Single-stranded small desoxyribonucleic acid targeting various viruses and application of single-stranded small desoxyribonucleic acid

Abstract

The invention discloses a single-stranded small desoxyribonucleic acid targeting multiple viruses and application of the single-stranded small desoxyribonucleic acid. The nucleotide sequence of the single-stranded small desoxyribonucleic acid is 5 '-ACAGGGTTTTCACCCTTCCT-3', and the single-stranded small desoxyribonucleic acid targets a highly conserved region of nine types of viruses of the infected tomato, so that a one-target multi-control synergistic silencing effect is achieved. Compared with the traditional ds-sRNA, the s-sDNA disclosed by the invention shows higher stability and virus-like RNA interference efficiency in a plant body. Experiments prove that compared with ds-sRNA, the titers of 9 types of viruses and the disease index of a plant can be respectively reduced by 10%-39% and 3.3%-17.4% by foliar spraying or stalk injection of the s-sDNA with the concentration of 20-25 mu M. The invention provides an efficient, broad-spectrum and environment-friendly novel nucleic acid pesticide for viroid diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of plant gene silencing prevention and control, and in particular to a small single-stranded deoxyribonucleic acid targeting multiple types of viruses and applications thereof. Background Art

[0002] Viroids are a class of small, single-stranded, closed RNA molecules. Smaller than viruses, with genomes of 240 to 430 base pairs, they lack the protein coat common to viruses, making them the smallest known pathogens. Viroids can be divided into the families Pospiviroidae and Avsunviroidae. They infect the apical meristem and reproductive organs of plants, have high infection rates, and a wide host population, making them important quarantine and seed-transmitted pathogens. Viroids can cause problems such as dwarf plant morphology, malformed reproductive organs, and loss of marketability. Viroids were discovered relatively recently, and because their symptoms are similar to those of viral diseases, they are often treated as viral diseases for prevention and control, with limited effectiveness.

[0003] There are no fewer than 30 tomato diseases, more than 10 of which can cause significant yield losses, and new and emerging diseases are increasingly common. Previous researchers have detected Citrus exocortis viroid, Columnea latent viroid, Pepper chat fruit viroid, Potato spindle tuber viroid, Tomato chlorotic dwarf viroid, Tomato planta machoviroid, and Tomato apical stunt viroid on tomato seeds or plants, demonstrating that tomatoes can be infected by a variety of viroids.

[0004] Traditional viral disease control methods (such as antiviral protein induction and capsid protein vaccines) are completely ineffective against viroids because they lack a protein coat. Host plants can induce degradation of viroid genomes through a mechanism called post-transcriptional silencing. Double-stranded small RNA (ds-sRNA) targeting viroid genome sequences has been developed. Serving as a template for this post-transcriptional silencing mechanism, ds-sRNA acts as a nucleic acid pesticide, enabling targeted degradation of viroid genome sequences. Although ds-sRNA application technology provides new ideas for plant disease resistance, ds-sRNA developed for RNA silencing (RNA interference, RNAi) applications of viroids face the following key obstacles: 1. The currently developed ds-sRNA targets are not broad-spectrum enough: viroids in the field are diverse, and usually multiple viroids cause complex infections. Conventional targeted ds-sRNA designs for single viroid sequences are difficult to effectively cover multiple pathogens; 2. Easy hydrolysis in the body: ds-sRNA is easily degraded by RNase in plants and has a short half-life; 3. Delivery efficiency needs to be improved: ds-sRNA has a large molecular weight (>50nt) and usually needs to be combined with some nanomaterials to improve cell permeability. Summary of the Invention

[0005] The present invention aims to provide a single-stranded small DNA (ss-sDNA) targeting multiple viroids and its application to address the aforementioned existing art challenges. By optimizing molecular properties and innovating silencing mechanisms, it achieves efficient targeted silencing of viroid RNA genomes. This single-stranded small DNA (ss-sDNA) can be used to silence nine viroids that infect tomatoes, making it particularly suitable for the precise prevention and control of complex infections. This approach lays the technical foundation for the development of new, universal nucleic acid pesticides for viroid diseases.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a single-stranded small deoxyribonucleic acid having a nucleotide sequence of 5'-ACAGGGTTTTCACCCTTCCTT-3' (SEQ ID NO. 1) and a length of 21 nt. The small deoxyribonucleic acid has a single-stranded linear structure and can form a stable double-stranded complex with a conserved region of a viroid sequence.

[0008] The present invention also provides an application of the single-stranded small deoxyribonucleic acid in the preparation of a pesticide formulation for preventing and treating virus-like diseases.

[0009] Preferably, the single-stranded small deoxyribonucleic acid (ss-sDNA) is used to target and silence the sequence conserved regions of the following nine virus species: Potato spindle tuber viroid (MW311909.1), Tomato chlorotic dwarf viroid (OM867867.1), Tomato apical stunt viroid (JN872142.1), Mexican poppy viroid (L78459.1), Tomato planta macho viroid (K00817.1), Chrysanthemum stunt viroid 1 (KX096367.1), Chrysanthemum stunt viroid 2 (MN718672.1), Pepper fruit cracking viroid (MN718672.1), and Potato spindle tuber viroid (MW311909.1). Chat fruit virus (JF742638.1), Columnea latent virus (JF446917.1). The base matching rate in the target region was 100%.

[0010] The present invention also provides a method for preventing and controlling tomato virus-like diseases, comprising the step of infecting tomato plants with the single-stranded small deoxyribonucleic acid.

[0011] Preferably, the infection method comprises foliar spraying or stem injection of the tomato plants.

[0012] Preferably, the infection concentration of the single-stranded small deoxyribonucleic acid is 10-25 μM.

[0013] More preferably, the infection concentration of the single-stranded small deoxyribonucleic acid is 20-25 μM.

[0014] Preferably, the infection cycle of the single-stranded small deoxyribonucleic acid is: infection once every 3 days, for a total of 3 times.

[0015] Preferably, the infection period of the single-stranded small deoxyribonucleic acid is within 1 to 2 days after the initial onset of symptoms.

[0016] The present invention also provides a pesticide preparation for preventing and treating viroids, wherein the pesticide preparation comprises the single-stranded small deoxyribonucleic acid.

[0017] Preferably, the viroids include: Potato spindle tuber viroid, Tomato chlorotic dwarf viroid, Tomato apical stunt viroid, Mexican papita viroid, Tomato planta macho viroid, Chrysanthemum stunt viroid, Pepper chat fruit viroid and Columnealatent viroid.

[0018] The present invention discloses the following technical effects:

[0019] (1) The present invention addresses the bottleneck issues of poor ds-sRNA stability, single target, and low delivery efficiency in viroid prevention and control. Through systematic research, the present invention team has achieved the following breakthrough progress: for the first time, a single-stranded small deoxyribonucleic acid (ss-sDNA) molecule (5'-ACAGGGTTTTCACCCTTCCTT-3') was designed and verified. Through molecular property optimization (21nt single-stranded structure, 50% lower molecular weight than traditional dsRNA) and innovative silencing mechanism (using DNA to simulate RNA and induce post-transcriptional silencing mechanism), efficient targeted silencing of viroid RNA genomes was achieved. This ss-sDNA targets the conserved sequences of 9 viroids that can infect tomatoes, with a target region binding rate of 100%.

[0020] (2) The ss-sDNA provided by the present invention has a significantly higher inhibitory reduction in titer of 9 types of viroids than ds-sRNA, and the reduction in titer of viroids is concentrated between 10% and 39%.

[0021] (3) The disease index of most viroids was inhibited and reduced better than that of ds-sRNA, and the reduction of plant disease index was mainly concentrated between 3.3% and 17.4%.

[0022] (4) Can penetrate into all tissue cells.

[0023] (5) The persistence is that ss-sDNA can still be detected in various organs 6 days after infection, and the silencing efficiency remains at a high level.

[0024] (6) Compared with existing technologies, the advantages are high efficiency: at the same concentration, the silencing efficiency of ss-sDNA is significantly improved compared to dsRNA; broad spectrum: a single sequence can simultaneously silence 9 types of viruses, while traditional ds-sRNA can only target a single type. Experiments have confirmed that the molecule has a better efficiency in silencing viroid genomes than ds-sRNA, has a good broad-spectrum effect, and has strong permeability to plant cells, laying a technical foundation for the development of a new type of universal nucleic acid pesticide for viroid diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 Photos of tomato plants infected with or without nine virus types; A: healthy control; B: potato tuber spindle viroid; C: tomato chlorotic dwarf viroid; D: tomato top dwarf viroid; E: Mexican poppy viroid; F: tomato male plant viroid; G: chrysanthemum stunt viroid 1; H: chrysanthemum stunt viroid 2; I: pepper fruit cracking viroid; J: snapdragon latent viroid;

[0027] Figure 2 Figure 3. Penetration and localization of ss-sDNA in tomato cells after leaf spraying and stem injection. A: Distribution of ss-sDNA in the stem (longitudinal section); B: Distribution of ss-sDNA in the petiole (cross section); C: Distribution of ss-sDNA in the leaf (longitudinal section); D: Distribution of ss-sDNA in the stem apex (longitudinal section). Red fluorescence indicates cell wall autoluminescence; green fluorescence indicates ss-sDNA.

[0028] Figure 3 Detection of the persistence of ds-sRNA and ss-sDNA in tomato cells in the stem 6 days after stem injection; A: Presence of ds-sRNA; B: Presence of ss-sDNA; Red fluorescence is cell wall self-luminescence; Green fluorescence indicates the presence of small nucleic acid signals. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Example 1 Screening, Synthesis and Inoculation of Nine Tomato Viruses

[0035] 1. Screening of viroid species with conserved base sequences of more than 21nt

[0036] 100 viroid genome sequences were randomly searched through the public bioinformatics database NCBI GenBank. After downloading the FASTA format, the homology of the above genome sequences was analyzed using a sequence comparison tool, and 9 viroids with the same 21nt base sequence were screened out, as shown in Table 1.

[0037] Table 19 virus information for testing

[0038]

[0039]

[0040] 2. Artificial synthesis of 9 types of viruses

[0041] The viroid cDNA genome was synthesized using a gene synthesizer, and sequence information was obtained from NCBI GenBank. The T-easy (Zeye, Shanghai, ZY-62479) recombinant plasmid (manufactured by Beijing Qingke) containing the synthesized viroid genome was digested at 37°C using the restriction endonucleases Sac I (TaKaRa, Japan) or Spe I (TaKaRa, Japan). The linearized recombinant plasmid containing the target fragment was transcribed in vitro using T7 RNA polymerase (Biyuntian, Shanghai) according to the manufacturer's instructions. The whole RNA viroid genome product was stored at -20°C until further use.

[0042] 3. Artificial inoculation of 9 virus types on tomatoes

[0043] In vitro transcripts of nine virus strains were dissolved in 1% K₂HPO₄ buffer and mechanically inoculated using a mixture of sterile quartz sand onto the lowest, expanded leaves of four-leaf, one-heart-stage tomato seedlings (A1isa Craig). Approximately 200 ng of the inoculum was inoculated per plant. Inoculation with K₂HPO₄ buffer served as a negative control. Each virus strain was inoculated with 10 plants per replicate, for a total of three replicates.

[0044] After inoculation, the plants were cultured in an environment with 18 h light / 6 h dark, 20% light intensity, 25°C / 18°C day / night temperature, and 80% relative humidity.

[0045] After 30 days of infection, 10 leaves were collected and mixed into one sample. The infection of various viruses in the leaves was detected by RT-PCR and RT-qPCR, and the symptoms were recorded. Figure 1 The primers used for RT-PCR and RT-qPCR are shown in Table 2:

[0046] Table 2 Detection primers

[0047]

[0048]

[0049] RT-PCR amplification system (20 μL): 1 μL template, 7 μL ddH2O, 10 μL 2× RealStar Fast SYBR qPCR Mix, and 1 μL each of upstream and downstream primers.

[0050] RT-PCR amplification program: pre-denaturation at 95°C for 2 min; 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 20 s, and extension at 72°C for 30 s; denaturation at 95°C for 10 s; annealing at 65°C for 60 s, extension at 97°C for 1 s, and extension at 37°C for 30 s; and storage at 4°C.

[0051] Depend on Figure 1It can be seen that all nine types of viruses can affect the normal growth of tomato plants.

[0052] Example 2 Design, Synthesis and Aqueous Solution Preparation of ss-sDNA

[0053] 1. Design of ss-sDNA

[0054] Based on the conserved base sequences of the nine viral species, a 21-nt ss-sDNA sequence was designed for targeting. The nucleotide sequence is 5'-ACAGGGTTTTCACCCTTCCTT-3' (SEQ ID NO. 1). The targeted regions of the ss-sDNA for the nine viral species are shown in bold (the targeted region sequence is in bold).

[0055] (1) Potato spindle tuber viroid (MW311909.1) is 359 bp long:

[0056] cggaactaaactcgtggttcctgtggttcacatctgacctcctgagcagaaaagaaaaaagaaggcggctcggaggagcgcttcagggatccccggggaaacctggagcgaactggcaaaaaaggacggtggggagtgcccagcggccgacaggagtaattcccgccgaaacagggtttt cacccttcctttcttcgggtgtccttcctcgcgcccgcaggaccacccctcgccccctttgcgctgtcgcttcggctactacccggtgga aacaactgaagctcccgagaaccgctttttctctatcttacttgcttcggggcgagggtgtttagcccttggaaccgcagttggttcct.

[0057] (2) Tomato chlorotic dwarf viroid (OM867867.1) is 360 bp long:

[0058] cggaactaaactcgtggttcctgtggttcacacctgacctcctgtgcagaaaagaaaaaagataggcggctcggaggagcgcttcagggatccccggggaaacctggagcgaactggcaaaaggcggcagggagcttgtggaaggcgaaacaggagtaatcccgtgtagaaacagggttttcacccttcctttcttctgcggtttccttcctttgcgcgccactcgacccctcgcccccttgcgctgtcgcttcggcaactacccggtggaaacaactgaagctcccgagaaccgctttttctctatcttgctgctaccggggcgagggtgtttagcccttggaaccgcagttggttcct。

[0059] (3) Tomato apical stunt viroid (JN872142.1) is 364 bp in length:

[0060] cgggaactttcttgaggttcctgtggtgctcacctgaccctgcaggcatcaagaaaaaagaatggcgcggaggagaagaagtccttcagggatccccggggaaacctggaggaagtcgaggtcgggggcttcggactactccttcgtgagacaggagtaatccccgctgaaacagggttttcacccttcctttcttcgggtttccttcctctcgcctggagaggtcttcggccctcgcccggagcttctctctggagactacccggtggaaacaactgaagcttcaaccctctcgcgctttttctctatctttgttgctctccgggcgagggtgaaagcccgtggaaccctggaaggagtccct。

[0061] (4) Mexican papita viroid (L78459.1) is 360 bp in length:

[0062] cgggatcttttccttgtggttcctgtggttcacacctgacctccagcccaggaaagaaaaaagaaaggcggctcggaggagcgcttcagggatccccggggaaacctggagcgaactggcaaaggagtcgcggctggggagtctcctcagacaggagtaatccccgctgaaacagggttttcacccttcctttcttcgggtttccttcctctgtggtcgacaccctcgcccgcctctctgcgctgtcgcttcggctactacccggtggaaacaactgaagctcccgagaaccgctttttctctatcttgctggcgcaggggcgagggtggaaagccctggaacccgctggatgggtccct。

[0063] (5) Tomato plantamacho viroid (K00817.1) is 360 bp long:

[0064] cgggatcttttccttgtggttcctgtggtacacacctgacctcctgaccagaaaagaaaaaagaattgcggccaaaggagcgcttcagggatccccggggaaacctggagcgaactggcgaaggagtcgcggctggggagtctcccagacaggagtaatccccgctgaaacagggttttcacccttcctttcttcgggtttccttcctctgcggtcgacaccctcgcccgcttctcttgcgctgtcgcttcggagactacccggtggaaacaactgaagctcccaagcgccgctttttctctatcttgctggctccggggcgagggtggaaaaccctggaacccttcgaaaagggtccct。

[0065] (6) Chrysanthemum stunt viroid 1 (KX096367.1) is 354 bp long:

[0066] aaagaaatgaggcgaagaagtccttcagggatccccggggaaacctggaggaagtccgacgagatcgcggctggggcttaggaccccactcctgcgagacaggagtaatcctaaacagggttttcacccttcctttagtttccttcctctcctggagaggtcttctgccctagcccggtcttcgaagcttcctttggctactacccggtggaaacaactgaagcttcaacgcctttttttcctatcttctttagcaccgggctagggagtaagcccgtggaaccttagttttgttccctcgggacttacttgtggttcctgtggtgcactcctgaccctgctgctttgaaagaa。

[0067] (7) Chrysanthemum stunt viroid 2 (MN718672.1) is 354 bp in length:

[0068] cgggacttacttgtggttcctgtggtgcactcctgaccctgctgctttgaaagaaaaagaaatgaggcgaagaagtccttcagggatccccggggaaacctggaggaagtccgacgagatcgcggctggggcttaggaccccactcctgcgagacaggagtaatcctaaacagggttttcacccttcctttagtttccttcctctcctggagaggtcttctgccctagcccggtcttcgaagcttcctttggctactacccggtggaaacaactgaagcttcaacgcctttttttcctatcttctttagcaccgggctagggagtaagcccgtggaaccttagttttgttccct。

[0069] (8) Pepper chat fruit viroid (JF742638.1) is 349 bp in length:

[0070] ccggattcttctaagggtgcctgtggtgcctcccccgaagcccgcttagggaaaaagaaaggggaagcaagcatctcctgttcagggatccccggggaaacctggacagaccgggcggagaagcgcacgagcggtaccgtcttctgacaggagtaatcccagtagaaacagggtt ttcacccttcctttcttcgggtttccttcctcagtcgaccggtccgcgtcggccttctcgcgcactgctgtccggctactacccggtggatacaactgacagaggtgctttttcttccacccgacttctaccgacgcggccgggagtgaagctacccgggacccgaggggatct.

[0071] (9) Columnea latent viroid (JF446917.1) 368 bp long:

[0072] cggaactaaactcgtggttcctgtggttcacacctgaccctgcagccatgcaaaggaaaaagaacgggagagagagcgcaagagcggtctcaggagccccggggcaactcagaccgagcggggtcttgaccagtggcgagcgccctgttcagacaggagtaatcccagcagaaacagggttttc acccttcctttcttctggtttccttcctctgcttcagcggcctcgcccggagtcttgaccagcgcaggttctgacgcgaccggtggcatcac cgagtttcgctcaaagcctcaatctcctttttctcattctagcttggtctccgggcgagggtgtttagcccttggaaccgcagttggttcct.

[0073] 2. Synthesis of ss-sDNA

[0074] The ss-sDNA was artificially synthesized by a gene synthesizer (Beijing Qingke), with a spatial conformation of a single-stranded linear structure and HPLC purification with a purity of ≥98%.

[0075] 3. Preparation of ss-sDNA aqueous solution

[0076] ss-sDNA was dissolved in sterile distilled water at room temperature, and the concentrations of the working solution were 0, 10, 15, 20, and 25 μM.

[0077] Example 3 Application of ss-sDNA to Disease Resistance of Virus-Susceptible Tomatoes

[0078] 1. Use ds-sRNA as a control to detect the efficiency of ss-sDNA

[0079] According to the above method, ds-sRNA with a positive chain sequence of 5'-ACAGGGTTTTCACCCTTCCTT-3' was synthesized, and the ds-sRNA was dissolved in sterile distilled water at room temperature. The concentration of the working solution was 0, 10, 15, 20, and 25 μM. The ds-sRNA and ss-sDNA were sprayed on 9 virus-susceptible tomatoes by leaf spray. The specific spraying method is: using an atomizing nozzle with an aperture of 50 μm, spray 2 mL of solution per plant to ensure that the front and back of the leaves are evenly misted. Infect once every 3 days, for a total of 3 times. The titer of various viruses in the leaves was detected by RT-qPCR (the primers used are the same as those in Example 1). The titer is the relative expression of the virus-like virus, and the titer is 2 μM. -ΔΔCt The results were calculated using the real-time quantitative PCR and 2(-Delta DeltaC(T)) method (Livak KJ, Schmittgen TD. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta DeltaC(T)) Method. Methods. 2001; 25(4): 402-408). The experimental results are shown in Table 3. The disease index of the tomato plants was also measured and calculated as follows: Viroid disease: Level 0: No symptoms; Level 1: Slight curling of leaves; Level 2: Curling of leaves; Level 3: Level 2 + Dwarfing; Level 4: Level 3 + Partial leaf necrosis; Level 5: Level 4 + Minor leaf loss; Level 6: Level 5 + Leaf loss; Level 7: Level 6 + Necrotic markings on the stem. Disease index = [(Number of diseased plants × Number of disease levels) / (Total number of plants × 7)] × 100. The experimental results are shown in Table 4.

[0080] Table 3 Comparison of silencing efficiency of ss-sDNA and ds-sRNA against 9 tomato virus genomes (RT-qPCR test results, control value normalized to 1)

[0081]

[0082] Table 4 Comparison of the inhibitory efficiency of ss-sDNA and ds-sRNA on 9 tomato virus diseases (disease index test results)

[0083]

[0084]

[0085] As shown in Tables 3 and 4, ss-sDNA was generally more effective than ds-sRNA at all concentrations against viroids. Therefore, subsequent studies used ss-sDNA as the research subject. The differences in inhibition rates for viroid titers and disease index between the two are shown in Tables 5 and 6, respectively. 20-25 μM ss-sDNA showed the best effect, with no significant difference between the two concentrations. Therefore, 25 μM ss-sDNA was used in subsequent studies.

[0086] Table 5 The difference in inhibition rate between ds-sRNA and ss-sDNA on viroid titer

[0087]

[0088] Note: The control sample values ​​were normalized to 1.00.

[0089] Table 6 The difference in inhibition rate between ds-sRNA and ss-sDNA on the disease index of viroid

[0090]

[0091]

[0092] From the results in Tables 5 and 6, it can be seen that 25 μM ss-sDNA can reduce the titers of nine types of viruses and the plant disease index by 10%-39% and 3.3%-17.4%, respectively, compared with ds-sRNA.

[0093] 2. Screening of infection methods

[0094] Foliar spraying: Using a 50 μm atomizer, spray 2 mL of a 25 μM ss-sDNA solution per plant, ensuring uniform coverage of both the front and back of the leaves. RT-qPCR was used to measure the titer of various viruses in the leaves, and the disease index of the tomato plants was also determined.

[0095] Stem injection: 20 μL of 25 μM ss-sDNA solution was pipetted into the stem of infected tomatoes 5 cm above the growing medium. The titers of various viruses in the leaves were determined by RT-qPCR, and the disease index of the tomato plants was also measured.

[0096] The cells were infected once every three days for a total of three times. The inhibitory efficiencies of 25 μM ss-sDNA leaf spraying and stem injection against viroids are shown in Table 7.

[0097] Table 7 Inhibitory efficiency of leaf spraying and stem injection on viroids

[0098]

[0099]

[0100] As can be seen from Table 7, there is no significant difference in the efficiency of silencing the nine types of viruses between leaf spraying and stem injection, so both methods are suitable for this application.

[0101] Example 4 ss-sDNA permeability detection

[0102] 1. ss-sDNA labeling

[0103] The ss-sDNA was fluorescently labeled using a FAM labeling kit (AM1634, Thermo Fisher Scientific, USA) according to the manufacturer's instructions.

[0104] 2. Preparation of samples to be observed

[0105] 20 μL of labeled ss-sDNA was injected into the middle of the main stem of PSTVd-susceptible tomatoes. After incubation for 2 h, non-injected sites, young and unfolded leaves were selected, the surface was washed, and paraffin sections of petioles and leaves were prepared.

[0106] 3. Observation of ss-sDNA permeability

[0107] Confocal microscopy was performed using a confocal laser scanning microscope (ZEISS, LSM780, Germany). FAM-labeled sRNA was excited with a 495 nm laser and fluorescence was detected at 520 nm. ddH2O labeling reaction was used as a control. The detection results are shown in Figure 2 .Depend on Figure 2 It can be seen that the ss-sDNA fluorescence signal is distributed in most cells, indicating that ss-sDNA has good cell permeability.

[0108] Example 5 Observation of ss-sDNA persistence

[0109] 1. Observation of ss-sDNA degradation resistance

[0110] Following the procedure described in Example 3, FAM-labeled ds-sRNA and ss-sDNA were injected into PSTVd ​​tomato stems. Samples were collected 0, 2, 4, 6, 8, and 10 days after injection to observe the appearance of labeled fluorescence in various tissue cells. The results are shown in Table 8.

[0111] Table 8 Presence of intracellular fluorescence response at different days after small nucleic acid treatment

[0112]

[0113] The results in Table 8 show that compared with ds-sRNA, ss-sDNA has a longer persistence and stronger resistance to degradation. Fluorescence can still be observed after 6 days of treatment. Figure 3 , while the ds-sRNA fluorescence reaction disappeared on the 6th day.

[0114] 2. Detection of the persistence of ss-sDNA against viroids

[0115] Following the procedures described in Example 3, FAM-labeled ds-sRNA and ss-sDNA were injected into PSTVd ​​tomato stems. Samples were collected 0, 2, 4, 6, 8, and 10 days after injection, and the viroid genome titer was determined by RT-qPCR. The results are shown in Table 9. Disease indexes were calculated at different days after treatment, as shown in Table 10. Using ds-sRNA as a control, the sustained inhibitory effect of ss-sDNA on PSTVd ​​was comprehensively evaluated.

[0116] Table 9 Changes in PSTVd ​​titer on different days after small nucleic acid treatment

[0117]

[0118] Table 10 Changes in disease index of susceptible plants on different days after small nucleic acid treatment

[0119]

[0120] As shown in Tables 9 and 10, ss-sDNA is more persistent than ds-sRNA in suppressing viroid titer and disease index, and therefore has greater superiority.

[0121] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A small single-stranded deoxyribonucleic acid, characterized in that: The nucleotide sequence of the single-stranded small deoxyribonucleic acid is 5'-ACAGGGTTTTCACCCTTCCTT-3'.

2. Use of the single-stranded small deoxyribonucleic acid according to claim 1 in the preparation of a viroid pesticide formulation.

3. The use according to claim 2, characterized in that The viroids include: Potato spindle tuber viroid, Tomato chlorotic dwarf viroid, Tomato apical stunt viroid, Mexican papita viroid, Tomato planta macho viroid, Chrysanthemum stunt viroid, Pepper chat fruit viroid and Columnea latent viroid.

4. A method for preventing and controlling tomato viroids, characterized in that: The method comprises the steps of infecting tomato plants with the single-stranded small deoxyribonucleic acid according to claim 1.

5. The method for controlling tomato viroids according to claim 4, wherein: The infection method includes spraying the leaves or injecting the stems of the tomato plants.

6. The method for controlling tomato viroids according to claim 4, wherein: The infection concentration of the single-stranded small deoxyribonucleic acid is 10 to 25 μM.

7. The method for controlling tomato viroids according to claim 6, characterized in that: The infection concentration of the single-stranded small deoxyribonucleic acid is 20-25 μM.

8. The method for controlling tomato viroids according to claim 4, wherein: The infection cycle of the single-stranded small deoxyribonucleic acid is: infection once every 3 days, for a total of 3 times.

9. A pesticide formulation for controlling viroids, characterized in that: The pesticide formulation comprises the single-stranded small deoxyribonucleic acid according to claim 1.

10. The pesticide formulation for controlling viroids according to claim 9, characterized in that: The viroids include: Potato spindle tuber viroid, Tomatochlorotic dwarf viroid, Tomato apical stunt viroid, Mexican papitaviroid, Tomato planta macho viroid, Chrysanthemum stunt viroid, Pepper chat fruit viroid and Columnea latent viroid.

Images