SiRNA for targeted inhibition of expression of FTO gene in intramuscular fat cells and application

Abstract

The invention belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken FTO expression and application thereof. The siRNA comprises FTO-858 (Fluorine Doped The siRNA can inhibit the expression of the chicken FTO gene in a targeted manner, after the siRNA is transferred into chicken primary intramuscular fat cells, the expression of the chicken FTO gene can be effectively reduced, the inhibition efficiency reaches 50% or above, and the knock-down efficiency is very high; the siRNA identifies the gene function by specifically knocking down the expression of the chicken FTO gene in vitro, can be used as a molecular marker to be applied to genetic breeding of intramuscular fat deposition of high-quality broilers, and has great economic value and scientific research value.

Description

Technical Field

[0001] The present invention relates to the technical field of poultry breeding, and in particular to an siRNA for targetedly inhibiting the expression of the FTO gene in intramuscular adipocytes and its application. Background Art

[0002] The fat mass and obesity-associated gene (FTO) is expressed in the nucleus and cytoplasm, regulating processes such as fatty acid transport by controlling the expression of lipid-related genes. Studies have shown that FTO polymorphisms are closely associated with obesity and metabolic dysfunction in humans. For example, variants at loci rs1421085 and rs3751812 are associated with an increased risk of obesity, and FTO mRNA levels in adipose tissue are positively correlated with body mass index (BMI). In mammals, FTO deficiency increases energy expenditure and reduces body fat in mice, while overexpression leads to a dose-dependent increase in fat mass.

[0003] Given the significant differences in fat metabolism between poultry and mammals, and the important role that FTO plays in the differentiation process of chicken myoblasts, it is speculated that FTO may affect the deposition of intramuscular fat by regulating the transdifferentiation of chicken myoblasts into adipocytes; at the same time, FTO may be involved in regulating the lipid synthesis and decomposition pathways of chicken intramuscular adipocytes, thereby playing a key role in the formation of intramuscular fat content and quality. Summary of the Invention

[0004] In response to the shortcomings of the existing technology, the present invention provides a siRNA that targets and inhibits the expression of the FTO gene in intramuscular adipocytes and its application. After being transferred into primary chicken intramuscular adipocytes, it can effectively reduce the expression of the chicken FTO gene, with an inhibition efficiency of more than 50%, and a very high knockdown efficiency.

[0005] To achieve the above objectives, the present invention is implemented through the following technical solutions:

[0006] The present invention provides an siRNA for targeting and inhibiting the expression of chicken FTO, wherein the siRNAs are FTO-205, FTO-858 and FTO-1286.

[0007] The FTO-205 includes a primer having a nucleotide sequence shown in SEQ ID NO.1 and a primer having a nucleotide sequence shown in SEQ ID NO.2.

[0008] The FTO-858 includes a primer having a nucleotide sequence shown in SEQ ID NO.3 and a primer having a nucleotide sequence shown in SEQ ID NO.4.

[0009] The FTO-12860 includes a primer having a nucleotide sequence shown in SEQ ID NO.5 and a primer having a nucleotide sequence shown in SEQ ID NO.6.

[0010] Accordingly, the present invention provides the use of the siRNA targeted to inhibit chicken FTO expression in the genetic breeding of high-quality broiler chickens for intramuscular fat deposition.

[0011] The present invention has the following beneficial effects:

[0012] The present invention provides a siRNA that can target and inhibit the expression of the chicken FTO gene. When transferred into primary chicken intramuscular adipocytes, this siRNA effectively reduces FTO gene expression, achieving an inhibition efficiency exceeding 50%, a high knockdown efficiency. By specifically knocking down FTO gene expression in vitro, this siRNA identifies gene function and can be used as a molecular marker in the genetic selection of high-quality broiler chickens for intramuscular fat deposition, possessing significant economic and scientific value. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The expression changes of FTO gene after exogenous transfection of FTO siRNA (different letters represent significant differences (P < 0.05), the same letters represent no significant differences (P > 0.05));

[0014] Figure 2 The changes in intramuscular adipocyte proliferation after exogenous transfection of FTO siRNA (* indicates significant difference (P < 0.05));

[0015] Figure 3 The figure shows the changes in lipid droplet deposition in intramuscular adipocytes after exogenous transfection of FTO siRNA. DETAILED DESCRIPTION

[0016] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0017] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0018] Example 1 Screening of the best siRNA sequence targeting chicken FTO gene

[0019] 1.1 FTO siRNA design

[0020] The chicken FTO gene mRNA sequence was obtained from the NCBI online database (accession number: NM_001185147.1). Using siCatch™ siRNA design software, three pairs of siRNAs targeting the CDS region of the chicken FTO gene were designed. Each siRNA sequence was suffixed with a TT overhang. The designed siRNAs were synthesized by Suzhou Jima Biotechnology Co., Ltd. After synthesis, each OD of synthesized siRNA was diluted with 125 μL of DEPC water to a final concentration of 20 μM / μL and stored at -20°C until use. The sequences of the three designed siRNA pairs are shown in Table 1.

[0021] Table 13 pairs of siRNA sequences

[0022]

[0023] 1.2siRNA transfection of primary chicken intramuscular adipocytes

[0024] Chicken intramuscular adipocytes (IMA) isolated from breast muscle tissue of 19-embryonic-age chickens were used as transfected cells. These primary IMA cells were seeded into 12-well culture plates. When the cells reached a density of 60-70%, the culture medium was aspirated and replaced with fresh serum-free culture medium. Three pairs of siRNAs targeting the chicken FTO gene and a negative control siRNA (NC) were then transfected into the IMA cells using the transfection reagent Lipofectamine 3000. Three replicate wells were set up for each group.

[0025] The specific transfection system is as follows: experimental group: 175 μL opti-MEM medium + 5 μL siRNA with a final concentration of 20 μM + 8 μL Hiperfect transfection; control group: 175 μL opti-MEM medium + 5 μL Negative with a final concentration of 20 μM + 8 μL Hiperfect transfection, incubate for 10 minutes to form a transfection complex, and transfect into the culture medium.

[0026] 1.3 RNA extraction and cDNA preparation

[0027] 24 hours after transfection, each well was washed three times with PBS. 0.6 ml of TROZL was added to the culture dish to collect the cells. Total RNA was extracted from the FTO siRNA-transfected and control groups using the RNA isolater Total RNA Extraction Reagent kit (Nanjing Novozymes Biotechnology Co., Ltd.). RNA concentration was measured using a nucleic acid quantifier. cDNA synthesis was performed according to the instructions for the reverse transcription kit (Dalian Takara Biotechnology Co., Ltd.).

[0028] 1.4 Real-time fluorescence quantitative PCR detection of siRNA interference efficiency

[0029] Real-time quantitative PCR (qPCR) was performed using the SYBR Green I assay using Hi Script III RT SuperMix for qPCR (with gDNAwiper) reagent from Nanjing Novozymes Biotechnology Co., Ltd. The efficiency of siRNA-specific knockdown of chicken FTO gene expression was determined using three replicates per sample. The Q-PCR reaction protocol was as follows: 95°C for 15 min, followed by 40 cycles of 94°C for 15 s, 55°C for 30 s, and 70°C for 30 s.

[0030] Upstream primer (SEQ ID NO.7): 5'-CTGGTCCTCCAAGAAGTTCG-3'

[0031] Downstream primer (SEQ ID NO.8): 5'-CTGCTCTTCTGGCAAGCTCT-3'

[0032] 1.5 The primer pair nucleic acid sequences for detecting chicken internal reference GAPDH gene expression are as follows:

[0033] Upstream primer (SEQ ID NO.9): 5'-AGAAGGCTGGGGCTCATCT-3'

[0034] Downstream primer (SEQ ID NO.10): 5'-CAATGCCAAAGTTGTCATG-3'

[0035] The efficiency of 3 pairs of siRNA in specifically knocking down chicken FTO gene expression is as follows Figure 1 As shown. Figure 1 Of the three siRNA pairs, only FTO-858 siRNA significantly inhibited FTO gene expression in intramuscular adipocytes (IMUs) compared to the control group (P < 0.05), achieving the highest inhibition efficiency of over 50%. FTO-858 was subsequently selected for use in studies of the FTO gene's role in IMU fat deposition in chickens. The sense strand of FTO-858 is GCTGAAGAAGCTACTGATTTT, while the antisense strand is AATCAGTAGCTTCTTCAGCTT (antisense strand).

[0036] Effects of 1.6FTO gene knockdown on cell proliferation and lipid deposition

[0037] After 24h and 48h of FTO-858 siRNA transfection, the changes in cell proliferation were detected using the CCK8 kit. Figure 2As shown in Figure 3, after transfection with FTO-858 siRNA, the proliferation of chicken primary intramuscular adipocytes was significantly increased (P<0.05). Oil red O staining 4 days after transfection showed that the lipid droplet deposition in intramuscular adipocytes was significantly higher than that in the control group (P<0.01). Figure 3 Experiments have shown that the FTO gene has the effect of inhibiting the proliferation of intramuscular adipocytes and promoting fat deposition.

[0038] The above description is only a preferred embodiment of the present invention, but is not intended to limit the present invention. Those skilled in the art can use the technical content disclosed above to make possible changes and modifications to the present invention without departing from the scope of the technical solution of the present invention, or modify it into an equivalent embodiment with equivalent changes. Without departing from the content of the technical solution of the present invention, any simple modification, equivalent change and modification made to the above embodiment based on the technical essence of the present invention shall fall within the protection scope of the technical solution of the present invention.

Claims

1. A siRNA targeting and inhibiting the expression of chicken FTO, characterized in that: The siRNA is FTO-858; the FTO-858 comprises a primer having a nucleotide sequence shown in SEQ ID NO.3 and a primer having a nucleotide sequence shown in SEQ ID NO.

4.

2. Use of the siRNA targeting and inhibiting chicken FTO expression according to claim 1 in the genetic breeding of high-quality broiler chickens with intramuscular fat deposition.

Images