Dynamic control system for coordinating production of streptomyces secondary metabolite and application of dynamic control system

Abstract

The invention provides a dynamic control system for coordinating streptomyces secondary metabolite production and application of the dynamic control system. Firstly, a general artificial promoter PQS (trigger) responding to a quorum sensing system of various streptomycetes is designed, then a stabilizer is constructed based on a bistable gene circuit, instantaneous signal output is converted into stable signal output, dependence of an inducer is successfully eliminated, finally, an orthogonal amplifier is developed based on a streptomycete rare extracellular function sigma factor, and finally, the specific function of the quorum sensing system of various streptomycetes is achieved. And different promoter element libraries containing amplifiers with response from weak to strong and with strength span of about 535 times are constructed. An amplifier and a CRISPRi system are combined to construct a turner, and gene expression inhibition with the strength span of about 200 times is achieved. The combination of the amplifier, the promoter library and the turner is called a multi-effect device, and abundant elements are provided for fine target gene expression. The combination of the trigger, the stabilizer and the multiple-effect device is called as a streptomycete multipath manual control system (SMARTS), and control tools of streptomycete are enriched.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and in particular relates to a dynamic control system for coordinating the production of secondary metabolites of Streptomyces and its application. Background Art

[0002] Streptomyces has attracted considerable attention as a natural producer of clinically and industrially valuable secondary metabolites. These secondary metabolites include two-thirds of clinical antibiotics (Hutchings I, 2019, Current Opinion in Microbiology, 51: 72-80), as well as many anticancer drugs, immunosuppressants, pesticides, etc. In addition to being a source for drug discovery, Streptomyces strains are also used in industrial production. In addition, Streptomyces is the largest bacterial genus, including more than 900 species (Barka A, 2016, Microbiology and Molecular Biology Reviews, 80(1): 1–43), and has a large number of unexplored silent gene clusters. Therefore, developing a universal and efficient engineering paradigm to unleash the potential of Streptomyces remains challenging.

[0003] Dynamic synchronization of related genes or pathways during secondary metabolism production ensures the maximum contribution of cells to biosynthesis, thereby preventing the inevitable resource loss caused by physiological adaptation. Streptomyces undergoes a natural synchronous switch during the transition from cell growth to secondary metabolism production (Wang W, 2020, Nature Biotechnology, 38(1):76–83). However, this switch is mainly for their own competitive interests rather than overproduction (Yan H, 2024, Trends in Biotechnology, 43(1): 12–15). This natural switch in Streptomyces does not fully coordinate the multiple factors that lead to secondary metabolism production. Therefore, achieving coordinated reprogramming of multiple targets, which can automatically regulate the required physiological and metabolic changes in parallel, can maximize microbial yields and minimize the need for human fermentation supervision. However, a fully autonomous and orthogonal dynamic control system capable of reprogramming multiple targets has not yet been developed, especially a system for evaluating the industrial applicability of Streptomyces. In addition, the diversity of Streptomyces species and secondary metabolite structures requires the development of plug-and-play and intervention-free dynamic control systems. Such a system could establish a pipelined multi-objective optimization framework, thereby facilitating standardized dynamic synchronization of multiple objectives across multiple Streptomyces species.

[0004] Quorum sensing has the function of synchronizing bacterial cell population-dependent behaviors and has been applied to control the expression of specific pathways and regulate population size (Gupta A, 2017, Nature Biotechnology, 35(3): 273-279), demonstrating the superiority of its self-regulatory properties in engineered artificial systems. However, due to the presence of a large number of lactonases and acylases, the well-studied homoserine lactone-based quorum sensing system cannot be applied to Streptomyces (Polkade A, 2016, Frontiers in Microbiology, 10(7): 131). On the other hand, Streptomyces has a unique quorum sensing system that is different from Gram-positive and Gram-negative bacteria. Therefore, we turned to understand the diversity of Streptomyces quorum sensing systems and subsequently developed a universal and multiplexed dynamic control system that can be easily used to reprogram multiple targets in different Streptomyces while avoiding any crosstalk with any Streptomyces host endogenous regulatory network.

[0005] The common control systems of Streptomyces are constitutive promoters or inducible promoters. The constitutive promoter sequence is short and can be plug-and-play, but it is affected by the housekeeping sigma factor. σ hrdB Dependence (Bai C, 2015, Proceedings of the National Academy of Sciences of the United States of America, 112(39): 12181-12186). The promoter activity is high during the logarithmic growth phase and low during the stationary phase. Secondary metabolism is only expressed in large quantities during the stationary phase. This temporal transcriptional difference makes it difficult for constitutive promoters to achieve synchronization of multiple targets of secondary metabolism. Inducible promoters can freely control the activation and transcription intensity of target genes by adding inducers. However, this process requires human supervision. At the same time, the cost of inducers varies. Some inducers are even high-value-added antibiotics, such as oxytetracycline (Wang W, 2016, ACS Synthetic Biology, 5(7): 765-773) and tetracycline (Rodriguez-Garcia A, 2005, Nucleic Acids Research, 33(9): e87). These inducers are not suitable for industrial scenarios.

[0006] Tian et al. combined the endogenous quorum sensing system of Streptomyces with CRISPRi to develop the EQCi system for dynamic and adjustable control of multiple targets (Tian J, 2020, Nucleic Acids Research, 48(14): 8188-8202). However, the quorum sensing-responsive elements of this system are all derived from Streptomyces rapa, and it is uncertain whether they are universal in other Streptomyces. At the same time, the system can only inhibit but not enhance gene expression, resulting in limited target selection. Summary of the Invention

[0007] The purpose of the present invention is to provide a dynamic control system for coordinating the production of secondary metabolites of Streptomyces and its application.

[0008] The present invention is conceived as follows: (1) An artificial promoter (trigger) is designed based on sequence analysis and alignment. Through in vitro and in vivo experiments, it is confirmed that the promoter can respond to different endogenous quorum sensing systems of various Streptomyces and realize signal output that depends on the concentration of quorum sensing signal molecules. (2) A stabilizer is constructed based on a bistable gene circuit, which successfully converts transient signal output into stable signal output and gets rid of the dependence on inducers. The orthogonality of the stabilizer is determined by transcriptomics. (3) An orthogonal amplifier is developed based on the rare extracytoplasmic functional σ factor of Streptomyces, which can amplify the transcription level by about 85 times and the translation level by about 9 times. At the same time, a library of different promoter elements containing amplifiers with response strengths ranging from weak to strong and a span of about 535 times is constructed. The amplifier is combined with the CRISPRi system to construct a flipper, which can achieve gene expression inhibition with a span of about 200 times. The combination of amplifier, promoter library, and flipper is called a multi-effector, which provides rich elements for fine target gene expression. (4) The combination of trigger, stabilizer, and multi-effector is called the Streptomyces multiplex artificial control system ( Streptomyces multiplexed artificial control system), referred to as SMARTS.

[0009] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a universal artificial promoter P that responds to the Streptomyces quorum sensing system. QS (trigger), the promoter P QS The nucleotide sequence is shown in SEQ ID NO: 1.

[0010] In the second aspect, the present invention provides the promoter P QS The bistable gene circuit (stabilizer) used in conjunction with the promoter P cymR controlled cebR Fusion gene expression cassette, driven by promoter P cebR -2 controlled cymR Fusion gene expression cassette and promoter P cymR Controlled target gene expression cassette; Among them, the cebR The fusion gene is derived from Streptomyces scabies ( Streptomyces scabiei )of cebR (SCAB_RS27580) gene from bacteriophage λ ci (EFW66490.1) genes are connected in series; cymR The fusion gene is derived from Pseudomonas putida ( Pseudomonas putida )of cymR (AII71791.1) gene and the gene from bacteriophage 434 ci434 (UMO75391.1) genes in tandem; or, described cebR The fusion gene is derived from Streptomyces scabies cebR Genes from bacteriophage 434 ci434 Genes are connected in series; cymR The fusion gene is derived from Pseudomonas putida cymR Genes from bacteriophage λ ci Genes are linked in series.

[0011] Preferably, the two tandem genes are connected by a linker; more preferably, the amino acid sequence encoded by the linker is GGGGSGGGGS.

[0012] Furthermore, the promoter P cymR For the cymR The promoter of the gene, the nucleotide sequence of which is shown in SEQ ID NO: 54.

[0013] Furthermore, the promoter P cebR -2 For the modified promoter P cebR (Promoter P cebR For the cebR The nucleotide sequence of the promoter is shown in SEQ ID NO: 2 ( Figure 8 ).

[0014] In the present invention, the target genes include genes involved in the production of secondary metabolites of Streptomyces.

[0015] In a third aspect, the present invention provides a multi-effect system for finely regulating target gene expression used in conjunction with the bistable gene circuit, the multi-effect system comprising: Derived from Streptomyces albicans ( Streptomyces albidoflavus )of σ antA Factors and identification σ antA P of factor ON Promoter or P ON mutant promoters (amplifiers); and, Controlled by a constitutive promoter dCas9 The gene expression cassette and the P ON Promoter or P ON Mutant promoter-controlled gRNA backbone and spacer sequence expression cassette (FLIP).

[0016] Among them, the P ON The mutant promoter was selected from P1-P 50 Mutate any one of the promoters, P1-P 50 The N17 sequence in the mutant promoter nucleotide sequence is as shown in any one of SEQ ID NOs: 4-53 (i.e., the sequence shown in any one of SEQ ID NOs: 4-53 is substituted for P ON CCGCCGCCTCCTCGCGC in the promoter nucleotide sequence). The P ON The nucleotide sequence of the promoter is shown in SEQ ID NO: 3. ON The schematic diagram of the promoter structure is as follows Figure 9 As shown, the specific location of the N17 sequence is shown in the figure.

[0017] Preferably, the constitutive promoter is derived from Saccharopolyspora erythraea ( Saccharopolyspora erythraea ) constitutive promoter P ermE .

[0018] Preferably, the size of the spacer sequence is 20 nt.

[0019] In a fourth aspect, the present invention provides a dynamic control system for coordinating the production of secondary metabolites of Streptomyces ( Streptomyces multiplexed artificial control system, SMARTS), the dynamic control system includes the promoter P QS , the bistable gene circuit and the multi-effect system.

[0020] In a fifth aspect, the present invention provides an expression vector comprising the dynamic control system.

[0021] Furthermore, the dynamic control system is constructed onto the expression vector to facilitate replication and expression in microorganisms and minimize expression leakage of the gene circuit.

[0022] In a sixth aspect, the present invention provides a genetically engineered Streptomyces bacterium, wherein the genetically engineered bacterium is a Streptomyces bacterium comprising the dynamic control system or the expression vector.

[0023] In a seventh aspect, the present invention provides a method for constructing a high-yield epirubicin genetically engineered bacterium, comprising the following steps: (1) Carrying the bacteria from Streptomyces borsei ( Streptomyces peucetius ) of the doxorubicin biosynthetic gene cluster pSET156- dox The plasmid (Qiu S, 2023, Metabolic Engineering, 81: 210-226) was integrated into Streptomyces venezuelae ( Streptomyces venezuelae ) on the genome, and then knock out the dnmV (CGZ69_24385) gene, resulting in strain △ dnmV ; (2) Design primers to amplify the P cymR - antA and P ermE - dCas9 DNA fragments of the sequence (SEQ ID NOs: 55 and 56); Design primers to amplify the QS - cebR 、P cymR - cebR and P cebR -2 - cymR Sequence DNA fragment (SEQ ID NO: 57-59); The purified DNA fragment was recombined with the NdeI / SpeI-digested pSOK616-OtcR plasmid (Qiu S, 2023, Metabolic Engineering, 81: 210-226) in vitro using NovoRec Plus recombinase to construct the pSOK616-SMARTS plasmid; (3) Integrate the pSOK616-SMARTS plasmid into the strain △ by conjugation transfer dnmV 's genome, resulting in strain EPI0; (4) Design primers to amplify P 39 、P 42 、P 46 、P 27 、P 30 Mutate the promoter sequence and then 39 Target gene dnrIN , P 42 Target gene avrE , P 46 Target gene dnS , P 27 Target gene panK , P 30 Target gene acc , P 27 Target gene bldD The sequences were assembled together using fusion PCR technology; Design primers to amplify the P 37 Mutate the promoter sequence and combine it with the targeting HkDJ The gRNA sequences of the genes are assembled together using fusion PCR technology; preferably, the targeting HkDJ The gRNA sequence of the gene is: 5′-CACGAGCACTTCGTGCCCCG-3′; Among them, P 39 、P 42 、P 46 、P 27 、P 30 、P 37 The mutant promoter is P ON Mutated promoter; (5) The seven P ON The target gene expression cassette controlled by the mutant promoter was recombined with the pSET157 plasmid fragment digested with XbaI in vitro using NovoRec Plus recombinase to construct the pSET157-EPI3 plasmid, which was then integrated into the genome of the strain EPI0 by conjugation.

[0024] In an eighth aspect, the present invention provides a high-epirubicin-producing genetically engineered bacterium constructed according to the method.

[0025] In a ninth aspect, the present invention provides the use of the genetically engineered bacteria in the fermentation production of epirubicin.

[0026] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (1) The present invention constructed a universal quorum sensing trigger promoter in different Streptomyces, integrated it with the stabilizer module and the multi-effector module, and developed a Streptomyces multi-channel artificial control system ( StreptomycesThe SMARTS (multiplexed artificial control system) can convert transient quorum sensing signals into stable, multi-pathway "on" or "off" signal outputs of varying intensities. This method can synchronize the expression of multiple target genes without affecting other physiological activities of Streptomyces, allowing for precise regulation of expression intensity. This approach is universally applicable, thus enriching the control tools available for Streptomyces.

[0027] (2) The present invention can be plug-and-play in different Streptomyces species, responding to their different quorum sensing systems and automatically regulating multiple targets simultaneously, enabling dynamic reprogramming of multi-target combinations; the stability of synthetic biology control tools is often overlooked. In contrast, the design of the present invention always prioritizes stability; crosstalk between artificial control systems and the host's own regulatory network always leads to imbalances, thereby affecting the performance and reusability of engineered strains. The design of the present invention avoids interference with the endogenous regulatory network of the Streptomyces host, and vice versa.

[0028] (III) The SMARTS system provided by the present invention can achieve efficient production of epirubicin. S. venezuelae The synergistic optimization of multiple target genes enabled the dynamic and synchronized production of epirubicin, reaching the highest yield reported to date of 101.23 mg / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a trigger-responsive Streptomyces quorum sensing system in a preferred embodiment of the present invention. (a) Trigger Response S. coelicolor The quorum sensing system of M145. (b) Trigger response S. avermitilis The quorum sensing system of MA-4680. (c) The stringency of the trigger. (d) The universality of the trigger.

[0030] Figure 2 Optimization of the bistable circuit in a preferred embodiment of the present invention. (a) Schematic diagram of the bistable circuit. (b) Response curves of four suppression systems. (c) CymR Dose-response curve of CebR. Dose-response curves of four P cebR Response curve of the variant. (f) Switching effect of the optimized bistable circuit. ( P <0.05, P <0.01).

[0031] Figure 3In a preferred embodiment of the present invention, the stabilizer can convert a transient signal into a stable signal. (a) The bistable circuit is in a stable off state. (b) The bistable circuit is in a stable on state. (c) The stabilizer can produce a stable signal output after packaging. (d) The stabilizer's universality. (e) The stabilizer's orthogonality.

[0032] Figure 4 Figure 2 shows the amplification effect of the amplifier in a preferred embodiment of the present invention. (a) Orthogonality of the amplifier. (b) Amplification effect of the amplifier at the translation level. (c) Amplification effect of the amplifier at the transcription level.

[0033] Figure 5 In the preferred embodiment of the present invention, the promoter library can be used to finely regulate the target gene 。 (a) Characterization of 50 promoters. (b) Correlation between the transcriptional and translational levels of the 10 selected promoters. (c) Universality of the promoter library.

[0034] Figure 6 The inhibitory effects of the flipper in a preferred embodiment of the present invention. (a) The inhibitory effects of 50 promoters. (b) The multi-effector achieves independent outputs of strengthening and weakening.

[0035] Figure 7 Optimizing epirubicin to achieve multi-target coordinated control in the preferred embodiment of the present invention 。 (a) Epirubicin production after optimizing the biosynthetic machinery. (b) Epirubicin production after optimizing independent pathways. (c) Multi-objective optimization technology synergistically controls genes involved in epirubicin production without interfering with other host physiological activities.

[0036] Figure 8 In the preferred embodiment of the present invention, cebR -2 Schematic diagram of the promoter structure.

[0037] Figure 9 In the preferred embodiment of the present invention, ON Schematic diagram of the promoter structure. DETAILED DESCRIPTION

[0038] In order to achieve synchronized control, the present invention needs to have elements that respond to the secondary metabolism of Streptomyces, so as to synchronize the control of the target gene during the conversion period between primary metabolism and secondary metabolism; in order to minimize human supervision of the fermentation process, the elements used in the present invention should avoid adding various compounds or changing the fermentation conditions as much as possible, and use the natural dynamic control of Streptomyces to start the artificial control system; in order to achieve predictable expression of the target gene, the present invention needs to have elements that stabilize the gene expression intensity; in order to achieve precise control of multiple targets, the present invention needs to have an element library of different intensities, and this element library can both enhance and weaken the expression of the target gene. In order to avoid crosstalk between the artificial control system and the host's own regulatory network, the elements used in the present invention should have orthogonality; in order to be plug-and-play in a variety of Streptomyces, the elements used in the present invention should have versatility.

[0039] The present invention adopts the following technical solutions: The invention provides a streptomyces multi-channel artificial control system, which consists of a trigger, a stabilizer and a multi-effect device.

[0040] 1. Development of a universal artificial promoter that responds to the quorum sensing system of Streptomyces Based on the sequence analysis of the promoters of the receptor protein of Streptomyces, it was found that they all contained a conserved binding motif of 5'-AAACCNNNNNNNNGGTTT-3', and this conserved binding motif is generally located in the N17 sequence between the -35 region and the -10 region of the natural promoter. Streptomyces coelicolor ) Source P kasO The promoter starts to kasO The N17 sequence between the -35 region and the -10 region of the promoter is replaced with the conserved binding motif. The complete sequence information is 5'-TGTTCACATTCGAACGGTCTCTGCTTTGACAAACCGGCTAGCCGGTTTGTAAAGTCGTGGCCAGGAGAATACGACAGCGTGCAGGACTGGGGGAGTT-3' (where the underline is the conserved binding motif). This sequence can be obtained by annealing a pair of primers. The obtained promoter is called P QS , with a total length of 97 bp (SEQ ID NO: 1).

[0041] In order to verify P QS Can it respond to different endogenous quorum sensing systems of Streptomyces and convert P QS Control reporter gene gfpmut3.1Gene circuits were formed and transferred into Streptomyces containing different quorum sensing systems. SMM liquid culture medium was used uniformly, and samples were taken at 12 h, 24 h, 36 h, 48 h, 60 h, and 72 h of culture to test the fluorescence intensity of the unit bacteria and the intensity of the quorum sensing signal molecules at different time sequences. S. coelicolor M145 confirmed that the fluorescence intensity per unit cell is proportional to the intensity of the signal molecule SCB1 ( Figure 1 a), the temporal changes of both strains first rose to a peak value and then rapidly decreased. In Streptomyces avermitilis ( Streptomyces avermitilis ) MA-4680 confirmed that the fluorescence intensity per unit cell is proportional to the intensity of the signal molecule avenolide ( Figure 1 b). In addition, the gene circuit was transferred into the signal molecule mutant strain ( S. coelicolor △ scbA ) and receptor protein mutants ( S. coelicolor △ scbR ) in the △ scbA It is not triggered in △ scbR , indicating the stringency of the trigger, which only responds to the Streptomyces quorum sensing system ( Figure 1 c). These results confirm that the artificial promoter P QS It can interact with multiple quorum sensing receptors and respond to their quorum sensing signals.

[0042] At present, only four types of quorum sensing signal molecules with different structures have been identified in Streptomyces. In order to determine whether the artificial promoter works the same in Streptomyces with unknown signal molecules, we selected S. rimosus ATCC 10970 and S. scabiei 87.22 The fluorescence intensity of the test unit bacteria was found to be S. coelicolor and S. avermitilis The results are similar to those in QS Able to receive allosteric signals from these quorum sensing receptor proteins ( Figure 1 d). The above results prove that P QS Triggered by multiple quorum sensing systems, it is universal.

[0043] 2. Develop an orthogonal stabilizer module Unlike traditional bacterial quorum sensing systems, the concentration of signal molecules in Streptomyces only reaches the threshold within a very narrow time window (Wang J, 2011, Moleculor Microbiology, 82(1): 236-250). QS The response is transient output, which does not meet the engineering requirements for stable output. In order to convert the transient output into a stable output, P QSCombined with a stabilizer module containing a bistable circuit. The bistable circuit includes two mutually inhibiting inhibitory systems, ensuring that the initial off state (promoter P2 is ON and P1 is OFF) can be switched to the promoter P2 by quorum sensing. QS Once switched to the on state, it remains in this state regardless of subsequent fluctuations in the concentration of the quorum sensing signaling molecule. Figure 2 a).

[0044] Based on the dynamic response range, select CymR / cuO and CebR / cebO Inhibitory system builds bistable circuit ( Figure 2 b). To visualize the on and off states, the CymR-responsive promoter P was used. cymR control cebR and gfpmut3.1 The gene, with green fluorescence as the on state, is expressed using a CebR-responsive promoter P cebR control cymR and mCherry , with red fluorescence as the off state. It was found that the natural bistable circuit had serious leakage. To enhance the rigor of the bistable circuit, the bistable circuit was optimized from both the protein and promoter aspects. First, the inhibitory protein was fused with the phage-derived oligomerization domains CI434 and CI to the C-termini of the CymR and CebR proteins, respectively. Due to the presence of the oligomerization domain, the fused proteins easily formed tetramers, which could synergistically recognize the two DNA binding sites to form a DNA loop, thereby reducing leaky expression and improving the inhibition efficiency ( Figure 2 c and Figure 2 d). The modified CymR and CebR proteins are respectively called CymR and CebR To match the activity of the two promoters, the relatively weak CebR was optimized. Identify promoter P cebR , modifying the non-recognition region of the promoter (the middle sequence from -35 to -10), generating four variants with different strengths and induction ranges ( Figure 2 e), selected the cymR A variant of P with almost identical behavior cebR -2 To construct a bistable circuit. After completing the transformation of the inhibitory protein and the promoter, S. coelicolor The test was carried out, and the culture medium and inducer were replaced every 18 h. The red and green fluorescence were successfully oscillated ( Figure 2 f), which shows that the optimized bistable circuit reduces leakage and improves stability.

[0045] After optimizing the bistable circuit and introducing the quorum sensing trigger promoter P QS The performance was evaluated by measuring the fluorescence intensity per cell. The bistable circuit was maintained in the closed state by induction on a solid plate initially containing cellobiose. The signal molecule mutant strain ( S. coelicolor Δ scbA ) of the fluorescence output, only the red fluorescence has a signal output while the green fluorescence does not, confirming the stability of the closed state ( Figure 3 a). Subsequently, to prove that the quorum sensing signal can trigger the on state, the same inoculation strategy was used to inoculate S. coelicolor In the wild type, only the red fluorescence signal was output at first, proving that it was still in the closed state at the beginning of fermentation. After the quorum sensing signal was generated, the red fluorescence signal gradually decreased, while the green fluorescence signal continued to increase and remained stable in the late fermentation period, proving the stability of the open state ( Figure 3 b).

[0046] Since both the on and off states can maintain stability, in order to encapsulate the stabilizer module based on the bistable circuit, the inhibitory factor is removed. cebR and cymR Two reporter genes were co-transcribed and an additional P was introduced. cymR Promoter ( cymR Gene promoter) to specifically drive target output, using P cymR Promoter control gfpmut3.1 Compared with the control without the stabilizer module, the encapsulated stabilizer module can increase the quorum sensing-triggered P QS The instantaneous signal is converted into a more stable signal ( Figure 3 c). In different Streptomyces species ( S. venezuelae ATCC 10712, S. avermitilis MA-4680, S. rimosus ATCC 10970) was transferred into a gene circuit with a trigger-stabilizer to obtain S. coelicolor The consistent signal output pattern shows that the stabilizer has a wide range of applicability ( Figure 3 d). Because the repressor and promoter in this module have been carefully designed to avoid any homologous sequences in the native Streptomyces system, the target output is only controlled by the trigger-stabilizer, and not by the endogenous genes of Streptomyces. Similarly, the expression of the trigger-stabilizer will not interfere with the normal physiological activities of Streptomyces. S. coelicolorThe RNA-seq experiment in the experiment showed that only the reporter gene had a significant change in transcription level, while other genes on the genome had no significant change in transcription level, proving the orthogonality of the stabilizer ( Figure 3 e).

[0047] 3. Develop a multi-effects module that can be finely controlled To convert stable signals into multiple outputs, we introduced a multi-effector module, which includes an amplifier-coupled promoter library for generating enhanced states of different strengths and a flipper for converting these multiplexed on states into weakened states. First, an orthogonal amplifier was constructed. To ensure broad applicability to different Streptomyces species while minimizing endogenous interference, rare extracytoplasmic functional σ factors were selected that only specifically activate their cognate target promoters. These rare extracytoplasmic functional σ factors recognize the unique -35 region and -10 region of their promoters, thereby avoiding cross-interference with endogenous promoters (Mascher T, 2023, Annual Review of Microbiology, 77: 625-644). S. albidoflavus of σ antA As an amplifier, the characteristic -35 and -10 regions of this σ factor have been reported (Seipke R, 2014, PeerJ, 2: e253). σ antA The promoter P ON Control reporter gene sfgfp (AJW68299.1) gene circuit and transferred into S. venezuelae In ATCC 10712, RNA-seq experiments were performed, and only the transcription level of the reporter gene changed significantly, while the transcription levels of other endogenous genes in the genome did not change significantly, proving that σ antA The expression of other genes in the genome has no significant effect ( Figure 4 a). Next, we determined the amplification effect of the amplifier and constructed a trigger-stabilizer-amplifier gene circuit as the experimental group, and a control group containing only the trigger-stabilizer gene circuit. σ antA The enlarged P ON The output intensity at the translational level increased approximately 9-fold ( Figure 4 b), the output intensity at the transcriptional level increased approximately 85-fold ( Figure 4 c). These results indicate that this rare extracytoplasmic functional σ factor is a non-interfering amplifier in Streptomyces.

[0048] In order to convert the single amplified signal into multiple outputs, the next step is to ON A mutation was introduced into the N17 sequence between the -35 and -10 regions of the promoter ( Figure 9 ) to generate a random library, which was then transferred to S. venezuelae ATCC 10712 and use flow cytometry-based sorting technology to obtain promoters of different strengths while ensuring amplifier σ antA 50 mutant promoters (P1~P 50 ), with the original unmutated promoter P ON The output intensity of the mutant promoters was taken as 100%, and the relative output intensity of the mutant promoters ranged from 0.41% to 219.53%. Detailed characterization was performed at the translation level ( Figure 5 a). In addition, by analyzing the correlation between expression and transcription levels, it was found that the two were positively correlated, R 2 The value reaches 0.96, confirming that the observed output changes can be attributed to the amplifier σ antA Different transcriptional activation ( Figure 5 b), thus determining the usability of 50 mutant promoters. To assess the universality, 10 mutant promoters were selected and tested in three additional Streptomyces species ( S. coelicolor M145, S. avermitilis MA-4680, S. rimosus ATCC 10970) and observed S. venezuelae The same trend was observed in ATCC 10712 ( Figure 5 c).

[0049] To further convert the multiplexed outputs into multiplexed weakened outputs, a flipper was designed that uses the multiplexed outputs to express repressors, which then inhibit the activity of the target gene to varying degrees. As the expression level of the repressor increases, the output signal gradually decays. CRISPRi was selected as the flipper, and promoters of varying strengths were used to control the gRNA, while the dCas9 protein was constitutively expressed. This configuration produced a series of weakened signal outputs, with inhibition efficiencies ranging from 2.82% to 99.51% ( Figure 6 Finally, to test whether the amplifier, promoter library, and flipper can be used simultaneously to form finely tuned signal outputs of different strengths, five promoters of different strengths were used to fine-tune activation and repression simultaneously, with enhanced output selection. sfgfp As a reporter gene, weakening output selection mCherry As a reporter gene, 25 sets of enhanced and weakened output results were generated, and the enhanced and weakened outputs were related to the promoter strength ( Figure 6b) Demonstrating the availability of amplifiers, promoter libraries, and flippers, the three-way combination is termed a pleiotrophin, demonstrating its ability to simultaneously autoregulate multiple targets in Streptomyces. Overall, by integrating trigger, stabilizer, and pleiotrophin modules, SMARTS enables dynamic, orthogonal, and predictable fine-tuning of multiple target genes across diverse Streptomyces strains.

[0050] 4. Reprogramming Epirubicin Production Using SMARTS To characterize SMARTS, a heterologous host S. venezuelae The dynamic synchronization of multiple targets was achieved to produce the anticancer drug epirubicin, which is currently semi-synthesized chemically from doxorubicin. S. peucetius By knocking out the native dnmV , and simultaneously introduce heterologous TDP-4-hexulose reductase (e.g., from S. avermitilis of avrE ) to synthesize epirubicin (Madduri K, 1998, Nature Biotechnology, 16(1): 69-74), but the yield was low. S. venezuelae SMARTS was used to dynamically control multiple targets to reprogram the production of epirubicin.

[0051] Streptomyces peucetica S. peucetius The doxorubicin biosynthetic gene cluster was introduced into Streptomyces venezuelae S. venezuelae , then knock out the dnmV Genes were identified and SMARTS was applied to the strain to obtain strain EPI0. The targets were then grouped, with Group I being the positive regulatory genes that enhance transcription of the gene cluster. dnrI (CGZ69_24375) and dnr (CGZ69_24440) (Malla S, 2010, Research in Microbiology, 161(2): 109-117), enhanced from S. avermitilis genes avrE (SAVERM_948), enhances the glycosylation gene, the rate-limiting step in biosynthesis dnrS (CGZ69_24270) and QUR (CGZ69_24275) (Malla S, 2009, Journal of Bioscience And Bioengineering, 108(2): 92-98), and attenuated doxorubicin byproduct synthesis genes HkDJ(CGZ69_24340) (Scotti C, 1996, Journal of Bacteriology, 178(24): 7316-7321). Several mutant promoters with different strengths were selected to control the above target genes, and 32 groups of mutant promoter combinations were obtained. The expression strengths of the four targets were represented by x, y, z, and w, respectively. The corresponding strains were named EPI-I1~EPI-I32. The yields (Titer) corresponding to the 32 groups of mutant promoter combinations were obtained by fermenting these strains. The optimal point was calculated by the response surface model based on these expression strengths and yield results. The obtained model equation was Titer = 76.42+3.69x+6.28y+3.88z+2.64w+0.514xy-0.619xz+0.538xw-0.885yz+0.474yw+1.24zw-12.9x 2 -9.90y 2 -10.36z 2 -13.28w 2 , R 2 is 0.89, and the optimal point corresponding to the mutant promoter combination is P 39 、P 42 、P 46 、P 37 , using this optimal combination to drive dnrIN 、 avrE 、 dnS and targeted HkDJ gRNA, the strain was obtained and the engineered strain EPI1 was constructed, and the yield of shake flask fermentation reached 73.61 mg / L ( Figure 7 a).

[0052] Then, a target of group II was selected, one of which was to enhance pantothenate kinase panK (ECK3966), used to increase the CoA pool (Song E, 2011, Journal of Industrial Microbiology and Biotechnology, 38(9):1245-1253), and enhance acetyl-CoA carboxylase acc (SCO4921), which is used to increase the acetyl-CoA pool by targeting (Ryu Y, 2006, Applied and Environmental Microbiology, 72(11): 7132-7139) and maintain the regulatory proteins of production-related cell morphology bldD(DEJ43_RS05345) (Qiu S, 2023, Metabolic Engineering, 81, 210-226). Several mutant promoters of varying strengths were selected to control the target genes listed above, yielding 19 combinations of mutant promoters. The expression intensities of the three targets were represented by x, y, and z, respectively. The corresponding strains were named EPI-II1 to EPI-II19. These strains were fermented to obtain the yields (Titer) corresponding to the 19 mutant promoter combinations. These expression intensities and yields were then calculated using a response surface model to optimize the optimal point. The resulting model equation was Titer = 97.65 + 1.24x + 3.16y + 1.21z - 1.72xy - 0.697xz - 1.17yz - 6.73x 2 -5.17y 2 -5.80z 2 , R 2 To determine the optimal promoter combination, three mutant promoter combinations were tested near the predicted optimal point, and the dynamic control panK 、 acc and bldD , and obtained strain EPI2 (P 26 、P 30 、P 27 )、EPI3(P 27 、P 30 、P 27 )、EPI4(P 27 、P 30 、P 26 ), among which EPI3 had a higher epirubicin production of 101.23 mg / L ( Figure 7 b). This yield was 1.81-fold higher than that of the previously engineered strain in a doxorubicin-producing host. Further comparative transcriptome analysis revealed that only the SMARTS-controlled targets and their associated downstream genes were altered compared to the parental strain. These altered genes showed consistent trends across time points, differing only in the extent of activation or repression ( Figure 7 c). These results demonstrate that the SMARTS-based optimization technology can be used as a plug-and-play for multiple Streptomyces to efficiently synchronize the production of secondary metabolites.

[0053] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0054] Unless otherwise specified, the bacterial strains, plasmids, vectors and other biological materials involved in the present invention were provided by Wang Weishan Laboratory, Institute of Microbiology, Chinese Academy of Sciences.

[0055] Example 1: Construction of trigger Trigger artificial promoter P QS A total of 97 bp was synthesized directly in the form of long primers by Beijing Qingke Biotechnology Co., Ltd. The primers were P QS _F / R (TGTTCACATTCGAACGGTCTCTGCTTTGACAAACCGGCTAGCCGTTTGTAAAGTCGTGGCCAGGAGAATACGACAGCGTGCAGGACTGGGGGAGTT / AACTCCCCCAGTCCTGCACGCTGTCGTATTCTCCTGGCCACGACTTTACAAACCGGCTAGCCGGTTTGTCAAAGCAGAGACCGTTCGAATGTGAACA), anneal the two primers to obtain P QS The DNA sequence was annealed at 95°C for 5 min and then cooled to room temperature. To characterize the trigger, the reporter gene was amplified using primers mut3_F / R (GTGCAGGACTGGGGGAGTTGATGCGGAAGGGCGAGGAGC / CTGGTTCCTTCTTGTTGTTTCACTTGTACAGCTCGTCCATGCCG). gfpmut3.1 , using KOD One TM PCR Master Mix was used for amplification, and the amplification reaction procedure was carried out according to the instructions provided with the polymerase. The specific thermal cycling conditions were as follows: the initial denaturation stage was set at 98°C for 3 min; the denaturation temperature of each cycle was 98°C for 10 s, the annealing temperature was 63°C for 5 s, the extension temperature was 68°C, the extension time was 1 min / kb, and the final extension stage was set at 68°C for 3 min. The purified DNA fragment was recombined in vitro with the backbone fragment of the pSET152 plasmid (Qiu S, 2023, Metabolic Engineering, 81: 210-226) double-digested with BamHI and XbaI using NovoRec Plus recombinase to construct pSET152-P QS - gfp plasmid.

[0056] Example 2 Determination of fluorescence intensity per cell Streptomyces was cultured in SMM liquid medium (10 g / L glucose, 50 g / L polyethylene glycol 6000, 2 g / L acid-hydrolyzed casein, 1.23 g / L magnesium sulfate heptahydrate, 1 mL / L trace element solution; after sterilization, 0.142 g / L sodium dihydrogen phosphate, 0.174 g / L potassium hydrogen phosphate, and 10 mL / L 2.5 mol / L Tris-ethanesulfonic acid (pH 7.2) were added. The trace element solution formulation included 40 mg / L zinc chloride, 200 mg / L ferric chloride hexahydrate, 10 mg / L copper chloride dihydrate, 10 mg / L manganese chloride tetrahydrate, 10 mg / L sodium borate decahydrate, and 10 mg / L ammonium molybdate tetrahydrate). Samples were collected at 12, 24, 36, 48, 60, and 72 hours of incubation to measure the fluorescence intensity per cell and the intensity of quorum sensing signal molecules. The method for determining the unit bacterial fluorescence intensity is to take 1 mL of fermentation liquid and draw 200 μL of test OD 600 , draw 200 μL to test the fluorescence intensity, and divide the fluorescence intensity value by OD 600 .

[0057] Example 3 Determination of Quorum Sensing Signal Molecule Intensity The signal molecule concentration is extremely low, necessitating concentration. The fermentation broth was first acidified to pH 3 with 6 M hydrochloric acid. Ethyl acetate (approximately 50 mL) was then added to the broth for extraction. The upper organic phase was collected by centrifugation at 8000 rpm and rotary evaporated to dryness. After addition of 1 mL of methanol, the resulting concentrate was analyzed by LC-MS / MS to determine the signal molecule intensity. The instrument used was an Agilent 1260 / 6460 Triple Quadrupole LC–MS / MS instrument, using a ZORBAX SB-Aq column (2.1 × 100 mm, 3.5 μm, Agilent). Elution was performed using a gradient of water (solvent A) and acetonitrile (solvent B) containing 0.1% formic acid at a flow rate of 0.25 mL / min. The elution program was as follows: 5% solvent B for 1 minute, followed by a linear increase to 40% over 9 minutes, a linear increase to 95% over 5 minutes and a hold for 5 minutes, and then a decrease to 5% over 2 minutes and a hold for 12 minutes. Mass spectrometry parameters were as follows: capillary voltage: 3500 V; gas temperature: 350°C; nebulizer pressure: 35 psi; drying gas flow rate: 13 L / min. Quantification was performed in multiple reaction monitoring mode.

[0058] Example 4 Construction of Quorum Sensing Signal Molecule and Receptor Protein Knockout Strains S. coelicolor The M145 signal molecule synthesis gene is scbA(SCO6266), the receptor protein synthesis gene is scbR (SCO6265), in order to build scbA and scbR The knockout strain was first amplified by amplifying the homology arms using primers ScbA_UpF / UpR (TAAAACGACGGCCAGTGCCACGCCGACGTGGTGGCCTTTC / CGGAGAACGCACTGCTTCGGGCATGGGTCC). scbA The upstream homology arm of the scbA gene was amplified using primers ScbA_DnF / DnR (CCGAAGCAGTGCGTTCTCCGGCTGAGCACC / TAGAGTCGACCTGCAGCCCAGCCGAAGGCTTCCGCGTGGT). scbA Downstream homology arm; amplified using primers ScbR_UpF / UpR (TAAAACGACGGCCAGTGCCACGCTCTACGCGGCGTTCGAC / GGCATGGCCAGACTGACCGCCGAAGCGCCC) scbR The upstream homology arm of the scbR gene was amplified using primers ScbR_DnF / DnR (GCGGTCAGTCTGGCCATGCCTGCCTCCTTG / TAGAGTCGACCTGCAGCCCAACCGATGCGGTGGGAGTCGC). scbR The downstream homology arms of the knockout plasmid were constructed by recombining the upstream and downstream homology arms with the backbone fragments of the HindIII-digested pKC1139 plasmid (Qiu S, 2023, Metabolic Engineering, 81: 210-226) in vitro using NovoRec Plus recombinase. scbA and pKC1139-Δ scbR Plasmid. The two plasmids were transformed into E. coli ET12567 / pUZ8002 was used as a parent and S. coelicolor M145 was used for intergeneric conjugation transfer. E. coli E to OD 600 = 0.4~0.6, centrifuge 1 mL of bacterial solution, and resuspend the cells in 1 mL of 2×YT medium (peptone 16 g / L, yeast extract 10 g / L, sodium chloride 10 g / L) for later use. S. coelicolorAdd 2 mL of 2×YT medium to an M145 plate. Collect fresh spores from the plate with a cotton swab to prepare a spore suspension. Heat shock the spores at 50°C for 10 minutes. Mix 5 µL of the cooled spores with 200 µL of resuspended E. coli and spread onto a MS plate. Incubate for 13 hours before applying antibiotics. After culturing at 28°C for 2-3 days, single colonies were selected for colony PCR verification. Zygotes that amplify the correct band were expanded.

[0059] Example 5 Construction and Optimization of Bistable Circuit To construct a bistable circuit, the response curves of four candidate inhibitory systems were evaluated by gradually adding inducers. The four inhibitory systems are CymR / cuO (the inducer is cumate), CebR / cebO (the inducer is cellobiose), TetR / tetO (the inducer is tetracycline) and OtrR / otrO (The inducer was oxytetracycline.) Nine inducer concentrations were selected for each inhibition system: cumate concentration gradients from 0.1 μM to 80 μM, cellobiose concentration gradients from 1 μM to 800 μM, tetracycline concentration gradients from 0.01 μM to 8 μM, and oxytetracycline concentration gradients from 0.01 μM to 8 μM. Response curves were expressed as changes in fluorescence intensity per unit cell.

[0060] cymR and cebR Gene and its recognized promoter P cymR and P cebR and reporter genes gfpmut3.1 (XCO69042.1) and mCherry (QSL83322.1) were synthesized by GenScript Biotech Co., Ltd. The plasmid construction method of the bistable circuit was as follows: First, primers R1_F / R (GGCTGAACTCCTTACTTAGATCACCGCTTGAACTTGGCGT / ATGGTGGTCATCATGTCCCCCAAGCGG) were used to amplify cymR , using primers R2_F / R (TCTCCTCAAGGAGTGTCCATATGGTGACAGGCCACGGGGC / GTGCAGTCTCCTTACTTAGATCAGGAAGAATCCCGCCCCA) cebR ; P was amplified using primers P1_F / R (AATTGTACTAGTTCGTCACA / ATGGACACTCCTTGAGGAGA) cymRThe primers P2_F / R (GGGGACATGATGACCACCATGTGCGGCCTCCTTACTTAGA / TGTGACGAACTAGTACAATTTGTTCACATTCGAACGGTCT) were used to amplify P cebR ; Amplify the reporter gene using primers Tcherry_F / R (AAAAGGAGCCTTTAATTGTACGAATTCAAGTGCATGGCCA / TCTAAGTAAGGAGTTCAGCCATGGTGAGCAAGGGCGAG) mCherry , using primers Tmut3_F / R (TCTAAGTAAGGAGACTGCACATGCGGAAGGGCGAGGAGCT / CCTGGTTCCTTCTTGTTGTTTCACTTGTACAGCTCGTCCA) to amplify the reporter gene gfpmut3.1 The PCR conditions were as described above. The purified DNA fragments were recombined in vitro with the backbone fragment of the pSET152 plasmid (Qiu S, 2023, Metabolic Engineering, 81: 210-226) double-digested with BamHI and XbaI using NovoRec Plus recombinase to construct the pSET152-Toggle plasmid.

[0061] To optimize the bistable circuit, we first engineered the inhibitory protein. ci434 Derived from bacteriophage 434, ci Derived from bacteriophage λ, both were synthesized by GenScript Biotech Co., Ltd. The linker used for fusion contains 10 amino acids with the sequence: Gly-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser. The specific plasmid construction method is as follows: Constructing CebR The method is as follows: first, primers 152cebR_F / R (AACAACAAGAAGGAACCAGG / GGAAGAATCCCGCCCCACCA) are used to amplify the cebR Gene, sfgfp The DNA fragments of the gene and the pSET152 plasmid backbone were amplified simultaneously using primers CI_F / R (TGGTGGGGCGGGATTCTTCCGGTGGCGGTGGCAGCGGTG / CCTGGTTCCTTCTTGTTGTTTCAGCCAAACGTCTCTTCAG) ci The two DNA fragments were purified and recombined in vitro using NovoRec Plus recombinase to construct pSET152-CebR Plasmid. Construction of CymR The method is as follows: first, primer 152cymR_F / R (AACAACAAGAAGGAACCAGG / CCGCTTGAACTTGGCGTACC) is used to amplify the cymR Gene, sfgfp The DNA fragments of the gene and the pSET152 plasmid backbone were amplified simultaneously using primers CI434_F / R (GGTACGCCAAGTTCAAGCGGGGTGGCGGTGGCAGCGGTGG / CCTGGTTCCTTCTTGTTGTTTCATACGAATTTTACCCTCGCTTCC). ci434 and Linker sequences, and the amplification reaction and in vitro recombination conditions were the same as CebR The construction of pSET152-CymR Then transform the P cebR Promoter, optimized P cebR The mutation sequence is located in the N17 sequence between the promoter -35 region and -10 region, where P cebR -1 5'-AGCCGACCTATAAACA-3', P cebR -2 5'-CGACCCACTTTCGCTG-3', P cebR -3 5'-ATGGGTCCGCCTCGAG-3', P cebR -4 The mutant sequences were introduced by primers.

[0062] In order to integrate the optimization results into the same plasmid to form the optimized bistable circuit, primers Tmut3_F and Tcherry_R were used to amplify the plasmid backbone and two reporter genes using pSET152-Toggle as a template, and primers R2_F and Toggle _R(GTGCAGTCTCCTACTTAGATCAGCCAAACGTCTCTTCAG) to pSET152-CebR Plasmid as template amplification , using primer Toggle _F (GGCTGAACTCCTTACTTAGATCATACGAATTTTACCCTCGC) and R1_R with pSET152-CymR Plasmid as template amplification cebR The PCR conditions are as shown above. The purified DNA fragments were recombined in vitro using NovoRecPlus recombinase to construct pSET152-Toggle plasmid.

[0063] Example 6 Construction of trigger-stabilizer gene circuit To obtain the stabilizer module, remove the two reporter genes and cymR , using primer Toggle (-)_F / R (CAGGGGCGGGGTTTTTTTTTTCATACGAATTTTACCCTCGC / GGTTCCTTCTTGTTGTTTCAGCCAAACGTCTCTTCAGGCC) with pSET152-Toggle The PCR conditions for the optimized bistable circuit for template amplification are as shown above. The purified DNA fragment was then double-digested with EcoRI and XbaI to form pSET152-Toggle NovoRec Plus recombinase was used to construct pSET152-Toggle (-). Then use primer P cymR gfp_F / R (AAGGAGCCTTTAATTGTACGGATCCTAGTTCGTCACATCCT / ACAGCATGGCCATGCACTTGCGAATTCAAGTGCATGGCC) to pSET152-CymR Plasmid was used as template to amplify another P cymR Promoter-controlled reporter gene PCR conditions are as shown above. The purified DNA fragment was cleaved with EcoRI-digested pSET152-Toggle The (-) plasmid fragment was recombined in vitro using NovoRec Plus recombinase to construct the pSET152-Stabilizer plasmid.

[0064] To combine the trigger and stabilizer modules, first build the trigger P QS Started gfpmut3.1 The element was cloned into pSET152-CebR using primers TcebR_F / R (GTGCAGGACTGGGGGAGTTGATGGTGACAGGCCACGGGGC / TCTTGTTGTTTCAGCCAAACGTCTCTTCAG). Plasmid as template amplification The PCR conditions were as above, and primers 152PQS_F / R (GTTTGGCTGAAACAACAAGAAGGAACCAGG / AACTCCCCCAGTCCTGCACGCT) were used to amplify the pSET152-P QS - mCherry Plasmid was used as template for amplification of the QS The pSET152 plasmid backbone was sequenced and the PCR conditions were as shown above. The purified DNA fragments were recombined in vitro using NovoRec Plus recombinase to construct pSET152-P QS - Plasmid. The primers Trigger_F / R (ACAGCATGGCCATGCACTTGAATTCTGTTCACATTCGAACGGTCT / AGCATGGCCATGCACTTGCGGGCTGCAGGTCGACTCTAGT) were used to amplify the expression of pSET152-P QS -cebR P was amplified as a template QS - gfpmut3.1 The sequence and PCR conditions are as shown above. The purified DNA fragment was recombined with the pSET152-Stabilizer plasmid fragment digested with EcoRI in vitro using NovoRec Plus recombinase to construct the pSET152-TS plasmid.

[0065] Example 7 RNA-seq experiment Introducing the trigger-stabilizer gene circuit Engineering bacteria (i.e., the pSET152-TS plasmid was integrated into cebR M145 genome) as the experimental group, only the trigger gene circuit was introduced Engineering bacteria (i.e., pSET152-P QS - cebR The plasmid is integrated into the S. M145 genome) served as a control group. The cells were cultured in SMM medium and harvested by centrifugation after 60 hours of fermentation. The cells were then smeared on double-layer filter paper to remove water. The cells were then placed in 2 mL centrifuge tubes, snap-frozen with liquid nitrogen, and stored in a -80°C freezer. RNA-seq experiments were performed by Novogene Biotechnology Co., Ltd. The mRNA read count for each gene was obtained and logarithmized. The logarithmized mRNA read count for each gene was compared between the experimental and control groups.

[0066] For SMARTS characterization, EPI3 engineered bacteria served as the experimental group, and EPI0 engineered bacteria served as the control group. The cells were cultured in MYM medium and harvested by centrifugation after 24, 48, 72, and 96 hours of fermentation. The cells were then smeared on double-layer filter paper to remove water. The cells were then placed in 2 mL centrifuge tubes, snap-frozen in liquid nitrogen, and stored at -80°C. RNA-seq experiments were performed by Novogene Biotechnology Co., Ltd. Gene expression levels were calculated using the expected number of fragments per kilobase of transcript sequence per million base pairs (FPKM). The p-value threshold was determined using the false discovery rate (FDR) in multiple testing. Genes with temporal differential transcription between the experimental and control groups were compared, and significantly differentially expressed genes were screened based on a |log2 (fold change)| > 1 and a p-value < 0.05. Classification and enrichment analysis were performed using the KEGG public database.

[0067] Example 8 Construction of amplifier gfp antA and its recognized promoter P ON Derived from Streptomyces albus J1074 (Ryan F, 2014, PeerJ, 2: e253), amplified using primers antA_F / R (GTGCAGGACTGGGGGAGTTGATGAACACCGCGCACGAACTG / GACCGTTCGAATGTGAACAGGAAGGGCGATACACGAATTC) cebR antA The P gene was amplified using primers antG_F / R (GCGAAGAGGCCCGCACCGATCCCTCCCGATCCGCCGCGT / CGCATGCCTTCTCCTCTTCACTCAGCCGCGG). ONPromoter, gfp_F / R (TGAAGAGGAGAAGGCATGCGGAAGGGCGAGGAGCT / CGAATTCAAGTGCATGGCCATGCTGTC) was amplified using pSET152-sfgfp plasmid (Qiu S, 2023, MetabolicEngineering, 81: 210-226) as a template The reporter gene and PCR conditions are as shown above. The purified DNA fragment was recombined with the pSET152-TS plasmid fragment digested with BamHI and SpeI in vitro using NovoRec Plus recombinase to construct pSET152-TSA- cebR plasmid.

[0068] Example 9 Flow Cytometry Sorting Technology YEME medium (3 g / L yeast extract, 5 g / L peptone, 3 g / L malt extract, 10 g / L glucose, 340 g / L sucrose, 2 mL / L 2.5 M magnesium chloride hexahydrate and 5 g / L glycine were added after sterilization) was used to culture the promoter library. The engineered bacteria were cultured for 48 hours. The cells were harvested by centrifugation, washed with 100 g / L sucrose solution, and resuspended in 5 mL of P10 buffer (125 g / L sucrose, 0.31 g / L potassium sulfate, 2.5 g / L magnesium chloride hexahydrate, 2.5 mL / L trace element solution, and sterilized, with the following added per 80 mL: 10 mL of 0.1 M 2-(N-morpholino)ethanesulfonic acid, pH 6.5, 1 mL of 5 g / L potassium dihydrogen phosphate, and 10 mL of 36.8 g / L calcium chloride dihydrate) supplemented with 5 mg / mL lysozyme. After incubation at 37°C for 1 hour, the protoplasts were washed twice with P10 buffer and resuspended in 5 mL of P20 buffer (the sucrose concentration in the P10 buffer was changed to 200 g / L, while all other parameters remained unchanged). The mycelia were removed by filtration through cotton wool.

[0069] The prepared Streptomyces protoplasts were diluted with PBS buffer (1.76 g / L sodium dihydrogen phosphate dihydrate, 13.86 g / L sodium hydrogen phosphate dodecahydrate, 8.77 g / L sodium chloride, and the pH was adjusted to 7.4 with sodium hydroxide) to an OD of 600The fluorescence intensity (FACS) was approximately 0.1. Cell sorting was performed using a BD FACSCalibur flow cytometer with an excitation laser wavelength of 488 nm and a detector with a 530 / 30 nm bandpass filter. Ten "gates" were created based on the fluorescence signal, with each gate representing a sample. (This means that a computer was used to manually define 10 windows, ranging from weak to strong, for each sample.) 30,000 cells were collected for each sample. Data were acquired using BD FACSuite software and analyzed using FlowJo 10.6.2. Fluorescence for each sample was the geometric mean of all cells measured and normalized to the corresponding FSC value, which indicates cell size.

[0070] Example 10 Construction of a Tumbler The flipper contains the constitutive promoter P ermE controlled S. coelicolor gene, remove the P of the RBS sequence ON or P ON The gRNA backbone and 20 nt spacer sequence under the control of the mutant promoter were first ligated to the gRNA backbone. The spacer sequence was obtained from CRISPy-web (https: / / crispy.secondarymetabolites.org) and directly annealed with primers gRNA-mCherry_F / R (CTCAGTCCTAGGTATAATACTAGTGCGCATGAACTCCTTGATGATTTTAGAGCTAGAAATAGCAAGTT / AACTTGCTATTTCTAGCTCTAAAATCATCAAGGAGTTCATGCGCACTAGTATTATACCTAGGACTGAG). The spacer sequence was then recombined in vitro with the BsaI-digested pSET-dCas9Rg-2 plasmid (Yan H, 2025, Nature communications, 16: 1883) using NovoRec Plus recombinase to construct the pSET-dCas9RgmCherry-2 plasmid.

[0071] The gene and gRNA backbone were derived from the pSET-dCas9RgmCherry-2 plasmid and amplified using primers dCas9_F / R (AATCGCCTTGCAGCACATCCGCTGCAGGTCGACTCTAGAC / GAACAGGAAGGGCGATACACTACACTTTATGCTTCCGGCT) S. coelicolor The purified DNA fragments were recombined with the pSET152-TSA plasmid fragment digested with EcoRI in vitro using NovoRec Plus recombinase to construct pSET152-TSA- plasmid.

[0072] Example 11 Real-time quantitative PCR analysis To determine the amplification effect of the amplifier at the transcriptional level, the cells were cultured in SMM medium. S. coelicolor To prove the correlation between the transcription level and translation level of the promoter library, the engineered bacteria were cultured in SMM medium. For engineered bacteria, collect cells after 60 hours of fermentation by centrifugation. Spread the centrifuged cells onto double-layer filter paper to remove water and snap-freeze in liquid nitrogen. Grind the frozen cells in liquid nitrogen until powdery and place in a 1.5 mL centrifuge tube. Add 600 μL of Trizol and vortex. Aspirate 1 mL of the supernatant and add 250 μL of chloroform, mix thoroughly, and centrifuge. Transfer 650 μL of the upper aqueous phase to a new tube, add an equal volume of chloroform, vortex for 30 seconds, and centrifuge. Transfer 450 μL of the upper aqueous phase to a new tube, add an equal volume of isopropanol, mix thoroughly, and precipitate at -20°C for 10 minutes. Centrifuge and discard the supernatant. Rinse the pellet with 1 mL of 75% ethanol, centrifuge, and discard the supernatant. Dry the RNA at room temperature. Dissolve the RNA in 50 μL of DNase I solution, incubate at 37°C for 1 hour, digest genomic DNA, and inactivate DNase I at 65°C for 10 minutes to obtain total RNA.

[0073] Total RNA was reverse transcribed using the SynScript™ III cDNA Synthesis Mix Kit from Beijing Qingke Technology Co., Ltd. according to the manufacturer's instructions. The reaction temperature was maintained at 25°C for 10 min, then raised to 50°C for 15 min, and finally raised to 85°C for 5 min. The resulting cDNA was amplified using the 2×TSINGKE® MasterqPCR Mix Kit from Beijing Qingke Technology Co., Ltd. using an Applied biosystems-7500 fluorescence quantitative PCR instrument. To calculate the relative transcription level of the target gene, the PCR product was amplified using the 2×TSINGKE® MasterqPCR Mix Kit from Beijing Qingke Technology Co., Ltd. using the Applied biosystems-7500 fluorescence quantitative PCR instrument. gfp hrdBThe transcription level of the gene was used as an internal reference, and the relative transcription level of the gene was analyzed using the ΔΔCt method. The PCR program was as follows: the first stage was a hold stage, with a reaction at 95°C for 10 min; the second stage was an amplification stage, with a total of 40 cycles, each cycle consisting of annealing at 95°C for 15 s, followed by an extension at 60°C for 30 s; the third stage was a melting curve stage, with a reaction at 95°C for 15 s, then at 60°C for 1 min, and finally at 95°C for 15 s. of coelicolor hrdB The upstream primer of the gene was SCOhrdB_TF (CTGCACTCCGTTCTCGACAC), and the downstream primer was SCOhrdB_TR (CGATCTCGTCGAGGGTCTTC). of σ hrdB The upstream primer of the gene is SVEhrdB_TF (AGTCCGAGTCTGTGATGGCG), and the downstream primer is SVEhrdB_TR (TTCCACTGGGTTGGCGGAAT). Amplify the target gene The upstream primer was sfgfp_TF (GAGCTGAAGGGCATCGACTT), and the downstream primer was sfgfp_TR (TTGTCGGCGGTGATGTAGAC).

[0074] Example 12 Construction of Epirubicin-producing Strain Since the epirubicin gene cluster is derived from S. albidoflavus Therefore, firstly, pSET156- The plasmid (Qiu S, 2023, Metabolic Engineering, 81: 210-226) was integrated into the σ ATCC 10712 genome, forming 10712- Then, the method in Example 3 was used to knock out 10712- sfgfp On the strain Gene, forming 10712- sfgfp -△ In order to apply SMARTS to S. venezuelae , using primers SMARTS_F1 / R1 (CCACTCCACAGGAGGACCCAATCCTAGTTCGTCACATCCT / ACAGCTATGACATGATTACGAATTCTGAATTTTCTGTATGAGGTT) to generate the pSET152-TSA- Plasmid was used as template to amplify P cymR - dCas9 With P ermE - Sequence, using primers SMARTS_F2 / R2 (CGTAATCATGTCATAGCTGTTTCCTGTGTG / GTACCACGTCTTAAGACGTAGGGCTGCAGGTCGACTCTAGT) with pSET152-TSA- dCas9 Plasmid was used as template to amplify P QS - 、P cymR - dCas9 With P cebR -2 - The purified DNA fragment was recombined in vitro with a fragment of the pSOK616-OtcR plasmid (Qiu S, 2023, Metabolic Engineering, 81: 210-226) digested with NdeI / SpeI using NovoRec Plus recombinase to construct the pSOK616-SMARTS plasmid. This plasmid contains the trigger and stabilizer of SMARTS, as well as the amplifier and flipper of the multi-effector. These sequences remain unchanged and are therefore constructed on the same plasmid. ON The target gene controlled by the mutant promoter or the gRNA sequence targeting the target gene is variable and therefore constructed on another plasmid (see Example 12). The pSOK616-SMARTS plasmid was integrated into the 10712- dCas9 -△ On the strain genome, an EPI0 strain is formed.

[0075] Example 13 Construction of optimized strains For the optimized strain of epirubicin, S. coelicolor Originated from The DNA fragment was amplified using primers avrE_F / R (CTGAGTGAAGAGGAGAAGGCATGGGGCGGTTTTCGGTGTG / CTACACGTAAGCCGCCACCATGTGGTCCAG). S. venezuelae and All come from σ, using primers dnrI_F / R (CTGAGTGAAGAGGAGAAGGCATGCAGATCAATATGTTGGGCC / TCAGGCAAGCGCGACGGACGCGGCTGCCGG) and dnrN_F / R (CGTGCAGGACTGGGGGAGTTATGACCATCCGAGTCGTGATTGCTG / TCAGATCCAGCCGGACATACTGGCGATGCG), dnrS_F / R (CTGAGTGAAGAGGAGAAGGCATGAAGGTGCTCGTGACGGC / CTAGGTGCCGGACGCCCTGCCCGGC), dnrQ_F / R (CGTGCAGGACTGGGGGAGTTATGCCCACCACCCACGTCCG / TCACTTCTGGGCCAGCCGCAGCGAGAGC) respectively amplified DNA fragments. Originated from S. coelicolor The DNA fragment was amplified using primers panK_F / R (CTGAGTGAAGAGGAGAAGGCATGAGTATAAAAGAGCAAACGT / TTATTTGCGTAGTCTGACCTCTTCTACCGC). Originated from S. σ The DNA fragment was amplified using primers acc_F / R (CTGAGTGAAGAGGAGAAGGCATGCGCAAGGTGCTCATCGC / TCAGCGCCAGCTGTGCGGGGCGCGGAAGC). Originated from S. venezuelae , using primers bldD_F / R (CTGAGTGAAGAGGAGAAGGCATGTCCAGCGAATACGCAAAG / TCAGTTCTCCTCGTGGGCGACGGCGCGGC) to amplify the DNA fragment. The spacer sequence is CACGAGCACTTCGTGCCCCG. These target genes were fused with promoters of different strengths by PCR in vitro to form expression cassettes. These cassettes were then recombined with XbaI-digested pSET157 plasmid (Qiu S, 2023, Metabolic Engineering, 81:210-226) fragments in vitro using NovoRec Plus recombinase to construct pSET157-EPI-I1 to pSET157-EPI-I32 and pSET157-EPI-II1 to pSET157-EPI-II32 plasmids. The plasmids were then integrated into the pSET157-EPI-II32 plasmids by conjugation according to the method described in Example 3.σ On the EPI0 genome.

[0076] The method for constructing the epirubicin high-producing strain EPI3 was as follows: primers PONmut_F / R (CCCTCCCGATCCGCCGCGTG / GCCTTCTCCTCTTCACTCAG) were used to amplify P 39 、P 42 、P 46 、P 27 、P 30 Mutate the promoter sequence and separate it with 、 sfgfp 、 、 S. peucies 、 、 dox The sequences were assembled using fusion PCR (where P 39 Control target genes , P 42 Control target genes S. venezuelae , P 46 Control target genes , P 27 Control target genes dox , P 30 Control target genes , P 27 Control target genes dox ), primers PONmutF / R37 (CCCTCCCGATCCGCCGCGTG / GCAGAGGAAGAGCTACGTAG) were used to amplify the P gene without RBS. 37 Mutate the promoter sequence and combine it with the targeting The gRNA sequences were assembled using fusion PCR technology. The PCR conditions were as shown above to obtain seven P ON The target gene expression cassette controlled by the mutant promoter was recombined with the pSET157 plasmid fragment digested with XbaI in vitro using NovoRec Plus recombinase to construct the pSET157-EPI3 plasmid, which was then integrated into the pSET157 plasmid by conjugation according to the method in Example 3. S. dnmV On the EPI0 genome.

[0077] Example 14 Fermentation production of epirubicin Cultured in MS solid medium After 3 days of culture, the engineered bacteria were harvested with 2 mL of 2×YT medium. S. dox dnmV S. venezuelae dCas9 antA dCas9 dCas9 cebR cebR cymR dox dnmV avrE S. avermitilis dnrIN dnrSQ S. peucetius panK E. coli [[ID=9)]]acc coelicolor bldD S. venezuelae dnrH S. venezuelae dnrIN avrE dnrSQ panK acc bldD dnrIN avrE dnrSQ panK acc bldD dnrH venezuelae S. venezuelae venezuelaeSpores of the engineered bacteria were inoculated into MYM medium (10 g / L maltose, 4 g / L yeast extract, 10 g / L malt extract, pH adjusted to 7.0 with sodium hydroxide) for 1 day. Spores were then inoculated into MYM medium at a 4% inoculum size and cultured for 6 days. All fermentations were performed at 28°C.

[0078] Example 15 Determination of Epirubicin Epirubicin was analyzed using a Shimadzu Nexera LC-40 liquid chromatograph with a ZORBAX SB-C18 column (250 mm × 4.6 mm, 5 µm, Agilent). The mobile phases consisted of water containing 0.1% trifluoroacetic acid (phase A) and acetonitrile containing 0.1% trifluoroacetic acid (phase B). The flow rate was 0.8 mL / min, and the elution program was a gradient starting with 20% phase B, increasing to 25% over 5 minutes, to 40% over 15 minutes, to 70% over 3 minutes, maintained for 5 minutes, to 100% over 4 minutes, maintained for 2 minutes, and then decreasing to 20% over 1 minute, maintained for 5 minutes.

[0079] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. Universal artificial promoter P that responds to the Streptomyces quorum sensing system QS , characterized in that, The promoter P QS The nucleotide sequence is shown in SEQ ID NO:

1.

2. The promoter P according to claim 1 QS The bistable gene circuit used in conjunction with the invention is characterized in that: The gene circuit includes a promoter P cymR controlled cebR Fusion gene expression cassette, driven by promoter P cebR -2 controlled cymR Fusion gene expression cassette and promoter P cymR Controlled target gene expression cassette; Among them, the cebR The fusion gene is derived from Streptomyces scabies ( Streptomyces scabiei )of cebR Genes from bacteriophage λ ci Genes are connected in series; cymR The fusion gene is derived from Pseudomonas putida ( Pseudomonas putida )of cymR Genes from bacteriophage 434 ci434 Genes are tandem; or, described cebR The fusion gene is derived from Streptomyces scabies cebR Genes from bacteriophage 434 ci434 Genes are connected in series; cymR The fusion gene is derived from Pseudomonas putida cymR Genes from bacteriophage λ ci Genes are connected in series; Preferably, the two tandem genes are connected by a linker; more preferably, the amino acid sequence encoded by the linker is GGGGSGGGGS; The promoter P cymR For the cymR Gene promoters; The promoter P cebR -2 The nucleotide sequence is shown in SEQ ID NO: 2; Preferably, the target gene includes a gene involved in the production of secondary metabolites in Streptomyces.

3. A multi-effect system for finely regulating target gene expression used in conjunction with the bistable gene circuit according to claim 2, characterized in that: The multi-effect system comprises: Derived from Streptomyces albicans ( Streptomyces albidoflavus )of σ antA Factors and identification σ antA P of factor ON Promoter or P ON mutated promoter; and, Controlled by a constitutive promoter dCas9 The gene expression cassette and the P ON Promoter or P ON gRNA backbone and spacer sequence expression cassette controlled by the mutant promoter; Among them, the P ON The mutant promoter was selected from P1-P 50 Mutate any one of the promoters, P1-P 50 The N17 sequence in the mutant promoter nucleotide sequence is shown in any one of SEQ ID NOs: 4-53; Preferably, the constitutive promoter is derived from Saccharopolyspora erythraea ( Saccharopolyspora erythraea ) constitutive promoter P ermE ; Preferably, the size of the spacer sequence is 20 nt.

4. A dynamic control system for coordinating the production of secondary metabolites by Streptomyces, characterized in that: The dynamic control system comprises the promoter P of claim 1 QS , the bistable gene circuit according to claim 2 and the multi-effect system according to claim 3.

5. An expression vector, characterized in that The dynamic control system according to claim 4 is included.

6. The expression vector according to claim 5, characterized in that The dynamic control system is constructed onto the expression vector to facilitate replication and expression in microorganisms and minimize expression leakage of the gene circuit.

7. A genetically engineered Streptomyces bacterium, characterized in that: The genetically engineered bacteria is a Streptomyces comprising the dynamic control system according to claim 4 or the expression vector according to claim 5 or 6.

8. A method for constructing a high-yield epirubicin genetically engineered bacterium, characterized in that: The following steps are involved: (1) Carrying the bacteria from Streptomyces borsei ( Streptomyces peucetius ) of the doxorubicin biosynthetic gene cluster pSET156- dox The plasmid was integrated into Streptomyces venezuelae ( Streptomyces venezuelae ) on the genome, and then knock out the dnmV Gene, obtained strain △ dnmV ; (2) Design primers to amplify the P cymR - antA and P ermE - dCas9 Sequenced DNA fragments; Design primers to amplify the QS - cebR 、P cymR - cebR and P cebR -2 - cymR Sequenced DNA fragments; The purified DNA fragment and the pSOK616-OtcR plasmid fragment digested with NdeI / SpeI were recombined in vitro using NovoRecPlus recombinase to construct the pSOK616-SMARTS plasmid; (3) Integrate the pSOK616-SMARTS plasmid into the strain △ by conjugation transfer dnmV 's genome, resulting in strain EPI0; (4) Design primers to amplify P 39 、P 42 、P 46 、P 27 、P 30 Mutate the promoter sequence and then 39 Target gene dnrIN , P 42 Target gene avrE , P 46 Target gene dnS , P 27 Target gene panK , P 30 Target gene acc , P 27 Target gene bldD The sequences were assembled together using fusion PCR technology; Design primers to amplify the P 37 Mutate the promoter sequence and combine it with the targeting HkDJ The gRNA sequences of the genes are assembled together using fusion PCR technology; preferably, the targeting HkDJ The gRNA sequence of the gene is: 5′-CACGAGCACTTCGTGCCCCG-3′; Among them, P 39 、P 42 、P 46 、P 27 、P 30 、P 37 The mutant promoter is P ON Mutant promoter, same as P described in claim 3 39 、P 42 、P 46 、P 27 、P 30 、P 37 Mutated promoter; (5) The seven P ON The target gene expression cassette controlled by the mutant promoter was recombined with the pSET157 plasmid fragment digested with XbaI in vitro using NovoRec Plus recombinase to construct the pSET157-EPI3 plasmid, which was then integrated into the genome of the strain EPI0 by conjugation.

9. A high-epirubicin-producing genetically engineered bacterium constructed according to the method of claim 8.

10. Use of the genetically engineered bacteria according to claim 9 in the fermentation production of epirubicin.

Images