Pinus massoniana gene silencing method
By using a gene silencing method based on plant virus vectors and combining it with vacuum infiltration infection technology, the problem of low gene silencing efficiency in Pinus massoniana was solved, efficient gene silencing and wide applicability were achieved, and the research on gene function and genetic improvement of Pinus massoniana were promoted.
Patent Information
- Application Number
- CN202510874263.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-27
- Publication Date
- 2025-09-12
AI Technical Summary
Existing technologies make it difficult to efficiently achieve gene silencing in Masson pine. Traditional transgenic technology is inefficient in Masson pine, resulting in slow progress in gene function research.
A gene silencing method based on plant virus vectors is used to synthesize specific nucleotide fragments, construct recombinant plant virus vectors and introduce them into Pinus massoniana plant materials using Agrobacterium-mediated method, mechanical inoculation method or nanomaterial delivery method, combined with vacuum infiltration infection technology to screen Pinus massoniana plants with target gene silenced.
The high efficiency and wide applicability of gene silencing in Masson pine have been achieved, with a silencing efficiency of up to 79.1%, which has broadened the application scope of gene function research and provided a new method for genetic improvement and variety breeding of Masson pine.
Smart Images

Figure CN120624544A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to plant genetic engineering, in particular to a gene silencing method for masson pine. Background Art
[0002] Masson pine is a widely distributed native tree species unique to subtropical regions. Its trunk is straight, its bark reddish-brown, and its needles are often bundled in bundles of two, 12-20 cm long. Its cones are chestnut-brown when mature. Masson pine is highly adaptable and grows rapidly, and its wood is an important industrial raw material, widely used in industries such as papermaking, construction, mining pillars, furniture, and transportation. Its byproducts, such as pine resin, pine needles, and pine pollen, also have extremely high economic value. Masson pine wood has a mature degreasing process, and its pulping, papermaking, and wood-based panels perform well. It is a core raw material for the forest products industry, and market demand continues to grow. It has become a key tree species with both ecological and economic value.
[0003] Plant genetic engineering faces significant challenges in Pinus massoniana research. Due to the long growth cycle and low efficiency of genetic transformation, traditional transgenic techniques are difficult to apply effectively to the study of its gene function, resulting in slow progress. Against this backdrop, virus-induced gene silencing (VIGS) offers unique advantages. VIGS is an RNA-based molecular tool that specifically inhibits endogenous gene expression by infecting plants with recombinant viruses carrying target gene fragments. However, no VIGS method currently exists for Pinus massoniana. Summary of the Invention
[0004] Purpose of the invention: The purpose of the present invention is to provide a gene silencing method for Pinus massoniana based on plant virus vectors.
[0005] Technical solution: The gene silencing method of Masson pine of the present invention comprises the following steps:
[0006] (1) Synthesizing specific nucleotide fragments based on the target gene;
[0007] (2) constructing specific nucleotide fragments into plant virus vectors;
[0008] (3) introducing the recombinant plant virus vector obtained in step 2 into the Masson pine plant material;
[0009] (4) Screening and obtaining Pinus massoniana plant materials with target gene silencing.
[0010] Preferably, the step 1 comprises:
[0011] (11) Design amplification primers based on the target gene;
[0012] (12) RNA was extracted from Pinus massoniana and reverse transcribed to obtain cDNA. Amplification primers were used to amplify specific nucleotide fragments by PCR.
[0013] Preferably, the plant virus vector in step 2 is selected from any one of a tobacco rattle virus vector, a cucumber mosaic virus vector, a tobacco mosaic virus vector, and a tomato golden mosaic virus vector.
[0014] Preferably, the plant virus vector is a tobacco rattle virus vector, ie, a pTRV vector.
[0015] Preferably, the method for introducing the Masson pine plant material in step 3 is selected from any one of an Agrobacterium-mediated method, a mechanical inoculation method, and a nanomaterial delivery method.
[0016] Preferably, the method of introducing the Masson pine plant material is an Agrobacterium-mediated method.
[0017] Preferably, the step of introducing the Masson pine plant material in step 3 comprises:
[0018] (31) transforming the recombinant plant virus vector obtained in step 2 into Agrobacterium competent cells, and screening to obtain the recombinant plant virus vector Agrobacterium;
[0019] (32) preparing an infection solution containing the recombinant plant virus vector Agrobacterium and a 0.1% volume concentration of an organosilicon surfactant;
[0020] (33) Select Pinus massoniana plant materials, immerse them in the infection solution, and evacuate to 0.7-0.9 kPa for 4-6 min.
[0021] Preferably, the Pinus massoniana plant material in step 31 is a Pinus massoniana seedling less than 1 year old.
[0022] Preferably, the Masson pine seedlings are 20-40 days old.
[0023] Preferably, the concentration of Agrobacterium in the infection solution in step 32 is OD 600 The value is 0.75-1.75.
[0024] Preferably, the screening in step 4 is any one of resistance gene screening, reporter gene screening, and molecular biological detection.
[0025] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: 1. This method can effectively achieve gene silencing in Masson pine. The experimental results based on the phytoene dehydrogenase gene show that the silencing efficiency can reach 79.1%; 2. The experimental results based on the plant geranylgeranyl pyrophosphate synthase 6 and NAC transcription factor family 5 genes show that this method has wide applicability and can be used for silencing different types of genes; 3. This method broadens the scope of application in the field of gene function research in Masson pine, provides the possibility for in-depth research on gene functions in multiple aspects such as growth and development, metabolic regulation, etc., and provides new ideas and methods for genetic improvement and variety breeding of Masson pine, which is conducive to breeding Masson pine varieties with specific phenotypes or excellent traits, and improving their economic value and ecological benefits. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 This is the gel electrophoresis diagram of the specific nucleotide fragment of the masson pine phytoene dehydrogenase gene;
[0027] Figure 2 Statistical diagram of gene silencing effects under different vacuum treatment times and pressures, where A is the survival rate of Masson pine seedlings under different vacuum treatment times, B is the albinism rate of Masson pine seedlings under different vacuum treatment times, C is the survival rate of Masson pine seedlings under different vacuum pressures, and D is the albinism rate of Masson pine seedlings under different vacuum treatment pressures; **** indicates P < 0.0001;
[0028] Figure 3 The statistical diagram of gene silencing effect at different bacterial concentrations, where ** means P < 0.01 and *** means P < 0.001;
[0029] Figure 4 Figure 2 shows the phenotypes of Masson pine after gene silencing at different stages. AC represents one-year-old Masson pine, DF represents 30-day-old Masson pine seedlings, A and D represent wild-type plants, B and E represent plants treated with control infection solution, and C and F represent plants treated with pTRV2-PmPDS infection solution.
[0030] Figure 5 The statistical diagrams of gene silencing in Masson pine at different stages are shown. A is the expression level of PmPDS gene after infection in one-year-old Masson pine, and B is the expression level of PmPDS gene after infection in 30-day-old Masson pine seedlings. **** indicates P < 0.0001, and ns indicates no significant difference.
[0031] Figure 6Figure 2 shows the statistical graph of geranylgeranyl pyrophosphate synthase 6 (GGPPS6) or NAC transcription factor family 5 (NAC5) gene silencing in Pinus massoniana under optimal infection conditions. A represents the expression level of GGPPS6, B represents the expression level of NAC5, **** indicates P < 0.0001, *** indicates P < 0.001, ** indicates P < 0.01, and ns indicates no significant difference. DETAILED DESCRIPTION
[0032] The technical solution of the present invention is further described below.
[0033] Example 1: Preparation of Masson Pine Gene Silencing Agrobacterium Infection Solution
[0034] 1. Preparation of phytoene dehydrogenase gene-specific nucleotide fragments
[0035] (1) Total RNA was extracted from Pinus massoniana needles using the FastPure Universal Plant Total RNA Isolation Kit and reverse transcribed using the Hifair III 1st Strand cDNA Synthesis SuperMix to obtain cDNA;
[0036] (2) Based on the publicly available Arabidopsis thaliana phytoene dehydrogenase gene sequence (NCBI Gene ID: 827061), the sequence of the pine phytoene dehydrogenase gene (PmPDS) as shown in SEQ ID NO: 1 was screened and obtained. Primers for amplifying the PmPDS interference fragment were designed and a 396-bp specific nucleotide fragment for silencing PmPDS was amplified from cDNA. The sequence is shown in SEQ ID NO: 2. The primer sequences are as follows:
[0037] Forward primer: gtgagtaaggttaccgaattcGAGTGGATGCATAAGCAGGGTG;
[0038] Reverse primer: gtgagctcggtaccggatccACCTCTTTCCACTCTTGGGGTAA;
[0039] The 50 μL PCR amplification system was as follows: 2.5 μL cDNA (final concentration 50 ng / μL), 2.5 μL forward primer, 2.5 μL reverse primer (final concentration 0.5 μM), 25 μL 2× Taq PCR Master Mix, and the balance was ddH2O. The PCR amplification program was as follows: 95°C for 3 min; 95°C for 15 s, 60°C for 5 s, and 72°C for 15 s, for 35 cycles; and 72°C for 5 min.
[0040] (3) After PCR, the product was subjected to agarose gel electrophoresis. Figure 1 As shown, the Novozymes FastPure GelDNA Extraction Mini Kit (Cat. No. DC301) was used to purify and recover the 396 bp band to obtain a PmPDS-specific nucleotide fragment.
[0041] 2. Construction of recombinant viral vector pTRV2-PmPDS
[0042] (1) The pTRV2 viral vector was double-digested with EcoR I and BamH I. The 20 μL digestion reaction system was as follows: QuickCut EcoR I 1 μL, QuickCut BamH I 1 μL, 10× QuickCut Buffer 2 μL, pTRV2 plasmid 1 μL (final concentration 50 ng / μL), and the balance was ddH2O. The digestion was performed at 37°C for 15 min and incubated at 80°C for 20 min to inactivate the endonucleases to obtain the linearized pTRV2 viral vector.
[0043] (2) The concentrations of the purified product and the enzyme-digested product obtained in Example 1 were measured, and a ligation system was constructed with 0.04 times the base pair mass of the specific nucleotide fragment and 0.02 times the base pair mass of the vector. That is, 12 ng of the PmPDS specific nucleotide fragment was mixed with 200 ng of the linearized pTRV2 viral vector, and 1 μL of Exnase II and 2 μL of 5×CEII buffer were added. The ligation system was established, and the reaction solution was centrifuged to the bottom of the tube by instantaneous centrifugation and placed in a PCR instrument. The ligation was carried out at 37°C for 30 min to obtain a recombinant plasmid.
[0044] (3) The aforementioned recombinant plasmid was transformed into Escherichia coli DH5α competent cells, spread on LB plate culture medium containing 50 mg / L kanamycin, inverted, and cultured overnight at 37°C; monoclonal colonies were picked and sequenced by Beijing Qingke Biotechnology Co., Ltd., and monoclonal DH5α containing pTRV2-PmPDS was screened and obtained. After further culture, the plasmid was extracted using the Novozymes FastPure Plasmid Mini Kit (Cat. No.: DC201) to obtain the successfully constructed pTRV2-PmPDS recombinant plasmid.
[0045] 3. Preparation of recombinant Agrobacterium GV3101
[0046] The pTRV1, pTRV2, and pTRV2-PmPDS plasmids were transformed into Agrobacterium GV3101 competent cells respectively.
[0047] (1) Add 10 μL of pTRV1, pTRV2 or pTRV2-PmPDS recombinant plasmid to every 100 μL GV3101 Agrobacterium competent cells, mix well, and place on ice for 5 min, soak in liquid nitrogen for 5 min, water bath at 37°C for 5 min, and ice bath for 5 min; add 700 μL of LB liquid medium without antibiotics, shake culture at 28°C and 200 rpm for 2.5 h, centrifuge at 6000 rpm for 1 min to recover the cells, take 100 μL of LB liquid medium, resuspend, and spread on LB plates containing 50 mg / L kanamycin and 25 mg / L rifampicin, and culture in an incubator at 28°C upside down;
[0048] (2) Monoclonal colonies with good growth status were selected and sequenced by Beijing Qingke Biotechnology Co., Ltd. The monoclonal colonies with correct sequencing were expanded and cultured to obtain recombinant Agrobacterium pTRV1 / GV3101, pTRV2 / GV3101 and pTRV2-PmPDS / GV3101.
[0049] 4. Prepare infection solution
[0050] (1) 10 μL of each of the recombinant Agrobacterium pTRV1 / GV3101, pTRV2 / GV3101, and pTRV2-PmPDS / GV3101 were added to 10 mL of LB liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin. The mixture was incubated in the dark at 28°C and 200 rpm for 30 h.
[0051] (2) When the bacterial solution becomes turbid, inoculate it into 200 mL of LB liquid culture medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, protect from light, 28°C, 200 rpm, and shake the culture until the OD value of the bacterial solution reaches 0. 600 =1.25±0.25, centrifuge at 4000 rpm for 15 min to collect the cells;
[0052] (3) Resuspend pTRV1 / GV3101, pTRV2 / GV3101, and pTRV2-PmPDS / GV3101 cells in a pH 5.6 buffer containing 10 mM 2-morpholinoethanesulfonic acid, 200 μM acetosyringone, and 10 mM MgCl2 until the OD 600 =1.0;
[0053] (4) The pTRV1 / GV3101 bacterial suspension was mixed with the pTRV2 / GV3101 bacterial suspension or the pTRV2-PmPDS / GV3101 bacterial suspension in a ratio of 1:1. After standing for 1.5 h at room temperature in the dark, 0.1% by volume of the organosilicon surfactant Silwet L-77 was added and shaken to obtain the OD value. 600 = 1 infection solution (containing pTRV1 / GV3101, pTRV2-PmPDS / GV3101 bacteria) and control infection solution (containing pTRV1 / GV3101, pTRV2 / GV3101 bacteria) were used for infection.
[0054] Example 2: Vacuum infiltration infection for gene silencing in Pinus massoniana
[0055] Agrobacterium was introduced into Pinus massoniana plant materials using vacuum infiltration. The influencing factors investigated included:
[0056] Vacuum treatment time and pressure, including treatment time of 5, 10, and 15 minutes, and pressure of 0.6, 0.7, and 0.8 kPa; bacterial concentration, including OD 600 = 0.5, 1, 1.5, 2 of four concentrations of bacterial solution; selection of plant materials, including seed stage, 30-day seedling stage and one-year-old Masson pine.
[0057] Evaluation of silencing rate by qRT-PCR:
[0058] (1) Total RNA was extracted from Pinus massoniana needles using the FastPure Universal Plant Total RNA Isolation Kit and reverse transcribed using the Hifair III 1st Strand cDNA Synthesis SuperMix to obtain cDNA at a concentration of 50 ng / μL.
[0059] (2) The Hieff UNICON Universal Blue qPCR SYBR Green Master Mix kit was used for the assay, wherein the primers for PmPDS and the internal reference gene are shown in Table 1 below, the reaction system is shown in Table 2 below, and the reaction conditions are shown in Table 3 below:
[0060] Table 1 Reaction primers
[0061] Primer name Sequence (5'-3') q-PmPDS-F GAAGCCCAAGATGGCTTAAC q-PmPDS-R GCGGATTTCCATCTAGAAAAGC q-PmTUA-R CAAACTTGGTCCCGTATCCTC q-PmTUA-R CACAGAAAGCTGCTCATGGTAA
[0062] Table 2 Reaction system
[0063]
[0064]
[0065] Table 3 Reaction conditions
[0066]
[0067] After obtaining the average Ct value, use 2 -ΔΔCT Methods The relative transcription level of PmPDS was calculated. TUA gene was used as an internal reference gene to normalize the transcription abundance and calculate the silencing rate.
[0068] 1. Effects of different vacuum treatment times and pressures on gene silencing in Pinus massoniana
[0069] 1.1 Effects of different vacuum treatment times on gene silencing in Pinus massoniana
[0070] (1) Select 30-day-old, well-grown and robust Pinus massoniana seedlings, wash them, dry the surface moisture, and completely immerse them in the infection solution prepared in Example 1 or the control infection solution;
[0071] (2) Using a vacuum infiltration apparatus HG-30F, after the vacuum degree reached 0.8 kPa, it was maintained for 5, 10, or 15 min, and then the air was slowly released at a rate of 1.5 kPa / s to restore the normal pressure. The experiment was repeated three times, with 120 plants in each treatment group in each experiment;
[0072] (3) The excess bacterial solution on the plants was washed with sterile water, and the roots of the seedlings were buried back in the soil. The plants were cultured under the conditions of 12000 lx of light, 25℃ / 20℃ day and night temperature, 16h / 8h day and night time, and 70% humidity. The phenotypic changes of the Masson pine seedlings were observed, and samples were taken after 30 days for silencing rate detection.
[0073] 1.2 Effects of different vacuum treatment pressures on gene silencing in Pinus massoniana
[0074] (1) Select 30-day-old, well-grown and robust Pinus massoniana seedlings, wash them, dry the surface moisture, and completely immerse them in the infection solution prepared in Example 1 or the control. The infection solution and control treatments were repeated three times, with 120 plants in each group.
[0075] (2) Using a vacuum infiltration device HG-30F, after the vacuum reaches 0.6, 0.7, or 0.8 kPa, maintain it for 5 minutes, then slowly release the air at a rate of 1.5 kPa / s to restore the normal pressure;
[0076] (3) The excess bacterial solution on the plants was washed with sterile water, and the roots of the seedlings were buried back in the soil. The plants were cultured under the conditions of 12000 lx of light, 25℃ / 20℃ day and night temperature, 16h / 8h day and night time, and 70% humidity. The phenotypic changes of the Masson pine seedlings were observed, and samples were taken after 30 days for silencing rate detection.
[0077] The results are as follows Figure 2 As shown in the data, the survival rates of the 10-min and 15-min treatment groups did not exceed 5%, the plant survival rate of the 5-min treatment group was 19.6%, and the bleaching rate reached 16.2%, which was significantly better than other treatments. This shows that extending the vacuum treatment time (greater than 5 minutes) will significantly reduce the survival rate of Masson pine seedlings and reduce the infection efficiency; in addition, as the pressure decreases, the survival rate shows an upward trend, but the bleaching rate drops significantly to 4.3%.
[0078] 2. Effects of different bacterial concentrations on gene silencing in Pinus massoniana
[0079] According to the method described in Example 1, OD 600 =0.5, 1.5, 2 infection solutions or control infection solutions.
[0080] (1) Select 30-day-old Masson pine seedlings that are well-grown and strong, wash them, dry the surface water, and completely immerse them in OD 600 = 0.5, 1, 1.5, or 2 infection solutions or control infection solutions, and the experiment was repeated three times, with 120 plants in each treatment group in each experiment;
[0081] (2) Using a vacuum infiltration device HG-30F, after the vacuum reaches 0.8 kPa, maintain it for 5 minutes, and then slowly release the air at a rate of 1.5 kPa / s to restore the normal pressure;
[0082] (3) The excess bacterial solution on the plants was washed with sterile water, and the roots of the seedlings were buried back in the soil. The plants were cultured under the conditions of 12000 lx of light, 25℃ / 20℃ day and night temperature, 16h / 8h day and night time, and 70% humidity. The phenotypic changes of the Masson pine seedlings were observed, and samples were taken after 30 days for silencing rate detection.
[0083] The results are as follows Figure 3 As shown in the figure, different bacterial concentrations can have a significant effect on the infection efficiency. 600 =1, the silencing rate was the highest at 76.9%, significantly higher than that of other treatment groups. 600= 0.5 treatment group due to insufficient bacterial concentration, the silencing efficiency was 63.3%, while the high concentration group OD 600 =1.5 or 2, the silencing efficiency was 72.3% and 65.8% respectively.
[0084] 3. Effects of different plant materials on gene silencing in Masson pine
[0085] (1) Masson pine seeds, 30-day-old seedlings, or one-year-old plants with their seed shells peeled off were selected, washed, and then the surface moisture was dried. The Masson pine seeds and 30-day-old seedlings were completely immersed in the infection solution prepared in Example 1 or the control infection solution. The experiment was repeated three times, with 120 plants (seeds) in each treatment group in each experiment. For one-year-old plants, only the needles were immersed. The experiment was repeated three times, with 30 plants in each treatment group in each experiment.
[0086] (2) Using a vacuum infiltration device HG-30F, after the vacuum reaches 0.8 kPa, maintain it for 5 minutes, and then slowly release the air at a rate of 1.5 kPa / s to restore the normal pressure;
[0087] (3) Wash off the excess bacterial solution with sterile water, plant the seeds in the soil, bury the seedling roots back into the soil, and cultivate under the conditions of 12000lx light, 25℃ / 20℃ day and night temperature, 16h / 8h day and night time, and 70% humidity. Observe the germination of Pinus massoniana seeds and the phenotypic changes of seedlings. Take samples after 30 days for silencing rate detection.
[0088] However, none of the Masson pine seeds treated with the infective solution or the control infective solution germinated.
[0089] The results of phenotype and silencing rate of infected plants are as follows Figure 4 、 5 As shown in the figure, after one month of vacuum infiltration infection, only some needles of one-year-old Masson pine showed bleaching. However, when the entire plant of 30-day-old Masson pine seedlings was completely immersed in the infection solution by vacuum infiltration infection, the entire plant showed bleaching after one month ( Figure 4 The silencing efficiency of PmPDS in one-year-old Masson pine was 65.7% on average, while that in 30-day-old Masson pine seedlings was 79.1% on average. The most suitable plant material for vacuum infiltration gene silencing in Masson pine was 30-day-old seedlings.
[0090] The above results show that the most suitable conditions for gene silencing in Pinus massoniana using vacuum infiltration infection are: select 30-day-old Pinus massoniana seedlings with good growth and robustness, immerse the whole plant in OD 600=1 infection solution; use the vacuum infiltration device HG-30F, after the vacuum degree reaches 0.8kPa, maintain it for 5 minutes, then slowly release the air at a rate of 1.5kPa / s to restore normal air pressure, wash away the excess infection solution with sterile water, bury the seedling roots back into the soil to complete the infection.
[0091] Example 3: Verification of Masson pine gene silencing method
[0092] 1. Gene silencing of Pinus massoniana geranylgeranyl pyrophosphate synthase 6 (PmGGPPS6)
[0093] The hidden Markov model map of GGPPS (PF00348) was downloaded from the Pfam database and searched in the masson pine transcriptome PRJNA595650 to obtain the masson pine geranylgeranyl pyrophosphate synthase 6 (PmGGPPS6) sequence as shown in SEQ ID NO: 3;
[0094] Based on the method described in Example 1, the PmGGPPS6-specific nucleotide fragment was designed and prepared. The obtained PmGGPPS6-specific nucleotide fragment sequence is shown in SEQ ID NO: 4;
[0095] The PmGGPPS6-specific nucleotide fragment was further connected to the viral vector pTRV2 to obtain pTRV2-PmGGPPS6, and the infection solution was prepared based on the above method. The bacterial solution containing pTRV1 / GV3101 and pTRV2 / GV3101 was also used as the control infection solution, and vacuum infiltration infection was performed using the most suitable conditions for gene silencing in Pinus massoniana using vacuum infiltration infection obtained in Example 2.
[0096] The infected plants were cultured under conditions of 12,000 lx light intensity, 25°C / 20°C day / night temperature, 16 h / 8 h day / night time, and 70% humidity. After one month, total RNA was extracted using the FastPure Universal Plant Total RNA Isolation Kit and reverse transcribed using the Hifair III 1st Strand cDNA Synthesis SuperMix to obtain cDNA at a concentration of 50 ng / μL.
[0097] The Hieff UNICON Universal Blue qPCR SYBR Green Master Mix kit was used for the assay. The primers for PmGGPPS6 and the internal reference gene TUA are shown in Table 4 below. The reaction system and reaction conditions were the same as in Example 2.
[0098] Table 4 Reaction primers
[0099]
[0100]
[0101] 2. Gene silencing of Pinus massoniana NAC transcription factor family 5 (PmNAC5)
[0102] The hidden Markov model map of NAC (PF02365) was downloaded from the Pfam database and searched in the Pinus massoniana transcriptome PRJNA595650 to obtain the sequence of Pinus massoniana NAC transcription factor family 5 (PmNAC5) as shown in SEQ ID NO: 5;
[0103] Based on the method described in Example 1, the NAC5-specific nucleotide fragment was designed and prepared. The obtained PmNAC5-specific nucleotide fragment sequence is shown in SEQ ID NO: 6;
[0104] The PmNAC5-specific nucleotide fragment was further connected to the viral vector pTRV2 to obtain pTRV2-PmNAC5, and the infection solution was prepared based on the above method. The bacterial solution containing pTRV1 / GV3101 and pTRV2 / GV3101 was also used as the control infection solution, and vacuum infiltration infection was performed using the optimal conditions for gene silencing in Pinus massoniana using vacuum infiltration infection obtained in Example 2.
[0105] The infected plants were cultured under conditions of 12,000 lx light intensity, 25°C / 20°C day / night temperature, 16 h / 8 h day / night time, and 70% humidity. After one month, total RNA was extracted using the FastPure Universal Plant Total RNA Isolation Kit and reverse transcribed using the Hifair III 1st Strand cDNA Synthesis SuperMix to obtain cDNA at a concentration of 50 ng / μL.
[0106] The Hieff UNICON Universal Blue qPCR SYBR Green Master Mix kit was used for the assay. The primers for PmNAC5 are shown in Table 5 below, and the primers, reaction system, and reaction conditions for the internal reference gene TUA were the same as above.
[0107] Table 5 Reaction primers
[0108]
[0109] The results are as follows Figure 6As shown in the data, the expression levels of PmGGPPS6 and PmNAC5 genes in both groups of plants were significantly downregulated, that is, the VIGS silencing system of Pinus tailingii can not only reduce the expression level of the enzyme gene PmGGPPS6, but also silence the expression of the transcription factor PmNAC5 gene. This method has wide applicability and can be used to silence different types of genes.
Claims
1. A method for silencing the gene of Masson pine, characterized in that the steps include: (1) Synthesizing specific nucleotide fragments based on the target gene; (2) constructing specific nucleotide fragments into plant virus vectors; (3) introducing the recombinant plant virus vector obtained in step 2 into the Masson pine plant material; (4) Screening and obtaining Pinus massoniana plant materials with target gene silencing.
2. The method according to claim 1, characterized in that The step 1 comprises: (11) Design amplification primers based on the target gene; (12) RNA was extracted from Pinus massoniana and reverse transcribed to obtain cDNA. Amplification primers were used to amplify specific nucleotide fragments by PCR.
3. The method according to claim 1, characterized in that The plant virus vector in step 2 is selected from any one of tobacco rattle virus vector, cucumber mosaic virus vector, tobacco mosaic virus vector, and tomato golden mosaic virus vector.
4. The method according to claim 1, wherein The method for introducing the Masson pine plant material in step 3 is selected from any one of the Agrobacterium-mediated method, the mechanical inoculation method, and the nanomaterial delivery method.
5. The method according to claim 4, characterized in that The method for introducing the Masson pine plant material is an Agrobacterium-mediated method.
6. The method according to claim 5, characterized in that The step of introducing the masson pine plant material in step 3 comprises: (31) transforming the recombinant plant virus vector obtained in step 2 into Agrobacterium competent cells, and screening to obtain the recombinant plant virus vector Agrobacterium; (32) preparing an infection solution containing the recombinant plant virus vector Agrobacterium and a 0.1% volume concentration of an organosilicon surfactant; (33) Select Pinus massoniana plant materials, immerse them in the infection solution, and evacuate to 0.7-0.9 kPa for 4-6 min.
7. The method according to claim 6, characterized in that The Pinus massoniana plant material in step 31 is a Pinus massoniana seedling less than 1 year old.
8. The method according to claim 7, characterized in that The masson pine seedlings are masson pine seedlings with an age of 20-40 days.
9. The method according to claim 6, characterized in that The concentration of Agrobacterium in the infection solution in step 32 is OD 600 The value is 0.75-1.
75.
10. The method according to claim 1, characterized in that The screening in step 4 is any one of resistance gene screening, reporter gene screening, and molecular biological detection.