUCH, with a deposit number of CCTCC NO: M 2025583. Experimental verification of the present invention shows that the strain improves weight loss, increased DAI score, and colon shortening caused by a mouse ulcerative colitis model, and has the effect of preventing and / or treating ulcerative colitis.

[0015] Furthermore, the present invention combines the Bifidobacterium longum ZJUCH with Bifidobacterium adolescentis (ATCC 15703) and Bifidobacterium pseudocatenulatus (ATCC 27919) to create a mixed probiotic. Experimental validation demonstrates that this mixed probiotic improves weight loss, increased DAI scores, and colon shortening in a mouse model of ulcerative colitis, demonstrating its effectiveness in preventing and / or treating ulcerative colitis. This mixed probiotic, with its complementary functions across different strains and multi-dimensional repair of the intestinal microenvironment, is more conducive to restoring the intestinal microecology in patients with ulcerative colitis, thereby enhancing the therapeutic effect.

[0016] Biological deposit information Bifidobacterium longum ZJUCH, classified as Bifidobacterium longumZJUCH, Latin name Bifidobacterium longum , deposited in the China Center for Type Culture Collection on March 25, 2025, with the deposit address being Wuhan University, Wuhan, China, with the deposit number being CCTCC NO: M 2025583. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a graph showing the results of Bifidobacterium longum ZJUCH improving the weight loss caused by modeling.

[0018] Figure 2 This is the result of the increase in DAI score caused by the improvement of modeling by Bifidobacterium longum ZJUCH.

[0019] Figure 3 This figure shows the results of mixed probiotics improving the weight loss caused by modeling.

[0020] Figure 4 This figure shows the result of the increase in DAI score caused by the improvement of modeling by mixed probiotics.

[0021] Figure 5 Statistical graph showing the improvement of colon shortening caused by mixed probiotics in modeling.

[0022] Figure 6 Diagram of the anatomy of the colon shortening caused by mixed probiotics to improve modeling.

[0023] Figure 7 Statistical graph showing that mixed probiotics improved model-induced colon shortening better than single strains.

[0024] Figure 8 The anatomy of the colon is shown in Figure 1. A mixed probiotic strain improves colon shortening caused by modeling, which is better than a single strain. B1 is Bifidobacterium longum ZJUCH, BP is Bifidobacterium pseudocatenulatum, and Ba is Bifidobacterium adolescentis. DETAILED DESCRIPTION

[0025] The present invention provides a strain for preventing and / or treating ulcerative colitis, wherein the strain is Bifidobacterium longum ( Bifidobacterium longum ) ZJUCH, deposit number: CCTCC NO: M 2025583. The Bifidobacterium longum ZJUCH of the present invention was isolated from the feces of a healthy child. The 16S rRNA gene sequence of the Bifidobacterium longum ZJUCH of the present invention is shown in SEQ ID NO. 1.

[0026] The present invention provides a bacterial agent for preventing and / or treating ulcerative colitis, comprising a bacterial solution of Bifidobacterium longum ZJUCH. The preparation of the bacterial solution of Bifidobacterium longum ZJUCH comprises the following steps: inoculating the Bifidobacterium longum ZJUCH into a Bifidobacterium longum (BBL) liquid culture medium for cultivation, then transferring the culture mixture into a Columbia blood agar plate for cultivation, and adjusting the bacterial solution concentration to 1×10 8 -1×10 10 Unless otherwise specified, the bifidobacterium liquid culture medium and Columbia blood agar plate described in the present invention are commercially available products well known in the art.

[0027] The present invention provides a mixed probiotic for preventing and / or treating ulcerative colitis, wherein the mixed probiotic comprises Bifidobacterium longum ZJUCH, Bifidobacterium adolescentis ( Bifidobacterium adolescentis ) and Bifidobacterium pseudocatenulatum ( Bifidobacterium pseudocatenulatum The preservation number of the Bifidobacterium adolescentis ATCC15703, purchased from Ningbo Mingzhou Biotechnology Co., Ltd., numbered BMZ137332; the preservation number of the Bifidobacterium pseudocatenulatum is ATCC 27919, purchased from Ningbo Mingzhou Biotechnology Co., Ltd., numbered BMZ009732.

[0028] In the present invention, the ratio of the viable bacteria counts of Bifidobacterium longum ZJUCH, Bifidobacterium adolescentis and Bifidobacterium pseudocatenulatum is 0.5-2:0.5-2:0.5-2, preferably 0.8-1.5:0.8-1.5:0.8-1.5, and more preferably 1:1:1.

[0029] The present invention provides a method for preparing the mixed probiotics, comprising the following steps: inoculating the Bifidobacterium longum ZJUCH, Bifidobacterium adolescentis, and Bifidobacterium pseudocatenulatum into a bifidobacterium liquid culture medium for cultivation, then transferring the culture mixture into a Columbia blood agar plate for cultivation, and adjusting the bacterial solution concentration; and uniformly mixing the Bifidobacterium longum ZJUCH bacterial solution: Bifidobacterium adolescentis bacterial solution: Bifidobacterium pseudocatenulatum bacterial solution in a volume ratio of 0.5-2:0.5-2:0.5-2. The present invention adjusts the bacterial solution concentration to 1×10 8 -1×10 10 CFU / mL, preferably 5×10 8 -0.5×10 10 CFU / mL, more preferably 1×10 9 CFU / mL. The concentration of the mixed probiotics of the present invention is 1×10 8 -1×10 10 CFU / mL, preferably 5×10 8 -0.5×10 10 CFU / mL, more preferably 1×109 Unless otherwise specified, the bifidobacterium liquid culture medium and Columbia blood agar plate described in the present invention are commercially available products well known in the art.

[0030] In the present invention, the culture is anaerobic culture; the culture time is 12-72 hours, preferably 20-48 hours, and more preferably 24 hours.

[0031] In the present invention, the reagent used to adjust the bacterial solution concentration is a pH 7.2-7.4 phosphate buffer solution. In the present invention, round translucent bacterial colonies are picked or scraped from a Columbia blood agar plate, placed in a pH 7.2-7.4 phosphate buffer solution, and mixed evenly to prepare the desired bacterial solution concentration.

[0032] The present invention also provides use of the strain, the bacterial agent, the mixed probiotics, or the mixed probiotics obtained by the preparation method in preparing a product for preventing and / or treating ulcerative colitis.

[0033] In the present invention, unless otherwise specified, all components, reagents, or culture media are commercially available products well known to those skilled in the art.

[0034] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0035] Example 1 1. Isolation and identification of Bifidobacterium longum A Bifidobacterium longum ( Bifidobacterium longum ZJUCH), isolated from fecal samples of healthy children. The samples were cultured using mGAM medium and single colonies were isolated.

[0036] The single colony was identified as Bifidobacterium longum by Hangzhou Weishu Biotechnology Co., Ltd. using the bacterial 16S rRNA gene sequencing identification method, and the nucleic acid sequence was as follows: GATGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGGGATCCATCAGGCTTTGCTTGGTGGTGAGAGTGGCGAACGGGTGAGTAATGCGTGACCGACCTGCCCCATACACCGGAATAGCTCCTGGAAACGGGTGGTAATGCCGGATGCTCCAGTTGATCGCATGGTCTTCTGGGAAAGCTTTCGCGGTATGGGATGGGGTCGCGTCCTATCAGCT TGACGGCGGGGTAACGGCCCACCGTGGCTTCGACGGGTAGCCGGCCTGAGAGGGCGACCGGCCACATTGGGACTGAGATACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAA TGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGAGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACG (SEQ ID NO.1).

[0037] The identified Bifidobacterium longum ZJUCH was deposited in China Center for Type Culture Collection (CCTCC) with the deposit number CCTCC NO: M 2025583.

[0038] 2. Cultivation, concentration determination and bacterial solution preparation of Bifidobacterium longum (1) Weigh 5.1 g of Bifidobacterium broth (BBL, purchased from Ningbo Mingzhou Biotechnology Co., Ltd.), dilute to 100 mL with distilled water or deionized water, mix well, and sterilize at 121°C for 30 min. Cool to below 50°C, and then place in an anaerobic chamber with a mixed gas of 80% N2, 10% H2, and 10% CO2 for deoxygenation overnight.

[0039] (2) The selected Bifidobacterium longum ZJUCH was transferred from the glycerol cryovial to a deoxygenated liquid culture medium. After culturing at 37°C under anaerobic conditions for 24 hours, flocculent precipitates were visible in the liquid culture medium. After mixing by pipetting, 200 μL of the mixture was placed in a Columbia blood plate and evenly spread with an L-shaped spreading stick. The mixture was then cultured at 37°C under anaerobic conditions for 24 hours. Round, translucent colonies were visible on the blood plate.

[0040] (3) Use McFarland turbidimeter to count bacteria: add 4 mL of sterile anaerobic phosphate buffer solution (PBS, pH 7.2-7.4) to a sterile tube, adjust the zero value with McFarland turbidimeter, then scrape the colonies from the blood plate with a sterile cotton swab, shake it up and down in the above sterile tube to shake off the colonies, and measure the turbidity again with McFarland turbidimeter to obtain the specific McFarland concentration unit (McF). According to 0.5McF=1.5×10 8 The specific bacterial concentration can be obtained by the conversion formula of CFU / mL. The bacterial concentration was adjusted to 1×10 using a McFadden turbidimeter. 9 CFU / mL.

[0041] 3. Bifidobacterium longum ZJUCH in treating mouse ulcerative colitis model Thirty 8-week-old C57BL / 6J male mice were pre-fed for one week and then divided into three groups: Con group, dextran sulfate sodium (DSS) group and DSS+Bifidobacterium longum group. The mice in the Con group were treated with 200µL / d PBS by gavage for 17 days, and the drinking water was changed to sterile water from the 10th day. The mice in the DSS+PBS group were treated with 200µL / d PBS by gavage for 17 days, and the drinking water was changed to DSS solution from the 10th day. The mice in the DSS+Bifidobacterium longum group were treated with 200µL / d Bifidobacterium longum bacterial solution by gavage for 17 days, and the drinking water was changed to DSS solution from the 10th day. The body weight and DAI score were recorded after the start of DSS modeling. The details of DAI score are shown in Table 1. The results are shown in Table 1. Figure 1-2 It can be seen that the administration of Bifidobacterium longum ZJUCH improved the weight loss and increased DAI score caused by modeling.

[0042] Table 1 DAI scoring rules

[0043] Example 2 1. Strain information Bifidobacterium longum ( Bifidobacterium longum ZJUCH) is the strain isolated in Example 1.

[0044] Bifidobacterium adolescentis ( Bifidobacterium adolescentis) ATCC 15703, deposited in the American Type Culture Collection (ATCC), was purchased from Ningbo Mingzhou Biotechnology Co., Ltd. with the number BMZ137332.

[0045] Bifidobacterium pseudocatenulatum ( Bifidobacterium pseudocatenulatum ) ATCC 27919, deposited in the American Type Culture Collection, was purchased from Ningbo Mingzhou Biotechnology Co., Ltd. with the number BMZ009732.

[0046] 2. Cultivation and identification of three strains Bifidobacterium longum ZJUCH, Bifidobacterium adolescentis, and Bifidobacterium pseudocatenulatum were transferred from glycerol cryovials to deoxygenated liquid culture medium (prepared as in step 2 of Example 1), fully activated, and cultured at 37°C for 24 hours. They were then streaked onto Columbia blood plates in an anaerobic chamber and cultured at 37°C under an anaerobic environment for 24 hours. Single colonies were picked for identification, and the above strains were identified as corresponding strains.

[0047] 3. Concentration determination of three strains (1) After culturing Bifidobacterium longum ZJUCH, Bifidobacterium adolescentis, and Bifidobacterium pseudocatenulatum at 37°C in an anaerobic environment for 24 hours, flocculent precipitates were visible in the liquid culture medium. After mixing by pipetting, 200µL of each mixture was placed in a Columbia blood agar plate and evenly spread with an L-shaped spreading stick. After culturing at 37°C in an anaerobic environment for 24 hours, round, translucent colonies were visible on the blood agar plate.

[0048] (2) Use McFarland turbidimeter to count bacteria: add 4 mL of sterile anaerobic phosphate buffer solution (PBS, pH 7.2-7.4) to a sterile tube, adjust the instrument to zero, then use a sterile cotton swab to scrape the colonies from the blood plate, move the swab up and down in the sterile tube to shake off the colonies, and measure the turbidimeter again to obtain the specific McFarland concentration unit (McF). According to 0.5McF=1.5×10 8 The conversion formula of CFU / mL can be used to obtain the specific bacterial liquid concentration.

[0049] 4. Preparation of mixed probiotics After culturing Bifidobacterium longum ZJUCH, Bifidobacterium adolescentis, and Bifidobacterium pseudocatenulatum at 37°C in an anaerobic environment for 24 hours, flocculent precipitates were visible in the liquid culture medium. After pipetting and mixing, 200µL of each mixture was placed in a Columbia blood agar plate and spread evenly with an L-shaped spreading stick. The plates were then incubated at 37°C in an anaerobic environment for 24 hours, after which round, translucent colonies were visible on the blood agar plate.

[0050] 4 mL of sterile anaerobic phosphate buffer solution (PBS, Meilun Biotechnology, catalog number MA0015) at pH 7.2-7.4 was added to a sterile tube. A sterile cotton swab was used to scrape a colony from the above-cultured Columbia blood plate. The colony was then moved up and down in the sterile tube. The concentrations of the three bacterial solutions were adjusted to 1×10-1 using a McFadden turbidimeter using the method described in step 3 of this example. 9 CFU / mL. Take 1 mL of each of the three quantified bacterial solutions and mix them evenly in a sterile tube. The mixing volume ratio is 1:1:1 for Bifidobacterium longum: Bifidobacterium adolescentis: Bifidobacterium pseudocatenulatum, and the final concentration is 1×10 9 CFU / mL of mixed probiotics.

[0051] Example 3 Treatment of ulcerative colitis model in mice with mixed probiotics Thirty 8-week-old C57BL / 6J male mice were pre-fed for one week and then divided into three groups: Con group, DSS group and DSS+mixed bacteria group. The mice in the Con group were given 200µL / d PBS by gavage for 17 days, and the drinking water was changed to sterilized ultrapure water from the 10th day. The mice in the DSS+PBS group were given 200µL / d PBS by gavage for 17 days, and the drinking water was changed to 3% DSS solution from the 10th day. The DSS+mixed bacteria group were given 200µL / d mixed bacteria by gavage for 17 days, and the drinking water was changed to 3% DSS solution from the 10th day. The body weight and DAI score were recorded after the start of the DSS model. The details of the DAI score are shown in Table 1. After the experiment, anatomical sampling was performed to measure the colon length of the mice in their natural state. The results are shown in Table 1. Figure 3-6 It can be seen that the administration of mixed probiotics improved the weight loss, increased DAI score and colon shortening caused by modeling.

[0052] Example 4 Comparison of mixed probiotics and single bacterial species in alleviating DSS-induced ulcerative colitis in mice 1. Cultivation and preparation of mixed probiotics and single strains The mixed probiotics were prepared according to the method in step 4 of Example 2.

[0053] The single strain was 1×10 prepared in step 4 of Example 2. 9 CFU / mL Bifidobacterium longum liquid, 1×10 9 CFU / mL Bifidobacterium adolescentis liquid and 1×10 9 CFU / mL Bifidobacterium pseudocatenulatus bacterial solution.

[0054] 2. Treatment of ulcerative colitis model in mice with mixed probiotics and single strains Sixty eight-week-old C57BL / 6J male mice were pre-fed for one week and then divided into six groups: Con group, DSS group, DSS + Bifidobacterium longum group, DSS + Bifidobacterium adolescentis group, DSS + Bifidobacterium pseudocatenulatus group, and DSS + mixed bacteria group. Mice in the Con group were gavaged with 200 µL / day of PBS for 17 days, with their drinking water replaced by sterile ultrapure water starting on day 10. Mice in the DSS + PBS group were gavaged with 200 µL / day of PBS for 17 days, with their drinking water replaced by 3% DSS solution starting on day 10. The DSS+Bifidobacterium longum group was given 200µL / d of Bifidobacterium longum solution by gavage, the DSS+Bifidobacterium adolescentis group was given 200µL / d of Bifidobacterium adolescentis solution by gavage, the DSS+Bifidobacterium pseudocatenulatus group was given 200µL / d of Bifidobacterium pseudocatenulatus solution by gavage, and the DSS+mixed bacteria group was given 200µL / d of mixed probiotic solution by gavage for 17 days. Starting from the 10th day, the drinking water was changed to 3% DSS solution. After the end of the experiment, the mice were dissected and the length of their colon was measured in their natural state. The results are as follows: Figure 7-8 It can be seen that in terms of improving the degree of colon shortening, the effect of administering mixed probiotics is better than administering a single strain.

[0055] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A bacterial strain for preventing and / or treating ulcerative colitis, characterized in that: The strain is Bifidobacterium longum ( Bifidobacterium longum )ZJUCH, the deposit number is CCTCC NO: M 2025583, and the deposit date is March 25, 2025.

2. A bacterial agent for preventing and / or treating ulcerative colitis, characterized in that: A bacterial solution comprising the strain according to claim 1.

3. A mixed probiotic for preventing and / or treating ulcerative colitis, characterized in that: The mixed probiotics include Bifidobacterium longum, Bifidobacterium adolescentis and Bifidobacterium pseudocatenulatum; The Bifidobacterium longum is the Bifidobacterium longum ZJUCH described in claim 1, the deposit number of the Bifidobacterium adolescentis is ATCC 15703, and the deposit number of the Bifidobacterium pseudocatenulatus is ATCC 27919.

4. The mixed probiotics according to claim 3, wherein The ratio of the number of live bacteria of Bifidobacterium longum ZJUCH, Bifidobacterium adolescentis and Bifidobacterium pseudocatenulatum is 0.5-2:0.5-2:0.5-2 respectively.

5. The method for preparing the mixed probiotics according to claim 3 or 4, characterized in that: The method comprises the following steps: inoculating the Bifidobacterium longum ZJUCH, Bifidobacterium adolescentis and Bifidobacterium pseudocatenulatum described in claim 3 into a bifidobacterium liquid culture medium for cultivation, then transferring the culture mixture into a Columbia blood agar plate for cultivation, adjusting the bacterial liquid concentration; and uniformly mixing the bacterial liquid according to a volume ratio of Bifidobacterium longum ZJUCH bacterial liquid: Bifidobacterium adolescentis bacterial liquid: Bifidobacterium pseudocatenulatum bacterial liquid = 0.5-2:0.5-2:0.5-2.

6. The preparation method according to claim 5, wherein The culture is anaerobic culture.

7. The preparation method according to claim 5, wherein The culture time is 12-72 hours and the temperature is 35-39°C.

8. The preparation method according to claim 5, wherein The concentration of the adjusted bacterial solution was 1×10 8 -1×10 10 CFU / mL.

9. The preparation method according to claim 5, wherein The reagent used to adjust the bacterial liquid concentration is a pH 7.2-7.4 phosphate buffer solution.

10. Use of the strain according to claim 1, the bacterial agent according to claim 2, the mixed probiotics according to any one of claims 3 to 4, or the mixed probiotics obtained by the preparation method according to any one of claims 5 to 9 in preparing a product for preventing and / or treating ulcerative colitis.

Images