Engineering bacterium for synthesizing mannitol by using fructose and nicotinamide ribose and application of engineering bacterium

Abstract

The invention relates to an engineering bacterium for synthesizing mannitol by using fructose and nicotinamide ribose and application thereof. The invention provides genetic recombination escherichia coli for synthesizing D-mannitol by using D-fructose and nicotinamide ribose, which comprises the following modifications: insertion or enhanced expression of a gene cluster 1, the gene cluster 1 comprises a D-mannitol dehydrogenase coding gene MDH and a formate dehydrogenase coding gene FDH; deletion or inhibitory expression of a gene cluster 2, wherein the gene cluster 2 comprises a 6-phosphofructokinase 1 coding gene pfkA; and insertion or enhanced expression of a gene cluster 3, wherein the gene cluster 3 comprises a nicotinamide ribokinase coding gene NRK, a nicotinamide mononucleotide adenosine transferase coding gene NMNAT, a polyphosphate kinase coding gene PPK2 and a pyrophosphohydrolase coding gene IPPa. The strain disclosed by the invention can effectively synthesize high-purity D-mannitol by using D-fructose as a production raw material and nicotinamide ribose as a co-substrate through an enzyme catalytic reaction under the condition of not additionally adding NAD < + > or NADP < + >, so that the production cost is greatly reduced.

Description

Technical Field

[0001] The present invention relates to the fields of gene editing, gene recombination-edited microbial strains, synthetic biology, and microbial whole-cell catalysis technology, and specifically to an engineered bacterium for synthesizing mannitol using nicotinamide riboside and its application. Background Art

[0002] D-mannitol is a white or colorless crystalline powder that is odorless and has a refreshing sweetness. Its sweetness is approximately 70% that of sucrose, and its caloric value is only 1.99 kcal / g. Due to its low calorie content and low cariogenicity, it is used in the food industry as a sweetener and stabilizer. D-mannitol has a zero glycemic and insulin-lowering index. As a functional food, it can be absorbed and utilized by intestinal microbiota, achieving lipid-lowering and weight-loss effects. Furthermore, D-mannitol is a precursor molecule for some synthetic drugs. In summary, D-mannitol has enormous application value in industries such as food additives, health supplements, and pharmaceuticals.

[0003] There are three main traditional methods for producing D-mannitol: plant extraction, chemical synthesis, and microbial transformation. Kelp extraction, currently the predominant method for producing mannitol, involves hydrolysis, filtration, separation, and purification, but suffers from low extraction yields and high production costs. The catalytic reduction method involves catalytically hydrogenating a mixture of glucose and fructose generated by sucrose hydrolysis under high temperature and strong acid conditions to produce a mixture of sorbitol and mannitol. This method then undergoes a separation process to obtain pure D-mannitol. However, this method has harsh reaction conditions, requires a metal catalyst, and is subject to the problem of byproduct accumulation.

[0004] Biotransformation (microbial fermentation and enzyme catalysis) is an environmentally friendly and rapidly developing method. Its key enzyme D-mannitol dehydrogenase is activated by the cofactor NAD + or NADP + Under the presence of NAD, D-fructose can be catalyzed to synthesize D-mannitol. + and NADP + The high price makes it difficult for the biotransformation method to be produced and applied on a large scale in industry.

[0005] In view of the above problems, it is necessary to establish an effective method without adding NAD. + or NADP + Therefore, a method for the biosynthesis of D-mannitol by adding nicotinamide riboside was developed. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a stable strain without adding NAD +It catalyzes the synthesis of D-fructose into D-mannitol.

[0007] In order to solve the above technical problems, the first aspect of the present invention provides a method for synthesizing D-mannitol by adding nicotinamide riboside to D-fructose, wherein the preparation method is as follows:

[0008] D-fructose and nicotinamide riboside are used as co-substrates, reaction solvent and recombinant engineered strains are added, the pH of the reaction system is adjusted to 6, the temperature of the reaction system is controlled, and the supernatant collected by centrifugation after the reaction is completed is the D-mannitol solution.

[0009] In a second aspect, the present invention provides a recombinant strain comprising NAD + Synthetic gene cluster, and can simultaneously express D-mannitol dehydrogenase (MDH) gene and formate dehydrogenase (FDH) gene.

[0010] The recombinant strain is a recombinant strain obtained by performing the following transformations A), B) and C) in Escherichia coli;

[0011] A) inhibiting or reducing the 6-phosphofructokinase 1 pfkA gene and the 6-phosphofructokinase 2 pfkB gene in the Escherichia coli; or the above isoenzyme genes or their functional homolog genes are inhibited, and / or the activity of the proteins, domains or functional fragments encoded by the above genes or their isoenzyme genes is inhibited.

[0012] B) increasing the expression of the nicotinamide ribokinase (NRK) gene, nicotinamide mononucleotide adenylyltransferase (NMNAT) gene, polyphosphate kinase (PPK2) gene and pyrophosphohydrolase (IPPa) gene in the Escherichia coli, or the expression of their isozyme genes or functional homologs thereof.

[0013] C) Simultaneous expression of the D-mannitol dehydrogenase (MDH) gene and the formate dehydrogenase (FDH) gene

[0014] The recombinant strain D-mannitol dehydrogenase (MDH) is derived from Thermotoganea politana, and the formate dehydrogenase (FDH) gene is derived from Ancylobacter aquaticus.

[0015] In the above-mentioned recombinant bacteria,

[0016] The transformation A) is any of the following:

[0017] A-1) inhibiting or reducing the expression of the pfkA gene and the pfkB gene in the Escherichia coli;

[0018] A-2) inhibiting or reducing the expression of the pfkA gene in the Escherichia coli;

[0019] In the recombinant bacteria described above, the Escherichia coli may be Escherichia coli BW25113 or MG1655 or BL21 (DE3) or MC02;

[0020] In a third aspect, the present invention provides a method for preparing the recombinant bacteria described in the second aspect, comprising the following steps: performing the transformation according to the second aspect.

[0021] In the above method, the modification A-1) is to knock out or replace the pfkA gene and the pfkB gene;

[0022] or, A-2) knocking out or replacing the pfkA gene;

[0023] Alternatively, the modification B) is to introduce the nicotinamide ribokinase (NRK) gene, nicotinamide mononucleotide adenosyltransferase (NMNAT) gene, polyphosphate kinase (PPK2) gene and pyrophosphohydrolase (IPPa) gene into the Escherichia coli.

[0024] Alternatively, the transformation C) is to introduce a recombinant plasmid containing the D-mannitol dehydrogenase (MDH) gene and the formate dehydrogenase (FDH) gene into Escherichia coli.

[0025] In an embodiment of the present invention, the method for preparing the recombinant strain described above is any one of the following:

[0026] The transformation A-1) + B + C specifically involves replacing both the pfkA and pfkB genes on the E. coli MC02 genome with the araC-araBAD promoter-E4 sequence-TrrnB terminator fragment shown in sequence 1, first order. The resulting recombinant bacterium is M02;

[0027] The transformation A-2) + B + C specifically involves replacing the pfkA gene on the E. coli MC02 genome with the araC-araBAD promoter-E4 sequence-TrrnB terminator fragment shown in sequence 1, first. The resulting recombinant strain is M01;

[0028] In a fourth aspect, the present invention provides a recombinant bacterium prepared by the method of the third aspect.

[0029] In a fifth aspect, the present invention provides the use of the recombinant bacteria described in the second or fourth aspect in any of the following:

[0030] D1, production of D-mannitol;

[0031] D2, catalyzes the conversion of D-fructose into mannitol;

[0032] D3. Preparation of products for producing D-mannitol;

[0033] D4. Prepare products that catalyze the conversion of D-fructose into D-mannitol.

[0034] The beneficial technical effects achieved by the present invention are as follows:

[0035] The present invention is based on the above cofactor NAD + and NADP + The high price makes it difficult for D-mannitol bioconversion to be produced and applied on a large scale in industry. + or NADP + A method for the biosynthesis of D-mannitol is disclosed. This method uses D-fructose as a raw material and nicotinamide riboside as a co-substrate to synthesize high-purity D-mannitol through an enzyme-catalyzed reaction. The D-mannitol production process of the present invention significantly reduces production costs, laying a solid foundation for its widespread application and development.

[0036] The recombinant strain provided by the present invention can achieve microbial growth using glucose, glycerol, sucrose, fructose syrup, and other carbon sources, as well as mixed carbon sources containing these carbon sources. After the microorganisms have grown to a certain biomass, D-mannitol can be synthesized using D-fructose and nicotinamide riboside as raw materials; a corresponding technical route for synthesizing D-mannitol has been established. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the plasmid map of pBAD / HisB-TNMDH-AAFDH.

[0038] Figure 2 This is a nucleic acid gel image of colony PCR. Lane M: 1kb plus DNA Marker; Lane 1: E. coli with the pfkA gene intact, producing an approximately 2200 bp band; Lane 2: E. coli with the target gene pfkA successfully replaced with a-E4, producing a 5800 bp band; Lane 3: E. coli with the pfkB gene intact, producing an approximately 2200 bp band; Lane 4: E. coli with the target gene pfkB successfully replaced with the a-E4 fragment, producing a 5800 bp band.

[0039] Figure 3 HPLC spectrum of D-mannitol standard.

[0040] Figure 4 The HPLC spectrum of the enzyme-catalyzed conversion of D-fructose to D-mannitol by the engineered bacteria M02 according to an exemplary embodiment of the present disclosure. DETAILED DESCRIPTION

[0041] definition

[0042] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0043] Throughout this specification and the appended claims, the words "comprise" and "include" and variations thereof should be interpreted inclusively. That is, these words are intended to convey that other elements or integers not specifically listed may be included, where the context permits.

[0044] The articles "a / an" are used herein to refer to one / a or more than one / more than a (i.e., one / an or at least one / at least one) grammatical object of the article. For example, "an element / an element" can mean one element / an element or more than one element / more than one element. When nouns (e.g., compounds, additives, etc.) are referred to in the singular, the plural is intended to be included. Thus, when referring to a particular part (e.g., "a gene"), this means "at least one" of the gene, e.g., "at least one gene," unless otherwise specified.

[0045] Unless explicitly indicated otherwise, the various embodiments of the invention described herein may be cross-combined.

[0046] The term "cell" refers to a eukaryotic or prokaryotic organism, preferably existing as a single cell. In the present invention, the cell can be a recombinant Escherichia coli. That is, the recombinant cell is selected from a cell population of the genus consisting of Escherichia coli.

[0047] As used herein, the term "transgenic" (e.g., with reference to "transgenic E. coli" and / or "transgenic cells") refers to E. coli and / or cells, respectively, that contain a nucleic acid that is not naturally present in the E. coli and / or cells and that has been introduced into the E. coli and / or cells using, for example, recombinant DNA techniques, such as recombinant yeast and / or cells.

[0048] As used herein, the term "gene" refers to a nucleic acid sequence that can be transcribed into mRNA and then translated into a protein. A gene encoding a protein refers to one or more nucleic acid sequences encoding the protein.

[0049] As used herein, the term "nucleic acid" or "nucleotide" refers to a monomeric unit in a deoxyribonucleotide or ribonucleotide polymer (i.e., a polynucleotide) in a single-stranded or double-stranded form, and unless otherwise limited, encompasses known analogs with the essential properties of natural nucleotides because they hybridize with single-stranded nucleic acids (e.g., peptide nucleic acids) in a manner similar to naturally occurring nucleotides. For example, an enzyme defined by a nucleotide sequence encoding an enzyme includes (unless otherwise limited) a nucleotide sequence that hybridizes with a reference nucleotide sequence encoding the enzyme. A polynucleotide can be the full length or subsequence of a natural or heterologous structure or regulatory gene. Unless otherwise indicated, the term includes reference to a specified sequence and its complementary sequence. Therefore, a DNA or RNA with a modified backbone for stability or other reasons is a term "polynucleotide" as intended herein. In addition, a DNA or RNA comprising rare bases (such as inosine) or modified bases (such as tritylated bases) (to give only two examples) is a term polynucleotide as used herein. It will be understood that a variety of modifications have been made to DNA and RNA for many useful purposes known to those skilled in the art. The term polynucleotide as used herein includes such chemically, enzymatically, or metabolically modified forms of the polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells (especially including simple and complex cells).

[0050] The terms "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein. An example of a nucleic acid sequence is a DNA sequence.

[0051] The term "enzyme" refers to a protein with catalytic function in this article. In the case of a certain biological reaction of protein catalysis, the terms "protein" and "enzyme" can be used interchangeably in this article. When enzymes are mentioned with reference to enzymes (EC), enzymes are such classifications, wherein enzymes are classified or can be classified according to the enzyme nomenclature provided by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB), which can be found at http: / / www.chem.qmul.ac.uk / iubmb / enzyme / . It is intended to include other suitable enzymes that have not yet (yet) been classified in a given category but can be so classified.

[0052] If a protein or nucleic acid sequence (such as a gene) is referred to herein by reference to an accession number, unless otherwise specified, that number is specifically used to refer to the protein or nucleic acid sequence (gene) having the sequence that can be found via www.ncbi.nlm.nih.gov / (available as of October 1, 2020).

[0053] As used herein, the term "functional homolog" (or simply "homolog") of a polypeptide and / or amino acid sequence or a gene having a specific sequence (e.g., "SEQ ID NO: X") refers to a polypeptide and / or amino acid sequence comprising the specific sequence, or refers to a nucleic acid sequence comprising a polypeptide and / or amino acid sequence encoding the specific sequence, provided that one or more amino acids are mutated, substituted, deleted, added and / or inserted, and the polypeptide has (qualitatively) the same enzymatic function for substrate conversion.

[0054] As used herein, the term "functional homolog" (or simply "homolog") of a polynucleotide and / or nucleic acid sequence having a specific sequence (e.g., "SEQ ID NO: X") refers to a polynucleotide and / or nucleic acid sequence comprising the specific sequence, provided that one or more nucleic acids are mutated, substituted, deleted, added, and / or inserted, and that the polynucleotide encodes a polypeptide sequence having (qualitatively) the same enzymatic function for substrate conversion. With respect to nucleic acid sequences, the term functional homolog is intended to include nucleic acid sequences that differ from another nucleic acid sequence due to the degeneracy of the genetic code and that encode the same polypeptide sequence.

[0055] Variants of the nucleotide or amino acid sequences disclosed herein may also be defined as nucleotide or amino acid sequences having one or more mutations, substitutions, insertions and / or deletions compared to the nucleotide or amino acid sequences specifically disclosed herein (e.g., in the sequence listing).

[0056] The nucleotide sequences of the present invention can also be defined by their ability to hybridize to portions of the specific nucleotide sequences disclosed herein, respectively, under moderate hybridization conditions or, preferably, under stringent hybridization conditions. Stringent hybridization conditions are defined herein as conditions that allow a nucleic acid sequence of at least about 25 nucleotides, preferably about 50, 75, or 100 nucleotides, most preferably about 200 or more nucleotides to hybridize at a temperature of about 65° C. in a solution comprising about 1M salt (preferably 6xSSC or any other solution with comparable ionic strength), and washed at 65° C. in a solution comprising about 0.1M or less salt (preferably 0.2x SSC or any other solution with comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with about 90% or higher sequence identity. Moderate conditions are defined herein as conditions that allow a nucleic acid sequence of at least 50 nucleotides, preferably about 200 or more nucleotides, to hybridize at a temperature of about 45° C. in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength) and washed at room temperature in a solution comprising about 1M salt (preferably 6x SSC or any other solution with a comparable ionic strength). Preferably, hybridization is performed overnight, i.e., for at least 10 hours; and preferably, washing is performed for at least one hour, with the washing solution being changed at least twice. These conditions will typically allow specific hybridization of sequences with up to 50% sequence identity. One skilled in the art will be able to modify these hybridization conditions to specifically identify sequences with identities varying between 50% and 90%.

[0057] "Expression" refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA), followed by translation into protein.

[0058] "Overexpression" refers to the expression of a gene (corresponding to a nucleic acid sequence) by a recombinant cell in excess of its expression in a corresponding wild-type cell. Such overexpression can be achieved, for example, by increasing the frequency of transcription of one or more nucleic acid sequences, for example by operably linking the nucleic acid sequence to a promoter functional in the recombinant cell; and / or by increasing the copy number of a nucleic acid sequence.

[0059] The terms "upregulate," "enhance," and variations thereof refer to a process by which a cell increases the amount of a cellular component, such as RNA or protein. Such upregulation can be in response to or caused by a genetic modification.

[0060] The term "pathway" or "metabolic pathway" is understood herein as a series of chemical reactions that build and break down molecules in a cell.

[0061] "Native," "homologous," or "endogenous" with respect to a host cell means that the nucleic acid sequence does exist naturally in the genome of the host cell, or that the protein is naturally produced by the cell. The terms "native," "homologous," and "endogenous" are used interchangeably herein.

[0062] As used herein, "heterologous" or "exogenous" can refer to nucleic acid sequences or proteins. For example, with respect to host cells, "heterologous" can refer to polynucleotides that are not naturally present in the genome of the host cell in this way, or polypeptides or proteins that are not naturally produced by the cell in this way. A heterologous nucleic acid sequence is a nucleic acid derived from an alien species, or if from the same species, it is substantially modified in composition and / or genomic locus relative to its native form by deliberate human intervention. For example, a promoter operably linked to a natural structural gene is from a species different from the species from which the structural gene was derived, or if from the same species, one or both are substantially modified relative to their original form. A heterologous protein can be derived from an alien species, or if from the same species, it is substantially modified relative to its original form by deliberate human intervention. In other words, heterologous protein expression relates to the expression of a protein that is not naturally expressed in this way in a host cell. The term "heterologous expression" refers to the expression of heterologous nucleic acids in a host cell. The expression of heterologous proteins in eukaryotic host cell systems (such as Escherichia coli) is well known to those skilled in the art. Polynucleotides containing nucleic acid sequences encoding genes for proteins or enzymes having specific activities can be expressed in such eukaryotic systems. In some embodiments, transformed / transfected cells can be used as expression systems for expressing enzymes. The expression of heterologous proteins in E. coli is well known. Published by Cold Spring Harbor Laboratory, is a recognized work describing various methods for expressing proteins in E. coli.

[0063] As used herein, a "promoter" is a DNA sequence that directs the transcription of a (structural) gene or other (partial) nucleic acid sequence. Suitably, the promoter is located in the 5' region of the gene, near the transcription start site of the (structural) gene. The promoter sequence can be constitutive, inducible or repressible. In one embodiment, no (external) inducer is required.

[0064] "Plasmid" refers to autonomously replicating extrachromosomal DNA that is not integrated into the genome of a microorganism and is typically circular in nature.

[0065] "Host cell" is understood herein to be a cell (such as an E. coli cell) that is transformed with one or more nucleic acid sequences encoding one or more heterologous proteins to create a transformed cell (also referred to as a recombinant cell). For example, a transformed cell can contain a vector and can support replication and / or expression of the vector.

[0066] As used herein, "conversion" refers to that exogenous polynucleotides are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome. As used herein, "conversion" refers to that exogenous polynucleotides (i.e., exogenous nucleic acid sequence) are inserted into a host cell, without considering the method for insertion, such as direct uptake, transduction, f-engagement or electroporation. Exogenous polynucleotides can be maintained as a non-integrated vector (e.g., plasmid), or alternatively can be integrated into the host cell genome.

[0067] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0068] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0069] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, and instruments used in the following examples are all commercially available unless otherwise specified.

[0070] Unless otherwise specified herein, the nouns and terms used herein should be understood in accordance with the common knowledge and usage of persons of ordinary skill in the art. Unless otherwise noted, the specific operating methods employed in this application (including preparation processes, experimental procedures, detection methods, etc.) employ conventional biochemical experiments, cell biology experiments, molecular biology experiments, gene editing (e.g., recombinant DNA technology), zoology experiments, and related techniques in the art. These techniques are well described in the existing literature, see Sam Brook et al., Molecular Cloning: a Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, 2012; Ausubel et al., Current Protocols in Molecular Biology, Wiley Online Publishing, updated from time to time; Kursad Turksen et al., Embryonic Stem Cell Protocols, 3rd edition, Springer, 2016; P. Nagarajan et al., Essentials of Laboratory Animal Science: Principles and Practices, Springer, 2021; and Jann Hau et al., Handbook of Laboratory Animal Science: Essential Principles and Practices, 4th edition, CRC Press, 2021.

[0071] The quantitative tests in the following examples were all repeated three times, and the results were averaged. In the following examples, for the chromatograms under the same conditions and parameters, the peak in the test sample with the same retention time (±0.1 min) as the standard can be identified as the target peak.

[0072] The starting E. coli in the following examples can be E. coli BW25113, E. coli MG1655, E. coli BL21(DE3), or E. coli MC02. E. coli BW25113 (CGSC#: 7636), E. coli MG1655 (CGSC#: 6300), and E. coli BL21(DE3) (CGSC#12504) were purchased from the Yale University E. coli Genetic Collection (CGSC). E. coli MC02 is deposited with the China General Microbiological Culture Collection (CGMCC) (deposit number: CGMCC No. 34378). This biological material was used only for repetition of experiments related to the present invention and is not intended for use for other purposes.

[0073] Plasmid pBAD / HisB was purchased from Invitrogen, product catalog number: V430-01.

[0074] The primer sequences in the following examples are as follows:

[0075] Table 1 shows the primer sequences

[0076] Table 1 shows the primer sequences

[0077] Primer Name Sequence (5’-3’) pBAD-F gaattcgaagcttggctgttttggc pBAD-R ctcgagctcggatccttatcgtc TNMDH-F gataaggatccgagctcgagATGTTGATTAAAAGCGAATATAAGCCCCGGATG TNMDH-R TCGCCATTGGTATATCTCCTTTAAGACGGTGTTTTGACGGCTGC AAFDH-F CCGTCAAAACACCGTCTTAAAGGAGATATACCAATGGCGAAGGTTCTGTGCGTTC AAFDH-R aacagccaagcttcgaattcCTAACCCGCCTTCTTGAACTTCCCCG pBAD-cexu-F gcatttttatccataagattagcggatcctacc pBAD-cexu-R gttccctactctcgcatgggg pBAD-F1 tgcctggcggcagtagcgcg pBAD-R1 ggttaattcctcctgttagccc E4-F ggctaacaggaggaattaaccATGGGTACCTCTCATCATCATCATCATCAC E4-R cgcgctactgccgccaggcaTTAGCCGTTGTACGCACGCTC aE4-F ttatgacaacttgacggctacatcattcac aE4-R aaggcccagtctttcgactgag pfkA-up500-F tacgcatgggatatgaggcggtac pfkA-up500-R tagccgtcaagttgtcataagactacctctgaactttggaatgc pfkA-down500-F cagtcgaaagactgggcctttgatttcggaaaaaggcagattcctttacc pfkA-down500-R gtgactgacgaatcaccacgttatc pfkA-up600-F gttgtcctggtacggctggcatc pfkA-down6 ​ ​ ​ ​ taaaacCCGATAACCACCAGCGCGTCactagtattatacctaggactgagctagctg pTarget-cexu-F cctgatgcggtattttctccttacg pfkB-up500-F accaggtcatggtggtgtcag pfkB-up500-R tagccgtcaagttgtcataacatttcctcctataggctgatttcagtctg pfkB-down500-F cagtcgaaagactgggccttcaaaaacattcccccagcattg pfkB-down500-R acatgatgtctctcccatgttgtctg pfkB-up600-F ctgaagaacgctcatcattagaagaagtattac pfkB-down600-R aaatgccatgcggcatggac pTarget-pfkB-F actagtTCGTTTTGTTATGCCAGGCGgttttagagctagaaatagcaagttaaaataaggc pTarget-pfkB-R taaaacCGCCTGGCATAACAAAACGAactagtattatacctaggactgagctagctg

[0078] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 6-phosphofructokinase 1 (pfkA) is NP_418351.1 (09-MAR-2022), and the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948412 (02-May-2024).

[0079] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 6-phosphofructokinase 2 (pfkB) is NP_416237.3 (09-MAR-2022), and the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 946230 (02-May-2024).

[0080] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the nicotinamide ribokinase (NRK) gene is XP_022677335.1 (04-DEC-2024), and the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 34717478 (06-DEC-2024).

[0081] In the present invention, the nicotinamide mononucleotide adenylyltransferase (NMNAT) gene has a GenBank address of AAB84656.1 (30-JAN-2014).

[0082] In the present invention, the NCBI reference sequence number of the polyphosphate kinase (PPK2) gene is (NCBI Reference Sequence) WP_010886780.1 (31-DEC-2024), and the NCBI reference sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 69516362 (31-Mar-2024).

[0083] In the present invention, the NCBI reference sequence number of the pyrophosphohydrolase (IPPa) gene is (NCBI Reference Sequence) WP_010870112.1 (31-MAY-2019), and the NCBI reference sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 1451473 (22-Oct-2024).

[0084] Unless otherwise specified, all replacements in the examples are considered replacements.

[0085] Example 1. Construction of pBAD / HisB-TNMDH-AAFDH recombinant plasmid

[0086] (1) PCR amplification to obtain the vector backbone pBAD / HisB: Using the pBAD / HisB plasmid as a template, PCR amplification was performed with primers PBAD-F / PBAD-R to obtain a fragment of approximately 4080 bp. The purified PCR product was digested with DpnI methylase for approximately 3 h. The purified digestion product is the vector backbone pBAD / HisB, which can be used for subsequent plasmid construction.

[0087] (2) PCR amplification to obtain the gene fragment TNMDH: The amino acid sequence of D-mannitol dehydrogenase from Thermotoganea politana was downloaded from NCBI (GenBank: AAA25463.1). The optimized nucleotide sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd. and constructed on the vector pUC57. Using the recombinant plasmid pUC57 / TNMDH as a template, PCR amplification was performed with primers TMNDH-F and TMNDH-R, and a fragment of approximately 1750 bp was amplified (the nucleotide sequence is patent sequence 3).

[0088] (3) PCR amplification of the AAFDH gene fragment: The amino acid sequence of formate dehydrogenase from Ancylobacter aquaticus (GenBank: BAC65346.1) was downloaded from NCBI. The optimized nucleotide sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd. and constructed on the vector pUC57. Using the recombinant plasmid pUC57 / AADH as a template, PCR amplification was performed with primers AAFDH-F and AAFDH-R, resulting in a fragment of approximately 1200 bp (nucleotide sequence is patent sequence 5).

[0089] (4) Gibson assembly: The gene fragments TNMDH and AAFDH were inserted into pBAD / HisB using the Gibson assembly method. The obtained products were directly transformed into E. coli DH5α competent cells using the chemical transformation method. The positive clones were screened by colony PCR using primers pBAD-cexu-F and pBAD-cexu-R on LB plates containing ampicillin (ampicillin concentration was 100 μg / mL). The pBAD-cexu-F and pBAD-cexu-R were sequenced and verified using primers. The recombinant plasmid with correct sequencing was pBAD / HisB-TNMDH-AAFDH, and its map is shown below. Figure 1 shown.

[0090] Example 2: Construction of recombinant Escherichia coli M02

[0091] This example prepared a method for growing bacteria using glycerol as a carbon source without adding NAD. + The basic bacteria M04 that converts D-fructose into D-mannitol by adding nicotinamide riboside is prepared as follows. The primers used in the preparation process are shown in Table 1.

[0092] 1. Construction of strain M01

[0093] 1) Preparation of NRK-NMNAT-PPK2-IPPa gene fragment

[0094] The nicotinamide ribokinase (NRK), nicotinamide mononucleotide adenylyltransferase (NMNAT), polyphosphate kinase (PPK2), and pyrophosphohydrolase (IPPa) genes were artificially synthesized. Restricted bases (RBSs) were designed between adjacent genes, resulting in a fragment E4 containing the NRK, RBS, NMNAT, RBS, PPK2, RBS, and IPPa sequences in that order. The nucleotide sequence of the entire E4 sequence is positions 1224-4373 of SEQ ID NO: 1. The entire sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0095] In sequence 1, positions 1224-2003 are NRK, positions 2018-2560 are NMNAT, positions 2575-3435 are PPK2, and positions 3450-4373 are IPPa.

[0096] PCR amplification of fragment E4, represented by positions 1224-4373 of SEQ ID NO: 1, was performed using primer pair E4-F / E4-R. The resulting amplified product, E4, was then amplified using primer pair pBAD-F1 / pBAD-R1 and the commercial plasmid pBAD / HisB (Invitrogen, catalog number: V430-01), to obtain the vector fragment pBAD. E4 was then assembled onto pBAD using the Gibson assembly method and verified by sequencing, resulting in the pBAD-E4 plasmid.

[0097] 2) Preparation of targeting fragments integrating into the pfkA site

[0098] PCR amplification was performed using primer pair aE4-F / aE4-R and pBAD-E4 plasmid as a template to obtain a target band of approximately 4600 bp and recover fragment aE4. Fragment aE4 is the E4 gene cluster under the regulation of the araBAD promoter and TrrnB terminator (sequence 1 is its nucleotide sequence, in which the araC arabinose operator is at positions 1-879, the araBAD promoter is at positions 906-1190, and the TrrnB terminator is at positions 4374-4531).

[0099] PCR amplification was performed using primer pairs pfkA-up500-F / pfkA-up500-R and pfkA-down500-F / pfkA-down500-R, yielding fragments of approximately 500 bp and 500 bp, respectively. Using a mixture of these two fragments and the aE4 fragment as template, overlap PCR amplification was performed using primer pairs pfkA-up500-F and pfkA-down500-R. The resulting target fragment, K1-aE4, was approximately 5600 bp in size. This fragment contains the pfkA gene upstream homology arm, the araC arabinose operator, the araBAD promoter, the E4 sequence, the TrrnB terminator, and the pfkA gene downstream homology arm.

[0100] 3) Construction of the pTarget plasmid: Use the website https: / / crispy.secondarymetabolites.org to select the knockout site N20 and design primers to construct the pTarget plasmid. Using pTargetF as a template, PCR amplification was performed with primers pTarget-pfkA-F and pTarget-pfkA-R, yielding a fragment of approximately 2100 bp. After digestion with DpnI methylase for approximately 3 hours, the plasmid was directly transformed into competent E. coli DH5α cells using chemical transformation. Positive clones were screened on LB plates containing streptomycin (50 μg / mL) and verified by sequencing using primer pTarget-cexu-F. If sequencing was correct, the clone was designated pTarget-pfkA.

[0101] 4) Preparation of electrocompetent cells: The pCas plasmid (Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S: Multigene editing in the Escherichia cooligenome via the CRISPRCas9 system. Appl Environ Microbiol 2015, 81: 2506-2514.) was chemically transformed into Escherichia coli MC02. Positive clones were screened by culturing on LB plates containing kanamycin (kanamycin concentration: 50 μg / ml) at 30°C. Positive clones were inoculated into LB liquid medium containing 2 g / L arabinose and cultured at 30°C to an OD600 of approximately 0.6. Electrocompetent cells were then prepared.

[0102] 5) Electroporation: Mix 400ng of pTarget-pfkA plasmid, 800ng of the targeting fragment K1-aE4, and 100μl of the electroporation competent cells prepared in step 4. Place the cells in a 2mm electroporation cuvette and electroporate at 2.55kV. Add 1ml of LB liquid medium and let them recover at 30°C. Then spread the cells on LB plates containing kanamycin and streptomycin (kanamycin concentration is 50ug / ml, streptomycin concentration is 50μg / ml) and incubate at 30°C. The primer pair pfkA-up600-F and pfkA-down600-R are designed for gene sequences other than the homology arms. Positive transformants were screened by colony PCR. Colony PCR results are shown in the table. Figure 2 A. By Figure 2 As shown in A, lane 1 shows a 2200 bp band obtained from E. coli without the pfkA gene knockout, while lane 2 shows a 5800 bp band obtained from E. coli with the target gene pfkA successfully knocked out and replaced with aE4. PCR results were sent to Suzhou GeneWeizhi Biotechnology Co., Ltd. for sequencing.

[0103] 6) Eliminate the pTarget plasmid: Positive clones verified by sequencing were inoculated into LB liquid medium containing 0.1 mM IPTG and kanamycin and cultured overnight at 30°C to eliminate the pTarget plasmid. Streak the overnight culture onto solid LB plates containing kanamycin and cultured overnight at 30°C to obtain the E. coli mutant MC02ΔpfkA::aE4 containing the pCas plasmid.

[0104] 7) Elimination of the pCas plasmid: Sequencing-verified E. coli mutant MC02ΔpfkA::aE4 containing the pCas plasmid was inoculated into LB liquid medium and cultured overnight at 42°C to eliminate the pCas plasmid. Streak the overnight culture onto solid LB plates and incubate at 42°C overnight to obtain the E. coli mutant MC02ΔpfkA::aE4.

[0105] The recombinant plasmid pBAD / HisB-TNMDH-AAFDH was introduced into the host strain MC02△pfkA:: aE4 to obtain strain M01.

[0106] 2. Construction of strain M02

[0107] Recombinant strain M02 was created by replacing both the pfkA and pfkB genes in the Escherichia coli MC02 genome with the aE4 fragment shown in SEQ ID NO: 1. This fragment contains the araC arabinose operator, the araBAD promoter, the E4 sequence, and the TrrnB terminator, resulting in the mutant strain MC02ΔpfkA::aE4ΔpfkB::aE4. Simultaneously, a recombinant plasmid containing the D-mannitol dehydrogenase (MDH) and formate dehydrogenase (FDH) genes (i.e., the aforementioned recombinant plasmid pBAD / HisB-TNMDH-AAFDH) was introduced into this strain, resulting in recombinant strain M02.

[0108] 1) The preparation method of recombinant strain M02 is basically the same as the preparation method of recombinant strain M01 in 1 above, except that the MC02 electroporation competent cells are replaced with MC02ΔpfkA::aE4 electroporation competent cells. The recombinant plasmid pBAD / HisB-TNMDH-AAFDH is introduced into the host strain MC02ΔpfkA::aE4ΔpfkB::aE4.

[0109] 2) The targeting fragment K1-aE4 was replaced with K2-aE4. The targeting fragment K2-aE4 was constructed by PCR amplification using primer pairs pfkB-up500-F / pfkB-up500-R and pfkB-down500-F / pfkB-down500-R, respectively, to obtain fragments of approximately 500 bp and 500 bp, respectively. Using a mixture of these two fragments and the aE4 fragment as template, overlap PCR amplification was performed using primer pairs pfkB-up500-F and pfkB-down500-R. The resulting targeting fragment K2-aE4 was approximately 5600 bp in size. This fragment contains the pfkB gene upstream homology arm, the araC arabinose operator, the araBAD promoter, the E4 sequence, the TrrnB terminator, and the pfkB gene downstream homology arm.

[0110] 3) Construction of the pTarget plasmid: Using the website https: / / crispy.secondarymetabolites.org, select the knockout site N20 and design primers to construct the pTarget plasmid. Using pTargetF as a template, PCR amplification was performed with primers pTarget-pfkB-F and pTarget-pfkB-R, yielding a fragment of approximately 2100 bp. After digestion with DpnI methylase for approximately 3 hours, the plasmid was directly transformed into competent E. coli DH5α using chemical transformation. Positive clones were screened on LB plates containing streptomycin (50 μg / mL) and verified by sequencing using primer pTarget-cexu-F. After sequencing, the clone was designated pTarget-pfkB.

[0111] The primer pair pfkB-up600-F and pfkB-down600-R were introduced for positive clone screening and colony PCR verification was performed. The results of colony PCR are shown in Figure 2 B. By Figure 2 As can be seen in lane B, lane 3 shows a 2200 bp band obtained from E. coli strains in which the pfkB gene had not been deleted, while lane 4 shows a 5800 bp band obtained from E. coli strains in which the target gene pfkB had been successfully replaced with aE4. PCR results were sent to Suzhou GeneWeizhi Biotechnology Co., Ltd. for sequencing. If sequencing was successful, the pTarget plasmid and pCas plasmid were eliminated sequentially to obtain the E. coli mutant MC02ΔpfkA::aE4ΔpfkB::aE4.

[0112] The recombinant plasmid pBAD / HisB-TNMDH-AAFDH was introduced into the host bacteria MC02△pfkA:: aE4△pfkB::aE4 to obtain strain M02.

[0113] Example 3: Production of D-mannitol by recombinant Escherichia coli M01 to M02 using D-fructose and nicotinamide riboside as substrates Applications

[0114] This example uses the NAD prepared in Example 2 + The recombinant engineered bacteria that synthesize the gene cluster and can co-express MDH and FDH catalyze the synthesis of D-mannitol from D-fructose.

[0115] 1. Bacterial culture and enzyme induction

[0116] The recombinant bacteria M02 and strains MC02 and M01 cultured overnight were inoculated at a 1% inoculum into a shake flask containing 200 ml of LB liquid medium. After incubation at 37°C until the OD600nm reached 2, arabinose at a final concentration of 0.2 g / L was added and cultured at 37°C for 12 h. The bacterial pellet was collected by centrifugation at 8000g for 10 min. The bacterial cells were then resuspended (90 OD) in pH 7 phosphate buffer at a final concentration of 50 mM and ultrasonically disrupted to obtain a crude enzyme solution.

[0117] 2. Recombinant engineered bacteria catalyze the synthesis of D-mannitol from D-fructose

[0118] The reaction system consists of the crude enzyme solution (30 OD) obtained in step 1, 150 g / L D-fructose and 1 M formate buffer, 2 mM nicotinamide ribose NR, 2 mM adenosine monophosphate AMP solution, and 1 mM sodium hexaphosphate (NaPO3)6.

[0119] The components of the reaction system were placed in a 100 mL Erlenmeyer flask, adjusted to pH 6, and reacted at 37°C and 220 rpm. The reaction progressed using pH test paper and was adjusted with 0.1 M NaOH and HCl solutions to maintain the pH between 6.0 and 6.5. After 24 hours of reaction, the reaction product was centrifuged at 8000 g for 10 minutes. The supernatant was filtered through a 0.22 μm filter membrane and assayed for D-mannitol content by HPLC. HPLC was performed using a Hi-Plex Ca column (300 mm × 7.7 mm, 8 μm) with ultrapure water as the mobile phase at a flow rate of 0.5 mL / min. The column temperature was 78°C, and the detector was a differential refractive index detector at 40°C.

[0120] D-mannitol standard was purchased from Shanghai MacLean Biotechnology (Cat. No. M813424). The HLPC standard curve was prepared using the D-mannitol standard, and the equation for D-mannitol concentration was obtained ( Figure 3 is the HPLC result of the standard).

[0121] The conversion rate is the ratio of D-mannitol production to D-fructose consumption in step 2 of the enzyme catalysis stage*100%.

[0122] The results are shown in Table 2. The wild-type strain MC02 produced 0 D-mannitol, while the production and conversion rates of the engineered strains M01 and M02 gradually increased. The D-mannitol production of the engineered strain M02 reached 149±1.11 g / L, and the conversion rate reached 99.42±2.97%. This indicates that this scheme can achieve a high efficiency in the enzymatic synthesis of D-mannitol using D-fructose as a raw material. In addition, the purity of D-mannitol in the reaction supernatant of the engineered strain M02 was high. Using the same HPLC conditions, no other sugar alcohols ( Figure 4 ), which is beneficial to the subsequent separation and purification work.

[0123] Table 2 shows the D-mannitol production and conversion rate of each strain

[0124] strain D-mannitol yield (g / L) D-mannitol conversion rate (%) MC02 0 0 M01 105.12±1.63 70.08±0 .86 M02 149.02±1.11 g / L 99.34±2 .97%

Claims

1. A genetically modified Escherichia coli for synthesizing D-mannitol from D-fructose and nicotinamide riboside, comprising the following modifications: Insertion or enhanced expression of gene cluster 1, wherein The gene cluster 1 includes the D-mannitol dehydrogenase encoding gene MDH and the formate dehydrogenase encoding gene FDH; Deletion or suppressed expression of gene cluster 2, wherein the gene cluster 2 includes the 6-phosphofructokinase 1 encoding gene pfkA; and Insertion or enhanced expression of gene cluster 3, wherein the gene cluster 3 includes the nicotinamide ribokinase encoding gene NRK, the nicotinamide mononucleotide adenylyltransferase encoding gene NMNAT, the polyphosphate kinase encoding gene PPK2 and the pyrophosphohydrolase encoding gene IPPa.

2. The Escherichia coli according to claim 1, wherein Gene cluster 2 further includes the 6-phosphofructokinase 2 encoding gene pfkB.

3. The Escherichia coli according to any one of claims 1 to 4, wherein Gene cluster 3 is a multi-copy insertion.

4. The Escherichia coli according to claim 1, wherein The D-mannitol dehydrogenase encoding gene MDH is derived from Thermotoga neapolitana, and the formate dehydrogenase encoding gene FDH is derived from Ancylobacter aquaticus.

5. The Escherichia coli according to claim 1, wherein The sequence of the D-mannitol dehydrogenase encoding gene MDH is shown in SEQ ID No. 3, and the sequence of the formate dehydrogenase encoding gene FDH is shown in SEQ ID No.

5.

6. The Escherichia coli according to claim 1, wherein The sequences of the nicotinamide ribokinase encoding gene NRK, the nicotinamide mononucleotide adenylyltransferase encoding gene NMNAT, the polyphosphate kinase encoding gene PPK2, and the pyrophosphohydrolase encoding gene IPPa are shown in SEQ ID No. 1 at positions 1224-2003, 2018-2560, 2575-3435, and 3450-4373, respectively.

7. The Escherichia coli according to any one of claims 1 to 4, wherein The sequence of the gene encoding 6-phosphofructokinase 1, pfkA, is shown in SEQ ID No. 7; The sequence of the 6-phosphofructokinase 2 encoding gene pfkB is shown in SEQ ID No.

8.

8. Use of the Escherichia coli according to any one of claims 1 to 9 in the preparation of D-mannitol.

Images