Construction method of viral reproductive dysfunction model based on spermatogonial stem cells and application of model

By constructing a viral reproductive dysfunction model based on spermatogonial stem cells, the direct damage mechanism of BVDV on germ cells was revealed, the problem of insufficient model simulation in existing technologies was solved, the development of cross-species disease resistance strategies and the standardization of drug screening were realized, and the experimental costs were reduced.

CN120624342APending Publication Date: 2025-09-12NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510821551.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-18
Publication Date
2025-09-12

AI Technical Summary

Technical Problem

Existing technologies lack an in vitro model that can truly simulate the direct effects of bovine viral diarrhea virus (BVDV) on reproductive stem cells, resulting in the mechanism of reproductive dysfunction caused by BVDV not being elucidated, which limits the development of targeted prevention and control strategies.

Method used

A standardized BVDV infection model was constructed using immortalized bovine and goat spermatogonial stem cells. Through specific culture medium and infection conditions, a spermatogonial stem cell-based viral reproductive dysfunction model was established. Combined with Western blotting data and exosome-mediated virus-host interactions, the specific functional damage of germ cells was revealed.

Benefits of technology

It provides cross-species disease resistance strategy development tools, systematically integrates proliferation inhibition, stem cell function loss and ferroptosis molecular pathways, reveals the BVDV pathogenicity mechanism, supports standardized processes for virus strain typing and drug screening, reduces experimental costs and improves R&D efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624342A_ABST
    Figure CN120624342A_ABST
Patent Text Reader

Abstract

The invention provides a construction method of a viral reproductive dysfunction model based on spermatogonial stem cells and application of the model, and belongs to the cross technical field of biotechnology and veterinary medicine. The construction method comprises the following steps: placing spermatogonial stem cells in a spermatogonial stem cell culture medium for culture, and infecting the spermatogonial stem cells with bovine viral diarrhea viruses to obtain the viral reproductive function disorder model based on the spermatogonial stem cells. In order to solve the problems that in the prior art, a BVDV reproductive injury mechanism is unknown, and an effective research model is lacked, the reproductive stem cells are used for simulating direct injury of BVDV to a male reproductive system for the first time, and the defect that a traditional model (such as MDBK cells) cannot reflect specific biological reaction of reproductive cells is overcome; meanwhile, experiments show that the model constructed by the invention can support standardized processes of virus strain typing and drug screening, the research and development efficiency is remarkably improved, and the experiment cost is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the interdisciplinary field of biotechnology and veterinary medicine, and in particular to a method for constructing a spermatogonial stem cell-based viral reproductive dysfunction model and the application of the model. Background Art

[0002] Bovine viral diarrhea virus (BVDV) is a major pathogen in the global ruminant industry. Infection with BVDV can lead to immunosuppression, reproductive failure, and growth retardation. In male livestock, BVDV infection can cause testicular atrophy, spermatogenesis abnormalities, and long-term infertility. The virus can also be transmitted through semen, exacerbating its spread within the herd. However, due to the lack of in vitro models that accurately simulate the direct effects of the virus on germline stem cells, the molecular mechanisms by which BVDV impairs male reproductive function have long remained unelucidated, severely hindering the development of targeted prevention and control strategies.

[0003] Traditional research methods have significant limitations. On the one hand, in vivo animal experiments rely on pathological observations of infected live animals, which are costly, time-consuming, and unable to accurately analyze the mechanism of action of the virus on specific cell types (such as spermatogonial stem cells). On the other hand, although non-germline cell models (such as the widely used MDBK cell line) can support BVDV replication, their biological characteristics differ significantly from those of germline stem cells and cannot reflect the specific damage caused by the virus to key cells involved in spermatogenesis (such as spermatogonial stem cells). In addition, existing spermatogonial stem cell culture technologies are mostly limited to basic research. Ordinary culture systems have difficulty maintaining long-term cell proliferation and pluripotency, and have not been standardized for use in viral infection research, resulting in a serious disconnect between mechanistic research and intervention strategies. For example, the molecular pathways by which BVDV infection leads to reproductive dysfunction (such as proliferation inhibition and ferroptosis) have not yet been clearly defined. Existing research has mostly focused on the immune system or somatic cells, while ignoring the direct effects of the virus on germline stem cells.

[0004] Therefore, providing a model that can reveal the molecular mechanism of reproductive dysfunction caused by BVDV infection is very necessary for disease resistance research in animal husbandry. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for constructing a viral reproductive dysfunction model based on spermatogonial stem cells and the application of the model. The present invention is the first to use immortalized bovine and goat spermatogonial stem cells to construct a standardized BVDV infection model, filling the gap in the research on the mechanism at the reproductive stem cell level and providing key technical tools for the development of cross-species disease resistance strategies.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides a method for constructing a viral reproductive dysfunction model based on spermatogonial stem cells, comprising the following steps: The spermatogonial stem cells are cultured in a spermatogonial stem cell culture medium and infected with bovine viral diarrhea virus to obtain the spermatogonial stem cell-based viral reproductive dysfunction model.

[0007] Preferably, the spermatogonial stem cells are bovine spermatogonial stem cells or goat spermatogonial stem cells; The spermatogonial stem cell culture medium includes the following raw material components: 1× L-glutamine solution, 1× non-essential amino acid solution, glial cell line-derived neurotrophic factor, basic fibroblast growth factor, β-mercaptoethanol, fetal bovine serum, DMEM / F12.

[0008] Preferably, the mass volume concentration of the glial cell line-derived neurotrophic factor is 8-12 ng / ml, the mass volume concentration of the basic fibroblast growth factor is 8-12 ng / ml, the molar concentration of the β-mercaptoethanol is 0.08-0.12 mM, and the volume fraction of the fetal bovine serum is 8-12%.

[0009] More preferably, the 1×L-glutamine solution, 1×non-essential amino acid solution, glial cell line-derived neurotrophic factor, basic fibroblast growth factor, β-mercaptoethanol, fetal bovine serum 、 The volume ratio of DMEM / F12 is 8~12:8~12:1:1:1:100:870~880.

[0010] Preferably, the culture environment contains 5% CO2, the culture temperature is 37°C, and the culture method is to subculture at a ratio of 1:2-3 every 2-3 days.

[0011] Preferably, the multiplicity of infection of the bovine viral diarrhea virus is 1 or 2; the infection temperature is 37° C., and the infection time is 1 to 72 hours.

[0012] The present invention also provides a spermatogonial stem cell-based viral reproductive dysfunction model constructed and obtained by the construction method.

[0013] The present invention also provides the use of the viral reproductive dysfunction model based on spermatogonial stem cells in screening drugs against bovine viral diarrhea virus.

[0014] The present invention also provides a method for screening anti-bovine viral diarrhea virus drugs, comprising the following steps: After pre-treating the spermatogonial stem cell-based viral reproductive dysfunction model with the drug to be tested, a cytopathic bovine viral diarrhea virus strain is added and incubated for 20 to 25 hours. CCK8 detection is performed. If the cell survival rate is ≥75%, the anti-bovine viral diarrhea virus drug is obtained.

[0015] The present invention also provides the use of Ferrostatin-1 in preparing a drug for resisting bovine viral diarrhea virus.

[0016] The beneficial effects of the present invention compared with the prior art are: This study addresses the existing challenges of BVDV-induced reproductive system damage, which remain unclear and lack effective research models. By using germline stem cells for the first time, this study simulates direct BVDV-induced damage to the male reproductive system. The Western blotting data provided by this study (BVDV infection downregulates expression of PLZF, SOX2, OCT4, and LIN28A in spermatogonial stem cells (SSCs)) provides direct experimental evidence demonstrating that BVDV directly impairs specific germ cell functions. These proteins are core regulators of germ cell self-renewal, pluripotency, and normal function, and are completely absent in the traditional MDBK cell model. Combined with the fact that germ cells / embryos may rely on specific receptors such as CD46 (Snider et al. Fertility and early embryonic development in a CD46-edited Gir heifer with reduced susceptibility to BVDV†. Biol Reprod, 2025, 112(2):245-252.) and the existence of a unique exosome-mediated transmission mechanism in the placental trophoblast (Liang et al. Exosomes-mediated transmission of standard bovine viral diarrhea strain OregonC24Va in bovine trophoblastcells. J Reprod Immunol. 2024, 164:104254.), the specificity of virus-host interactions in the reproductive system has been revealed, which strongly supports the fundamental defects of traditional somatic cell models (such as MDBK) in terms of the lack of reproductive-specific molecules (PLZF, etc.) and the inability to simulate reproductive-specific mechanisms (specific receptor utilization, exosome transmission, etc.). Therefore, the present invention utilizes the SSCs model to successfully overcome the limitations of traditional models and provides an effective tool for studying the direct damage mechanism of BVDV on the male reproductive system for the first time.

[0017] The present invention systematically integrates the triple molecular pathways of proliferation inhibition, loss of stem cell function, and ferroptosis, revealing the molecular mechanism of viral pathogenicity and providing a multi-dimensional analytical framework for the BVDV pathogenicity mechanism. This viral reproductive dysfunction model is compatible with economic ruminants such as cattle and goats, breaking through the limitations of single-species research, and can support the development of disease resistance strategies widely used in animal husbandry, providing key technical tools for disease resistance research in animal husbandry. At the same time, the model constructed by the present invention can support the standardized process of virus strain typing and drug screening, significantly improving R&D efficiency and reducing experimental costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 Figure 2 is the replication efficiency curve of cytopathic (CP) and non-cytopathic (NCP) BVDV in bovine spermatogonial stem cells and goat spermatogonial stem cells; Figure 1 A in the figure is the replication efficiency curve of CP type BVDV strain (NADL), Figure 1 B in the figure is the replication efficiency curve of NCP type BVDV strain; among them, SSCs cattle Bovine spermatogonial stem cells, SSCs goat Goat spermatogonial stem cells; Figure 2 The effect of NADL infection on the protein levels of genes related to proliferation, function and ferroptosis markers in bovine and goat spermatogonial stem cells 24 hours after infection; Figure 2 A and Figure 2 B in the chart are the detection results of proliferation genes (EIF2S3Y, PCNA, CCND1), Figure 2 C and Figure 2 The D in the figure are the test results of spermatogonial stem cell functional genes (PLZF, SOX2, OCT4, LIN28A), Figure 2 E and Figure 2 The F in the figure represents the detection results of ferroptosis marker genes (SLC7A11, GPX4); Figure 3 Transmission electron microscopy images of bovine spermatogonial stem cells undergoing ferroptosis induced by NADL; Mock is the control group, M is mitochondria, ER is the endoplasmic reticulum, Ly is lysosome, and LD is lipid droplet; enlarge is the magnified field of view; Figure 4 This is a comparison of Giemsa staining of bovine spermatogonial stem cells and goat spermatogonial stem cells 24 hours after infection with CP and NCP BVDV; Figure 4 A in the figure is a comparison of Giemsa staining of bovine spermatogonial stem cells and goat spermatogonial stem cells 24 hours after infection with NADL strain; Figure 4 B is a comparison of Giemsa staining of bovine spermatogonial stem cells and goat spermatogonial stem cells 24 hours after NCP infection; Figure 5 The results of BVDV infection rate detection after CP and NCP BVDV infection of bovine spermatogonial stem cells for 24 hours; Figure 5 A in the figure is a representative image of immunofluorescence staining of BVDV E2 protein, and cells with green fluorescence indicate cells successfully infected with BVDV; Figure 5 Figure B shows the statistical results of BVDV infection rate using ImageJ; Figure 6 The results of ferrous ion level detection in bovine spermatogonial stem cells 24 hours after infection with CP and NCP BVDV; Figure 7 The results of CCK-8 cell viability test 24 hours after NADL infection of bovine spermatogonial stem cells. DETAILED DESCRIPTION

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0022] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0023] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0024] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0025] The present invention provides a method for constructing a viral reproductive dysfunction model based on spermatogonial stem cells, comprising the following steps: The spermatogonial stem cells are cultured in a spermatogonial stem cell culture medium and infected with bovine viral diarrhea virus to obtain the spermatogonial stem cell-based viral reproductive dysfunction model.

[0026] In the present invention, the spermatogonial stem cells are preferably bovine spermatogonial stem cells or goat spermatogonial stem cells; the spermatogonial stem cell culture medium preferably comprises the following raw material components: 1× L-glutamine solution, 1× non-essential amino acid solution, glial cell line-derived neurotrophic factor, basic fibroblast growth factor, β-mercaptoethanol, fetal bovine serum, and DMEM / F12; the mass volume concentration of the glial cell line-derived neurotrophic factor is preferably 8-12 ng / ml, more preferably 9-11 ng / ml, and even more preferably 10 ng / ml; the mass volume concentration of the basic fibroblast growth factor is preferably 8-12 ng / ml, more preferably 9-11 ng / ml, and even more preferably 10 ng / ml; the molar concentration of the β-mercaptoethanol is preferably 0.08-0.12 mM, more preferably 0.09-0.11 mM, and even more preferably 0.10 mM; the volume fraction of the fetal bovine serum is preferably 8-12%, more preferably 9-11%, and even more preferably 10%; L-glutamine solution, 1× non-essential amino acid solution, glial cell line-derived neurotrophic factor, basic fibroblast growth factor, β-mercaptoethanol, fetal bovine serum 、The volume ratio of DMEM / F12 is preferably 8~12:8~12:1:1:1:100:870~880, more preferably 9~11:9~11:1:1:1:100:874~878, and further preferably 10:10:1:1:1:1:100:877; the culture environment preferably contains 5% CO2; the culture temperature is preferably 37°C; the culture method is preferably passaging at a ratio of 1:2~3 every 2~3 days; the multiplicity of infection of the bovine viral diarrhea virus is preferably 1 or 2; the infection temperature is preferably 37°C; and the infection time is preferably 1~72 hours, which is adjusted according to the purpose of the experiment. If the replication efficiency of different strains needs to be studied, samples need to be collected at 1, 5, 12, 23, 48, and 72 hours after infection. If the pathogenic mechanism of the virus needs to be studied, such as detecting the expression of proliferation, pluripotency, and ferroptosis-related proteins, observing cell pathological morphology by Giemsa staining, etc., samples can be collected 24 hours after infection.

[0027] The present invention also provides a spermatogonial stem cell-based viral reproductive dysfunction model constructed and obtained by the construction method.

[0028] The present invention also provides the use of the viral reproductive dysfunction model based on spermatogonial stem cells in screening drugs against bovine viral diarrhea virus.

[0029] The present invention also provides a method for screening anti-bovine viral diarrhea virus drugs, comprising the following steps: After pre-treating the spermatogonial stem cell-based viral reproductive dysfunction model with the drug to be tested, a cytopathic bovine viral diarrhea virus strain is added and incubated for 20 to 25 hours. CCK8 detection is performed. If the cell survival rate is ≥75%, the anti-bovine viral diarrhea virus drug is obtained.

[0030] In the present invention, the pretreatment temperature is preferably 37°C; the pretreatment time is preferably 2-12 hours, more preferably 4-10 hours, and even more preferably 6 hours; the bovine viral diarrhea virus strain is preferably NADL (GenBank AJ133738.1); the incubation time is preferably 22-23 hours, and even more preferably 24 hours; after the CCK8 test, if the cell survival rate of the viral reproductive dysfunction model cells is <75%, it is not a bovine viral diarrhea virus drug.

[0031] The present invention also provides the use of Ferrostatin-1 in preparing a drug for resisting bovine viral diarrhea virus.

[0032] Example 1

[0033] A method for constructing a viral reproductive dysfunction model based on spermatogonial stem cells, comprising the following steps: Immortalized bovine spermatogonial stem cells (SSCs-cattle, preserved in this laboratory and recorded in the open document "LEI Q, PAN Q, MA J, et al. Establishment and characterization of immortalized bovine male germline stem cell line[J]. Journal of Integrative Agriculture, 2017, 16(11): 2547-2557.") were placed in spermatogonial stem cell culture medium, cultured in a 37°C, 5% CO2 incubator, passaged at a ratio of 1:3 every 3 days, infected with cytopathic (CP) bovine viral diarrhea virus strain NADL (GenBank: AJ133738.1, purchased from China Veterinary Drug Administration) at a multiplicity of infection (MOI) of 1 at 37°C for 1-72 hours, and maintained stem cell characteristics (PLZF (promyelocytic leukemia zinc finger protein) positive rate >95%, Lin28A positive rate >95%), to obtain the viral reproductive dysfunction model based on spermatogonial stem cells; The spermatogonial stem cell culture medium contains the following components: 500 μL 1× L-glutamine solution (purchased from Gibco Thermo Fisher Scientific, Catalog No. 35050061), 500 μL 1× non-essential amino acid solution (purchased from Gibco Thermo Fisher Scientific, Catalog No. 11140050), 50 μL of 10 ng / ml glial cell line-derived neurotrophic factor (GDNF, purchased from Millipore (Shanghai) Trading Co., Ltd., Catalog No. GF003AF), 50 μL of 10 ng / ml basic fibroblast growth factor (bFGF, purchased from Millipore, Catalog No. GF003AF), and 50 μL of 0.10 mM glutathione. β-Mercaptoethanol (purchased from Sigma, 60-24-2), 5 mL of 10% fetal bovine serum (purchased from Gibco Thermo Fisher Scientific, catalog number 10270-106), and 43.85 mL of DMEM / F12 (purchased from Corning Life Sciences, catalog number 10-092-CVRC).

[0034] Example 2

[0035] A method for constructing a viral reproductive dysfunction model based on spermatogonial stem cells, comprising the following steps: Goat spermatogonial stem cells (SSCs-goat, preserved in this laboratory and recorded in the open document "Haijing Z, Jing M, Rui D, et al. Characterization of immortalized dairy goat malegermline stem cells (mGSCs). [J]. Journal of cellular biochemistry, 2014, 115 (9): 1549-60.") were placed in spermatogonial stem cell culture medium, cultured in a 5% CO2 incubator at 37°C, passaged at a ratio of 1:3 every 3 days, and infected with cytopathic (CP) bovine viral diarrhea virus strain NADL (GenBank: AJ133738.1) at a multiplicity of infection (MOI) of 1 at 37°C for 1-72 hours, and maintained stem cell characteristics (PLZF (promyelocytic leukemia zinc finger protein) positive rate >95%, Lin28A positive rate >95%), thereby obtaining the viral reproductive dysfunction model based on spermatogonial stem cells; The spermatogonial stem cell culture medium contains the following components: 500 μL 1× L-glutamine solution, 500 μL 1× non-essential amino acid solution, 50 μL glial cell line-derived neurotrophic factor with a mass volume concentration of 10 ng / ml, 50 μL basic fibroblast growth factor with a mass volume concentration of 10 ng / ml, 50 μL 0.10 mM β-mercaptoethanol, 5 mL 10% fetal bovine serum, and 43.85 mL DMEM / F12.

[0036] Example 3

[0037] A method for constructing a viral reproductive dysfunction model based on spermatogonial stem cells, comprising the following steps: Immortalized bovine spermatogonial stem cells were placed in spermatogonial stem cell culture medium and cultured in a 37°C, 5% CO2 incubator. The cells were passaged at a ratio of 1:3 every 3 days and infected with a non-cytopathic (NCP) bovine viral diarrhea virus strain (GenBank: JQ799141.1, purchased from the China Veterinary Drug Administration) at a multiplicity of infection (MOI) of 1 at 37°C for 1-72 hours. The stem cell characteristics (PLZF (promyelocytic leukemia zinc finger protein) positive rate >95%, Lin28A positive rate >95%) were maintained to obtain the spermatogonial stem cell-based viral reproductive dysfunction model. The spermatogonial stem cell culture medium contains the following components: 500 μL of 1× L-alanyl-L-glutamine solution, 500 μL of 1× non-essential amino acid solution, 50 μL of 10 ng / ml glial cell line-derived neurotrophic factor, 50 μL of 10 ng / ml basic fibroblast growth factor, 50 μL of 0.10 mM β-mercaptoethanol, 5 mL of 10% fetal bovine serum, and 43.85 mL of DMEM / F12.

[0038] Example 4

[0039] A method for screening anti-bovine viral diarrhea virus drugs, comprising the following steps: The spermatogonial stem cell-based viral reproductive dysfunction model prepared in Example 1 was placed in a 96-well plate at 37°C, and 1.0×10 3 When the cells grew to 80% density after iron walling, they were pretreated with 2µM Ferrostatin-1 (purchased from MedChemExpress (MCE), Catalog No. HY-100579) at 37°C for 6.0h. The cells were then infected with the cytopathic (CP) bovine viral diarrhea virus strain NADL (GenBank: AJ133738.1) at an MOI of 1. After 1h of virus adsorption, the spermatogonial stem cell culture medium was replaced with 2µM Ferrostatin-1. The cells were incubated for 24h and the cell activity was detected using a CCK8 detection kit (purchased from Beyotime Biotechnology Co., Ltd., Catalog No. C0037). If the cell viability of the viral reproductive dysfunction model cells is ≥75%, the drug is considered to be resistant to bovine viral diarrhea virus; otherwise, it is not a drug for bovine viral diarrhea virus.

[0040] Example 5

[0041] A method for screening anti-bovine viral diarrhea virus drugs, comprising the following steps: At 37°C, the spermatogonial stem cell-based viral reproductive dysfunction model prepared in Example 1 was placed in a 96-well plate, and 1.0×10 3When the cells grow to 80% density after iron walling, they are pretreated with 2µM Ferrostatin-1 at 37°C for 12 hours, and then infected with the cytopathic (CP) bovine viral diarrhea virus strain NADL (GenBank: AJ133738.1) at an MOI of 1. After 1 hour of virus adsorption, the spermatogonial stem cell culture medium supplemented with 2µM Ferrostatin-1 is replaced and incubated for 20 hours. The cell activity is detected using a CCK8 kit. If the cell survival rate of the viral reproductive dysfunction model cells is ≥75%, it is an anti-bovine viral diarrhea virus drug. Otherwise, it is not a bovine viral diarrhea virus drug.

[0042] Example 6

[0043] A method for screening anti-bovine viral diarrhea virus drugs, comprising the following steps: At 37°C, the spermatogonial stem cell-based viral reproductive dysfunction model prepared in Example 1 was placed in a 96-well plate, and 1.0×10 3 When the cells grow to 80% density after iron walling, they are pretreated with 2µM Ferrostatin-1 at 37°C for 2.0h, and then infected with non-cytopathic (NCP) bovine viral diarrhea virus strain (GenBank: JQ799141.1) at an MOI of 1. After virus adsorption for 1h, the spermatogonial stem cell culture medium supplemented with 2µM Ferrostatin-1 is replaced and incubated for 25h. The cell activity is detected using a CCK8 kit. If the cell survival rate of the viral reproductive dysfunction model cells is ≥75%, it is an anti-bovine viral diarrhea virus drug. Otherwise, it is not a bovine viral diarrhea virus drug.

[0044] Test Example 1 Viral Load Detection The viral reproductive dysfunction model was constructed according to the method described in Example 1 and Example 3, and total RNA was extracted from cells at 1, 6, 12, 24, 48, and 72 hours after infection, and the viral copy number was detected by RT-qPCR. Figure 1 shown.

[0045] The primers used in the RT-qPCR detection were: 5'-UTR-F: ATGCCCTTAGTAGGACTAGCA (SEQ ID No. 1), 5'-UTR-R: TCAACTCCATGTGCCATGTAC (SEQ ID No. 2).

[0046] The results showed that 24 hours after infection, the copy number of CP-type NADL in SSCs-cattle reached 4.5×10 4copies / mL; the copy number of CP-type NADL in SSCs-goat is 2.5×10 4 copies / mL; the copy number of NCP-type bovine viral diarrhea virus strain in SSCs-cattle reached 2.3×10 4 copies / mL, and the copy number of NCP-type bovine viral diarrhea virus strain in SSCs-goat was 1.0×10 3 copies / mL.

[0047] The culture medium used in the following experiments was the spermatogonial stem cell culture medium in Example 1.

[0048] Experimental Example 2 Study on the Pathogenic Mechanism of Bovine Viral Diarrhea Virus 2.1 Western blotting SSCs-cattle and SSCs-goat were plated in 6-well plates, with 1.2×10 5 When the cells grew to 80% density after attachment, CP type BVDV strain NADL (GenBank AJ133738.1) was used to infect SSCs-cattle and SSCs-goat at an MOI of 1. After virus adsorption for 1 hour, the spermatogonial stem cell culture medium described in Example 1 was replaced.

[0049] Cell samples were collected 1, 6, 12, and 24 hours after NADL infection, centrifuged at 1000 rpm for 5 minutes, and lysed on ice for 30 minutes using RIPA cell lysis buffer (purchased from Beyotime, catalog number P0013B). The protein concentration was detected using a BCA kit (purchased from Beyotime, catalog number P0009), followed by SDS-PAGE electrophoresis. The cells were transferred to a PVDF membrane and stained with EIF2S3Y (purchased from Abcam (Shanghai) Trading Co., Ltd., catalog number ab32157), CCND1 (purchased from Abmart Pharmaceutical Technology (Shanghai) Co., Ltd., catalog number T55404), and PCNA (purchased from Bo The expression of PLZF (purchased from Wuhan Boster Biotechnology Co., Ltd., catalog number A00125), PLZF (purchased from eBioscience Thermo Fisher Scientific, catalog number PA5-29213), SOX2 (purchased from Bioss Beijing Bio-Aosin Biotechnology Co., Ltd., catalog number bs-0523R), OCT4 (purchased from Abclonal Aiboteike Bio, catalog number A25288), LIN28A (purchased from Abclonal, catalog number A21261), SLC7A11 (purchased from Abclonal, catalog number A13685), and GPX4 (purchased from Abclonal, catalog number A11243) were detected by specific antibodies. The results are as follows Figure 2 shown.

[0050] The results showed that 24 hours after NADL infection, the protein expression of proliferation-related genes (EIF2S3Y, CCND1, PCNA) in SSCs-cattle and SSCs-goat decreased by more than 50%, while the protein expression of spermatogonial stem cell function-related genes (PLZF, SOX2, OCT4, LIN28A) and ferroptosis marker genes (SLC7A11, GPX4) were close to zero, resulting in impaired self-renewal ability of SSCs.

[0051] 2.2 Transmission electron microscopy SSCs-cattle were plated in 60 mm dishes, with 2.1×10 6 When the cells adhered to the wall and grew to a density of 80%, NADL was taken to infect SSCs-cattle at an MOI of 1. After the virus was adsorbed for 1 hour, the spermatogonial stem cell culture medium was replaced.

[0052] 24 hours after infection, adherent cells were first digested with 0.25% trypsin (purchased from Beyotime, product number C0201), and spermatogonial stem cell culture medium was added to terminate digestion. The cells were centrifuged at 1000×g for 5 minutes, the supernatant was discarded, and the cells were gently washed twice with pre-cooled PBS. The cell pellet was then resuspended with 2.5% glutaraldehyde (pre-cooled at 4°C), and primary fixed at 4°C for more than 2 hours. After rinsing with PBS three times, the cells were fixed with 1% osmium acid (OsO4) at 4°C in the dark for 1 hour. The cells were dehydrated with gradient ethanol (50%, 70%, 90%, 100%) for 15 minutes each, impregnated with epoxy resin and embedded, and polymerized at 60°C for 48 hours. 70 nm sections were cut with an ultrathin microtome, and double-stained with uranyl acetate and lead citrate for 15 minutes each. The cells were observed and images were collected using a transmission electron microscope. The results are shown in Figure 2. Figure 3 shown.

[0053] The results showed that 24 hours after NADL infection, SSCs-cattle showed shrinkage of mitochondria (M), rupture of mitochondrial membrane accompanied by increased membrane density, reduction or even disappearance of cristae, expansion of endoplasmic reticulum (ER), increase of autophagic lysosomes (Ly), and increase of lipid droplets (LD).

[0054] Experimental Example 3 Virus strain typing and pathogenicity difference analysis 3.1 Cytopathic Effect Detection SSCs-cattle and SSCs-goat were plated in 24-well plates, with 1.0×10 5 When the cells adhered to the wall and grew to a density of 80%, CP-type BVDV strains NADL and NCP-type strains were used to infect SSCs-cattle and SSCs-goat at an MOI of 1. After virus adsorption for 1 hour, the spermatogonial stem cell culture medium was replaced.

[0055] After 24 hours, the culture medium was discarded, and each well was gently washed twice with pre-cooled PBS (1 mL each time, and allowed to stand for 1 minute), and the liquid was aspirated; 4% paraformaldehyde or methanol (1 mL / well) was added for fixation at room temperature for 15 minutes, the fixative was discarded, and the wells were washed three times with PBS; diluted Giemsa working solution (purchased from Beyotime, item number C0131) was added to each well (stock solution: PBS = 1:10, 0.5 mL / well), and the wells were stained at room temperature in the dark for 15 minutes; the staining solution was discarded, and the wells were gently rinsed with PBS or distilled water until the background was clear, and the wells were inverted on absorbent paper to absorb the residual liquid. After drying at room temperature, the wells were observed under a microscope. The results are as follows Figure 4 shown.

[0056] The results showed that 24 hours after NADL infection, the morphology of SSCs-cattle and SSCs-goat cells underwent obvious changes, including cytoplasmic shrinkage, while there was no obvious change in the cells 24 hours after NCP infection.

[0057] 3.2 BVDV infection rate detection SSCs-cattle were plated in 96-well plates, with 1.0×10 3 When the cells adhered to the wall and grew to a density of 80%, CP-type BVDV strains NADL and NCP-type strains were used to infect SSCs-cattle at an MOI of 1. After the virus was adsorbed for 1 hour, the spermatogonial stem cell culture medium was replaced.

[0058] 24 hours after infection, cells were fixed with 4% paraformaldehyde and incubated overnight at 4°C with an antibody against BVDV capsid protein E2 (purchased from Vmrd, American Veterinary Medical Research and Development Company, catalog number D89). Then, cells were incubated with FITC-labeled goat anti-mouse IgG (purchased from Beyotime, catalog number A0568) at room temperature in the dark for 1 hour. Images were captured under a fluorescence microscope, and the BVDV infection rate was analyzed using ImageJ. The infection rate was calculated as follows: infection rate = number of cells positive for E2 immunofluorescence staining / total number of cells × 100%. The results are shown in Figure 2. Figure 5 shown.

[0059] The results showed that the CP infection rate was 20% and the NCP infection rate was 15%.

[0060] 3.3 Ferrous ion level detection SSCs-cattle were plated in 6-well plates, with 1.2×10 5 When the cells adhered to the wall and grew to a density of 80%, NADL and NCP were taken to infect SSCs-cattle at an MOI of 1, and the spermatogonial stem cell culture medium was replaced after the virus adsorbed for 1 hour.

[0061] After 24 hours, the cells were collected and tested using a ferrous colorimetric assay kit (purchased from Elabscience Wuhan Elaruite Biotechnology Co., Ltd., catalog number E-BC-K881-M). 6 Cells were lysed on ice with 200 μL RIPA lysis buffer for 10 minutes, centrifuged at 15,000 × g for 10 minutes, and the supernatant was collected. The supernatant was treated with 80 μL of the iron probe in the above kit at 37°C for 10 minutes. The absorbance was measured at 593 nm using a microplate reader. The relative ferrous content is equal to the difference in ferrous content between the experimental group and the control group (the experimental group was infected with BVDV, and the control group was not infected with BVDV, i.e., the Mock group). The ferrous ion content was calculated using a ferrous ion standard curve. The results are shown in Figure 2. Figure 6 shown.

[0062] The results showed that the ferrous ion level in the CP type group increased by 3 times compared with the control group, and the ferrous ion level in the NCP type group increased by 2 times compared with the control group.

[0063] Through the above three steps, the pathogenicity of CP type strains to SSCs is significantly higher than that of NCP type, and the strain typing can be achieved through the above indicators.

[0064] Test Example 4 Antiviral Drug Screening To evaluate the effect of antiviral compounds (such as the ferroptosis inhibitor Ferrostatin-1) on the recovery of cell viability after NADL infection, a control group and a ferroptosis inhibitor Ferrostatin-1 (Fer-1) pretreatment group were set up. Cell viability in both groups was measured using the CCK-8 assay 24 hours after NADL inoculation. The specific steps are as follows: SSCs-cattle were plated in 96-well plates, with 1.0×10 3 After the cells adhered to the wall and grew to 80% density, SSCs-cattle were pretreated with 2μM Ferrostatin-1 for 2h. NADL was taken to infect SSCs-cattle at an MOI of 1. After 1h of virus adsorption, the spermatogonial stem cell culture medium was replaced in the control group, and the spermatogonial stem cell culture medium in the Ferrostatin-1-treated group was replaced with 2μM Ferrostatin-1. CCK8 detection was performed 24h later. Figure 7 shown.

[0065] The results showed that the cell survival rate in the control group was significantly reduced to 45%, while the cell survival rate in the Fer-1 treatment group was increased to 78%, indicating that Fer-1 can significantly alleviate the cytotoxic effects induced by BVDV infection by inhibiting the ferroptosis pathway.

[0066] As can be seen from the above embodiments, the present invention provides a method for constructing a viral reproductive dysfunction model based on spermatogonial stem cells and the application of the model. The constructed model can support the standardized process of viral strain typing and drug screening, which can significantly improve R&D efficiency and reduce experimental costs.

[0067] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A method for constructing a viral reproductive dysfunction model based on spermatogonial stem cells, characterized in that: The steps include: The spermatogonial stem cells are cultured in a spermatogonial stem cell culture medium and infected with bovine viral diarrhea virus to obtain the spermatogonial stem cell-based viral reproductive dysfunction model.

2. The construction method according to claim 1, characterized in that The spermatogonial stem cells are bovine spermatogonial stem cells or goat spermatogonial stem cells; The spermatogonial stem cell culture medium includes the following raw material components: 1× L-glutamine solution, 1× non-essential amino acid solution, glial cell line-derived neurotrophic factor, basic fibroblast growth factor, β-mercaptoethanol, fetal bovine serum, DMEM / F12.

3. The construction method according to claim 2, characterized in that The mass volume concentration of the glial cell line-derived neurotrophic factor is 8-12 ng / ml, the mass volume concentration of the basic fibroblast growth factor is 8-12 ng / ml, the molar concentration of the β-mercaptoethanol is 0.08-0.12 mM, and the volume fraction of the fetal bovine serum is 8-12%.

4. The construction method according to claim 2 or 3, characterized in that The volume ratio of the 1× L-glutamine solution, 1× non-essential amino acid solution, glial cell line-derived neurotrophic factor, basic fibroblast growth factor, β-mercaptoethanol, fetal bovine serum, and DMEM / F12 is 8-12:8-12:1:1:1:100:870-880.

5. The construction method according to claim 1, characterized in that The culture environment contains 5% CO2, the culture temperature is 37°C, and the culture method is to subculture at a ratio of 1:2-3 every 2-3 days.

6. The construction method according to claim 1, characterized in that The multiplicity of infection of the bovine viral diarrhea virus is 1 or 2; the infection temperature is 37° C.; and the infection time is 1 to 72 hours.

7. A spermatogonial stem cell-based viral reproductive dysfunction model constructed by the construction method according to any one of claims 1 to 6.

8. Use of the spermatogonial stem cell-based viral reproductive dysfunction model according to claim 7 in screening drugs against bovine viral diarrhea virus.

9. A method for screening anti-bovine viral diarrhea virus drugs, characterized in that: The steps include: After pre-treating the spermatogonial stem cell-based viral reproductive dysfunction model described in claim 7 with the drug to be tested, a cytopathic bovine viral diarrhea virus strain is added and incubated for 20 to 25 hours. CCK8 detection is performed. If the cell survival rate is ≥75%, the anti-bovine viral diarrhea virus drug is obtained.

10. Application of Ferrostatin-1 in the preparation of drugs against bovine viral diarrhea virus.