SNP molecular marker based on CDC42 gene and related to pig hypoxia resistance and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker based on CDC42 gene and related to pig hypoxia resistance and application of the SNP molecular marker, the SNP molecular marker is located at the 359th site of a nucleotide sequence of a core promoter region of the CDC42 gene, the basic group is G or T, and T is a dominant allele under the hypoxia condition; and the nucleotide sequence of the core promoter region of the CDC42 gene is-1bp to-619bp of the sequence as shown in SEQ ID NO. 15. Through high and low altitude transcriptome analysis of Tibetan pigs and a pig skeletal muscle satellite cell hypoxia model, it is found that the CDC42 gene plays an important role in pig hypoxia resistance, and a CDC42 gene promoter region is utilized to construct a dual-fluorescein reporter vector to determine the SNP site (g.-359Ggt; t). The invention provides the SNP molecular marker to assist the breeding method of the hypoxia-resistant pig breeds, a large amount of group scale sampling and determination are not needed, and the breeding efficiency of the hypoxia-resistant pig breeds is effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a SNP molecular marker related to pig hypoxia tolerance based on the CDC42 gene and its application. Background Art

[0002] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by variations in a single nucleotide at the genomic level. It is typically a dimorphic marker and the most widely distributed type of genetic polymorphic marker within the genome. SNPs offer advantages such as large abundance, high frequency, and low mutation rate. Compared to traditional breeding methods, molecular breeding significantly accelerates selection efficiency. Unaffected by environmental influences, SNPs can be selected through genetic background selection, reducing linkage drag, thereby accelerating the breeding process and improving accuracy, enabling breeders to efficiently select livestock and poultry breeds with superior traits.

[0003] CDC42 is a member of the Rho GTPase family, acting as a molecular switch to regulate various cellular processes. Studies have shown that CDC42 can affect the stability or transcriptional activity of HIF-1α, influencing HIF signaling by regulating post-translational modifications of HIF-1α or influencing its interactions with cofactors, potentially playing an important role in hypoxia tolerance. Pig breeding is influenced by local climates (such as temperature and oxygen levels). Breeding pigs with strong stress tolerance can increase production and reduce breeding costs. Breeding hypoxia-tolerant pigs is expected to improve the adaptability of commercial or local pigs to high-altitude ecological environments and accelerate genetic improvement efforts. Summary of the Invention

[0004] In response to the deficiencies in the prior art, the present invention aims to provide a CDC42-based SNP molecular marker associated with pig hypoxia tolerance and its application. The SNP molecular marker is located at position 359 of the nucleotide sequence of the core promoter region of the CDC42 gene, and the base is G or T; the nucleotide sequence of the core promoter region of the CDC42 gene is -1bp to -619bp of the sequence shown in SEQ ID NO.15, and T is the dominant allele under hypoxic conditions.

[0005] In order to solve the above technical problems, the technical solution provided by the present invention is:

[0006] A SNP molecular marker related to hypoxia tolerance in pigs based on the CDC42 gene,

[0007] The SNP molecular marker is located at position 359 of the nucleotide sequence of the core promoter region of the CDC42 gene, and the base is G or T; the core promoter region of the CDC42 gene is -1bp to -619bp of the sequence shown in SEQ ID NO.15; the SNP site is located at 80034675bp on chromosome 6 of the international pig genome NCBI Sscrofa 11.1 version.

[0008] Preferably,

[0009] Under hypoxic conditions, T is the dominant allele.

[0010] A primer pair for amplifying the core promoter region of the CDC42 gene where the SNP molecular marker associated with pig hypoxia tolerance according to claim 1 is located,

[0011] The forward sequence of the primer pair is shown in SEQ ID NO.24;

[0012] The reverse sequence of the primer pair is shown in SEQ ID NO.25.

[0013] A reagent or kit containing the primers for the SNP molecular marker related to pig hypoxia tolerance based on the CDC42 gene.

[0014] The application of the above-mentioned SNP molecular markers related to pig hypoxia tolerance in the assisted breeding of hypoxia-tolerant pig breeds.

[0015] Preferably,

[0016] The core promoter region of the porcine CDC42 gene is detected, and recombinant plasmids pGL3-basic-CDC42-P1, pGL3-basic-CDC42-P2 and pGL3-basic-CDC42-P3 are constructed by constructing porcine CDC42 gene promoter truncations P1, P2 and P3. The relative luciferase activity of the recombinant plasmids is then determined using dual luciferase activity. The nucleotide sequence of the truncation P1 is the base sequence at positions 1-619 of SEQ ID NO.15; the nucleotide sequence of the truncation P2 is the base sequence at positions 1-1460 of SEQ ID NO.15; and the nucleotide sequence of the truncation P3 is the base sequence at positions 1-2000 of SEQ ID NO.15.

[0017] Preferably,

[0018] The forward sequences of the primer pairs for amplifying the porcine CDC42 gene promoter truncation P1, P2 and P3 are shown in SEQ ID NO.16, SEQ ID NO.17 and SEQ ID NO.18, and the reverse sequences are shown in SEQ ID NO.19.

[0019] A method for breeding hypoxia-resistant pig breeds, based on the above-mentioned SNP molecular marker, detects the SNP molecular marker at position 359 in the core promoter region of the CDC42 gene, and selects individuals with the allele G at this site for breeding.

[0020] A method for identifying the above-mentioned SNP molecular marker related to pig hypoxia tolerance based on the CDC42 gene comprises the following steps:

[0021] 1) Establish a hypoxic model for porcine skeletal muscle satellite cell proliferation;

[0022] 2) Analyzing the expression of the CDC42 gene in the hypoxia model of pig skeletal muscle satellite cells using transcriptome data from different tissues of Tibetan pigs at high and low altitudes;

[0023] 3) qRT-PCR detection of CDC42 gene expression in proliferating satellite cells of hypoxic porcine skeletal muscle;

[0024] 4) Constructing the porcine CDC42 gene promoter truncations P1, P2, and P3, and then constructing the recombinant plasmids pGL3-basic-CDC42-P1, pGL3-basic-CDC42-P2, and pGL3-basic-CDC42-P3;

[0025] 5) Detection of the promoter region activity of the porcine CDC42 gene;

[0026] 6) Transient cell transfection and dual luciferase activity assay to identify the mutation activity of the SNP site (g.-359G>T).

[0027] The beneficial effects of the present invention are:

[0028] The present invention obtains a molecular marker related to pig hypoxia tolerance based on the CDC42 gene, which enables the selection and breeding of hypoxia-tolerant pig breeds to improve the adaptability of commercial pigs or local pigs to high-altitude ecological environments, accelerates the progress of genetic improvement work, and breeds pig breeds with strong stress resistance, which can increase production and reduce breeding costs. It does not require large-scale group sampling and measurement, and can effectively improve the efficiency of breeding hypoxia-tolerant pig breeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0030] Figure 1Figure 5 is the experimental result showing that the CDC42 gene is highly expressed in the hypoxia model of porcine skeletal muscle satellite cells; A is the expression of hypoxia-related factors HIF1A, VEGF, and GLUT1 transcriptional levels by qRT-PCR after satellite cells were treated with different concentrations of cobalt chloride (0, 10, 25, 50, 100, and 200 μmol / L) for 24 h (n=3, *P<0.05, **P<0.01); B is the expression of CDC42 transcriptional levels by qRT-PCR after satellite cells were treated with 50 μmol / L cobalt chloride (n=3, *P<0.05, **P<0.01).

[0031] Figure 2 These are the electrophoresis diagrams of PCR products of truncated CDC42 gene promoters; A is the electrophoresis diagram of the amplified product of truncated P1, with a fragment size of 619 bp; the electrophoresis diagram of the amplified product of truncated P2, with a fragment size of 1460 bp; and B is the electrophoresis diagram of the amplified product of truncated P3, with a fragment size of 2000 bp.

[0032] Figure 3 This is the sequencing result analysis of pGL3-basic-CDC42-P1; A is the sequencing sequence of pGL3-basic-CDC42-P1; B is the sequencing peak graph of pGL3-basic-CDC42-P1.

[0033] Figure 4 This is the sequencing result analysis of pGL3-basic-CDC42-P2; A is the sequencing sequence of pGL3-basic-CDC42-P2; B is the sequencing peak graph of pGL3-basic-CDC42-P2.

[0034] Figure 5 This is the sequencing result analysis of pGL3-basic-CDC42-P3; A is the sequencing sequence of pGL3-basic-CDC42-P3; B is the sequencing peak graph of pGL3-basic-CDC42-P3.

[0035] Figure 6 The relative luciferase activities of different promoter truncations of the CDC42 gene (n=3, *P<0.05, **P<0.01).

[0036] Figure 7The following are the verification results of the CDC42 gene SNP site (g.-359G>T); A is the electrophoresis diagram of the reverse PCR product of the mutant fragment, with a fragment size of 5412 bp; B is the sequencing peak diagram of pGL3-basic-CDC42-SNP (g.-359G>T); C is the relative luciferase activity of the CDC42 gene SNP site (g.-359G>T) promoter expression vector (n=3, *P<0.05, **P<0.01). DETAILED DESCRIPTION

[0037] The following describes preferred embodiments of the present invention in conjunction with the accompanying drawings. It should be understood that the following embodiments are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0038] Example 1 Comparison of CDC42 gene expression in high and low altitude Tibetan pig transcriptomes

[0039] The transcriptome data of different tissues of Tibetan pigs at high and low altitudes (heart: GSE114779; lung: GSE88409; skeletal muscle: GSE90510) were downloaded from NCBI "GEO DataSets". Differential gene analysis was performed using DESeq2, and it was found that the pig CDC42 gene was a down-regulated differentially regulated gene, indicating that the CDC42 gene may play an important role in hypoxia tolerance.

[0040] Example 2 Expression of CDC42 gene in pig satellite cells treated with hypoxia

[0041] (1) Isolation and culture of porcine skeletal muscle satellite cells in vitro

[0042] Porcine skeletal muscle satellite cells (PSCs) were isolated from longissimus dorsi muscles of wild-type experimental pigs and digested with collagenase II and Dispase II. PSCs were then isolated and purified by differential adhesion. PSCs were cultured at 37°C and 5% CO2 in F12 medium supplemented with 20% (v / v) fetal bovine serum (FBS) and 0.1% (w / v) gentamicin / ampicillin.

[0043] (2) Construction of a hypoxia model of porcine skeletal muscle satellite cells

[0044] Porcine satellite cells were plated at 10 per well 4 The cells were seeded at a density of 100 cells / well in a 24-well plate and treated with different concentrations of cobalt chloride (0, 10, 25, 50, 100, 200 μmol / L) for 24 h. Figure 1As shown in A, qRT-PCR detection found that the expression levels of hypoxia-related factors HIF1A, VEGF, and GLUT1 were significantly increased during the proliferation of porcine satellite cells treated with 50 μmol / L cobalt chloride and were greater than those at other concentrations. The hypoxia-related factors EPASI and EPO were also significantly increased compared with the control group. It is speculated that 50 μmol / L cobalt chloride is the optimal concentration for hypoxia treatment and is used as a hypoxia model for porcine skeletal muscle satellite cells in subsequent experiments.

[0045] (3) qRT-PCR detection of CDC42 gene expression in hypoxic pig skeletal muscle satellite cells

[0046] Subsequently, the expression changes of CDC42 gene during the proliferation of satellite cells treated with 50 μmol / L cobalt chloride hypoxia were detected. Figure 1 As shown in Figure 2(B), qRT-PCR results showed that the expression level of CDC42 gene was significantly reduced, indicating that WAS may play an important role in the proliferation of pig skeletal muscle as a hypoxia-sensitive gene.

[0047] The qRT-PCR procedure is as follows: cells were lysed using Trizol solution (500 μL per 24-well plate), total RNA was extracted, and reverse transcribed into cDNA using RT-PCR. qPCR primers for specific genes were designed, and 18S was used as an internal reference. mRNA expression levels were measured using a fluorescent quantitative PCR instrument. Details of the primers used are as follows:

[0048] 18S-F: CCTGCGGCTTAATTTGACTC (SEQ ID NO. 1);

[0049] 18S-R: ATGCCAGAGTCTCGTTCGTT (SEQ ID NO. 2);

[0050] HIF1A-F:CTCCATTGCCTGCCTCTGAA(SEQ ID NO.3);

[0051] HIF1A-R:TGGGACTGTTAGGCTCAGGT (SEQ ID NO.4);

[0052] EPAS1-F:CTCCTGTCCCTCAGTTTGCTCT (SEQ ID NO.5);

[0053] EPAS1-R:TGCTGTGTCCTGTTAGCTCC (SEQ ID NO.6);

[0054] EPO-F:GCGCGCGAATGTCCT(SEQ ID NO.7);

[0055] EPO-R: CCATCGTGGCATTTTCGCC (SEQ ID NO. 8);

[0056] VEGF-F:CAACGACGAAGGTCTGGAGT (SEQ ID NO.9);

[0057] VEGF-R:CAAGGCCCACAGGGATTTTCTT (SEQ ID NO. 10);

[0058] GLUT1-F:ATCCTCATCGCCCAGGTATTT(SEQ ID NO.11);

[0059] GLUT1-R:CGGTTCTCCTCATTGCGGTT (SEQ ID NO. 12);

[0060] CDC42-F:ATGTGAAAGAAAAGTGGGTGCC (SEQ ID NO. 13);

[0061] CDC42-R:ACAGCACTTCCTTTTGGGTTGA (SEQ ID NO. 14);

[0062] Example 3 Construction of pig CDC42 gene promoter truncation

[0063] (1) Prediction of TSS site in the 5' flanking sequence of the porcine CDC42 gene and promoter sequence truncation

[0064] Bioinformatics analysis of the 2000-bp 5' end of the CDC42 gene was performed using the websites BDGP, ​​Promoter2.0, TSSG, and TSSWW to predict the transcription start site (TSS). Based on available VCF samples from Tibetan pigs and Yorkshire pigs, the Fst and Xpehh population selection analysis methods were used to identify SNPs in the CDC42 gene promoter region, and the CDC42 gene promoter sequence was truncated.

[0065] (2) Primer design for different truncated promoter fragments

[0066] Based on the first 2000 bp of the CDC42 gene (Gene ID: 780428) in the NCBI database, whose nucleotide sequence is shown in SEQ ID NO. 1, promoter truncation-specific primers were designed using SnapGene. The upstream and downstream primers contain Kpn I and Xho I restriction sites, respectively, while the downstream primer (CDC42-R) remains unchanged. These primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. Three CDC42 gene promoter truncation variants were constructed, with promoter fragment sizes of P1 (-619 / -1), P2 (-1460 / -1), and P3 (-2000 / -1).

[0067] The first 2000 bp sequence of the CDC42 gene is as follows (SEQ ID NO.15):

[0068] TTGCGGGTTCGCTGCCCTTGCTCAGTGGGTTAACGATCCGGTGTTGCCG

[0069] TGAGCTGTGGTGTAGGTTGCAGACACAGCTCGGATCCCGCATTGCTGTGGC

[0070] TCTGGCGTAGGCCGGTGGCTACAGCTCCGATTCAACCCCTAGCCTGGGAAC

[0071] CTCCATATGCCTCGGGAGCGGCCCAAGAAATAGCAACAACAACAACAAAA

[0072] AGACAAAAAAAAAAAAAAAAAAAGATGTTTTATTTGACATGGGAAGATGT

[0073] TCACAATGTAGTTTCGAGAGAGAAACACAGAGTACAATGTGTTTTTTGTGC

[0074] AATAAATGTGTGTAGGTATATTTGTATCTGTGAATATCTGGGAAGGTGTACAC

[0075] CAAAATGTTAATAGTTAGTATCACTAGGGTAGGACTGCAACTGAAGCTTATC

[0076] ATCTGATTTCACTGTAATAAACCTGCTAGGTAGCATTTGGGTCAGCTAGAGT

[0077] CTCAACTCTGCTACCGCCTGGCTTGATGACCTTGGGTAAGTCCCTTAACAC

[0078] CTCTGAGCTGCATCAATAGTGAGGGTAATGGTCTCTTAGTCCATAGGGTGGT

[0079] TGTGAATTTTACATGAACTACTATGTTTAGATGCAAATTTGTTAGCATCATAC

[0080] CTATAGTATGTTAGCATCATACCTATAGTAATCACTCTAAAACGTAGTTCTTG

[0081] TGTAATTAAAAAAGTCCAGGAGTTCCCGTTGTGGCTCAGTGGTTAACGAAT

[0082] CTGACTAGGAACCACGAGGTTGTGGGTTCGATCCCTGGCCTTGCTCAGTGG

[0083] GTTAAGGATCCGGCGTTGCCGTGAGCTGTGGTATAGGTCGCAGATGCCGCT

[0084] CGGATCCTGCGTTGCTGTGGCTCTGGTGTAGGCTGGCGGTTACAGCTCCAA

[0085] TTAGATCCCTAGCCTGGGAACCTCCACATGCGGTGGGAGCGGCCCAAA

[0086] ATGGCAAAAAAAAAAAAAAAGGACCAAAAAATAAAATAAAATAAAATGA

[0087] AACATTCGAAACAATAAAAAGTCCGAAGGGAAATATGACTATTAAA

[0088] AATATTGTAAATAGATGTCTTTCTTGGCCAAATAACTGTGGCAGTCATCAAT

[0089] AAATGAATTATTGTAGTTCCCCTCGTAGCTCAGAGGAAACTAATCTGAGTAG

[0090] TATCCATCCATGAGGATGCAGGTTCTATCCCTGGCCTTGCTCAGTGGGCTAA

[0091] GGATCTGGCGTTGCCTTAAGCTGTGGTGTAAGTTGCAGACCAAGGCTTGGAT

[0092] CCCGGGTTGCTATGGCGTGGTGTAGGCCAGCAGCTACAGCTTCAATTTGA

[0093] CCCCTAGCCTAGGAACCTCCATAGGCCAGGGGGTGCAGCCCTAAAAAGAAA

[0094] AAAATAAAGAACTATTATTTAAGATAAGCTATTTTCCTCTAACACTAGGCAC

[0095] CATCTGAGAAAAAGACCGAGAAGGCTCCTATTCTGAAGTGTGCACACTGGC

[0096] AAGGAAGACGGATGACAACAGGTGCTGTGAGGATAGGATGATCAGGAAG

[0097] GCAGTGACATTTGAAGGCAGAGGGCCAACGGAAGGACTGGTGAAAGAGGA

[0098] GGCAGCCAGGGGAAATTGTGAATCTGAGGCCTTGTTGTGGGAGGAAGTC

[0099] TCTAAACCAATTGATGACGGATGTCGCTGGAACGAGAGACAGTAGGGTGG

[0100] AAGCAGTGAAGCGAGCACTCAGCTCTCAAGCCATACGGGCCGGGGGAGTC

[0101] AGAGGGCCATCCACTTGCATTGTGGTCACAAGTCATGCCCCTTTTCGAGTA

[0102] GCCGCTGTCTTCTTTGCAAAATCAGGATGATGATACTTTGCAAAAGTGCAA

[0103] AGATCAAAAGAAATGTTAGTTGTGGTGCTTTGCAAACGACCATTTATAGCAT

[0104] TATTACAAATATATGACAGCCACTGGAGAAACAGTTACAAGCGCAACACAC

[0105] GAAAGAGCAAGCAGGACCGCCTGGCGCGTGCGCTAGGCTGCCTGAACC

[0106] TGGGGAGCGGATGAATTCAAGCCCCGCCCGGAACAGCTCGGCCTCTTTTTC

[0107] GCCTCGGATCCCTC

[0108] The details of the primers used are as follows:

[0109] Forward primer:

[0110] CDC42-P1-F: 5'CGGGGTACCCCATCTGAGAAAAGACCGAGAAGGC3' (SEQ ID NO.16)

[0111] CDC42-P2-F: 5'CGGGGTACCGGTTCTTAGTCCATAGGGTGGTTGTG3' (SEQ ID NO.17)

[0112] CDC42-P3-F: 5'CGGGGTACCTTGCGGGTTCGCTGCC3' (SEQ ID NO. 18) Reverse primer:

[0113] CDC42-R: 5'CCGCTCGAGGAGGGATCCGAGGCGAAAAGAG3' (SEQ ID NO.19)

[0114] (3) Amplification of different truncated fragments in the promoter region and purification and recovery of products

[0115] 50 μL PCR reaction system: KOD FOX Buffer 25 μL, 2 mM dNTP 10 μL, 1.5 μL each of 10 μM forward and reverse primers, 1 μL template DNA, 1 μL KOD FOX, and 10 μL sterile water.

[0116] The amplification conditions were as follows: pre-denaturation at 94°C for 3 min, denaturation at 98°C for 15 s, annealing at 57°C for 15 s, extension at 68°C for 60 s, 35 cycles, termination extension at 68°C for 5 min, and cooling at 16°C for 2 min.

[0117] In this example, a kit was used to extract pig genomic DNA. The extraction method was referred to the instructions of the blood / cell tissue genomic DNA extraction kit (Tian Gen), and the DNA concentration was determined by a NanoDrop1000 micro-volume UV spectrophotometer.

[0118] The PCR products were identified by 1% agarose gel electrophoresis. Figure 2 As shown, Figure 2 A is the electrophoresis diagram of the amplified products of truncated P1 and P2, with the fragment size of truncated P1 being 619 bp and the fragment size of truncated P2 being 1460 bp; Figure 2 B is the electrophoresis diagram of the amplified product of truncated P3. The fragment size is 2000 bp. After verifying that the band is in the correct position, the Magen agarose gel DNA recovery kit is used for gel excision, recovery and purification. All operations are performed according to the kit instructions.

[0119] (4) Enzyme digestion and ligation of different truncated fragments of the promoter region with pGL3-basic plasmid

[0120] The gel-cutting product was double-digested with KpnⅠ and XhoⅠ at 37℃ for 3h. The system was: 1μL each of KpnⅠ and XhoⅠ, 1μg of gel-cutting product, 5μL of 10x Cutsmart Buffer, and sterile water to 50μL.

[0121] The pGL3-basic plasmid was double-digested with Kpn I and Xho I overnight at 37°C using the following system: 1 μL each of Kpn I and Xho I, 1 μg of pGL3-basic plasmid, 5 μL of 10x Cutsmart Buffer, and sterile water to 50 μL. The gel-cleaved product after Kpn I and Xho I double-digestion and the pGL3-basic plasmid after Kpn I and Xho I double-digestion were purified using a PCR product purification kit (Magen).

[0122] The purified gel-cleaved recovery product and the purified pGL3-basic plasmid were ligated using the NEB T4 ligase kit. The ligation system was as follows: T4 Buffer 2 μL, Vecter (4 kb) 50 ng (0.020 pmol), Insert (1 kb) 37.5 ng (0.060 pmol), T4 ligase 1 μL, and sterile water was added to 20 μL. The ligation was carried out at 16°C overnight to obtain recombinant plasmids pGL3-basic-CDC42-P1, pGL3-basic-CDC42-P2, and pGL3-basic-CDC42-P3.

[0123] (5) Transformation of recombinant plasmids pGL3-basic-CDC42-P1, pGL3-basic-CDC42-P2, and pGL3-basic-CDC42-P3

[0124] Add 10 μL of recombinant plasmids pGL3-basic-CDC42-P1, pGL3-basic-CDC42-P2, and pGL3-basic-CDC42-P3 to 100 μL of DH5α competent cells, incubate on ice for 30 minutes, heat shock at 42°C for 90 seconds, and then incubate on ice for 2 minutes. Add 500 μL of antibiotic-free LB liquid medium and incubate at 37°C with shaking for 30 minutes. Spread 200 μL evenly on a plate containing LB solid medium (100 mg / mL) and incubate inverted overnight at 37°C for 12-16 hours.

[0125] (6) Positive clone screening and sequencing identification

[0126] Single colonies were streaked from the plates for colony PCR testing. A 20 μL aliquot system consisted of 0.4 μL each of forward and reverse primers, 10 μL of 2xTaq Mix, and 9.2 μL of sterile water. Amplification conditions were as follows: 94°C pre-denaturation for 3 min, 94°C denaturation for 15 s, 57°C annealing for 30 s, 72°C extension for 60 s / kb for 30 cycles, 72°C stop extension for 2 min, and 16°C cooling for 5 min. Positive single colonies were selected after electrophoresis on a 1% agarose gel. Details of the primers used are as follows:

[0127] Forward primer:

[0128] P1-F: 5'CGGGGTACCCCATCTGAGAAAGACCGAGAAGGC 3'(SEQ IDNO.20)

[0129] P2-F: 5'CGGGGTACCGGTTCTTAGTCCATAGGGTGGTTGTG 3' (SEQ ID NO. 21)

[0130] P3-F: 5'CGGGGTACCTTGCGGGTTCGCTGCC 3' (SEQ ID NO.22)

[0131] Reverse primer:

[0132] LucNrev-R: 5'CCTTATGCAGTTGCTCTCC 3' (SEQ ID NO. 23)

[0133] Sequencing: The positive monoclonal bacterial solution was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were spliced ​​and aligned using SnapGene software. The results are as follows: Figure 3 , Figure 4 , Figure 5 As shown, Figure 3 This is the sequencing result analysis of pGL3-basic-CDC42-P1; Figure 3 A is the sequencing sequence of pGL3-basic-CDC42-P1; Figure 3 B is the sequencing peak diagram of pGL3-basic-CDC42-P1; Figure 4 This is the sequencing result analysis of pGL3-basic-CDC42-P2; Figure 4 A is the sequencing sequence of pGL3-basic-CDC42-P2; Figure 4 B is the sequencing peak diagram of pGL3-basic-CDC42-P2; Figure 5 This is the sequencing result analysis of pGL3-basic-CDC42-P3; Figure 5 A is the sequencing sequence of pGL3-basic-CDC42-P3; Figure 5 B is the sequencing peak diagram of pGL3-basic-CDC42-P3. The above results show that the CDC42 gene promoter truncation dual-fluorescein reporter gene plasmid was successfully constructed.

[0134] (7) Extraction of recombinant plasmids pGL3-basic-CDC42-P1, pGL3-basic-CDC42-P2, and pGL3-basic-CDC42-P3

[0135] The recombinant plasmids pGL3-basic-CDC42-P1, pGL3-basic-CDC42-P2 and pGL3-basic-CDC42-P3 with correct sequencing results were mini-extracted using the Omega Endo-free Plasmid Mini Kit II. All operations were performed according to the kit instructions.

[0136] Example 4 Detection of activity of the porcine CDC42 gene promoter region

[0137] (1) Transient cell transfection

[0138] PK15 cells were seeded into 24-well cell culture plates with three replicates per group. Transfection was performed when the cell density reached approximately 70%. DNA / liposome complexes were prepared and the liposomes were allowed to stand for 5 minutes. Equal volumes of the plasmid solution and liposome solution (as shown in Table 1) were mixed, gently pipetting to mix, and allowed to stand for 20 minutes to form the DNA / liposome complexes.

[0139] Table 1 Target sequence and pGL3-basic vector ligation system

[0140]

[0141]

[0142] DNA / liposome complexes were added dropwise to each well, shaken and cultured in a 37°C cell culture incubator for 6 h, then replaced with complete culture medium and continued to culture. Fluorescence intensity was detected after 48 h.

[0143] (2) Dual luciferase activity assay

[0144] The luciferase activity of the corresponding groups was measured according to the instructions of the Biyuntian Dual-Luciferase Reporter Gene Assay Kit II (RG029S). The relative luciferase activity value of each group was equal to the average ratio of the firefly luciferase to Renilla luciferase detection values ​​of each independent experiment in each group. The activity of the control pGL3-basic was set as 1. The relative luciferase activity results of different promoter truncations of the CDC42 gene are shown in Figure 2. Figure 5 As shown, the truncation P1 has the highest activity and is significantly higher than other truncation forms, indicating that -1bp to -619bp is the core promoter region.

[0145] Example 5 Verification of the SNP site of the pig CDC42 gene

[0146] (1) Mutation primer design

[0147] Based on the results of the previous population selection analysis, a SNP site (g.-359G>T) in the core promoter region of the CDC42 gene was selected for verification, and specific primers were designed as follows:

[0148] CDC42-SNP(g.-359G>T)-F:

[0149] GCAGTGAATCGAGCACTCAGCTCTCAAGCCAT(SEQ ID NO.24)

[0150] CDC42-SNP(g.-359G>T)-R:

[0151] AGTGCTCGATTCACTGCTTCCACCCTACTGTC(SEQ ID NO.25)

[0152] (2) Amplification of target plasmid pGL3-basic-CDC42-P1 and product purification and recovery

[0153] 50 μL PCR reaction system: KOD FOX Buffer 25 μL, 2 mM dNTP 10 μL, 1.5 μL each of 10 μM forward and reverse primers, recombinant plasmid pGL3-basic-CDC42-P1 DNA 1 ng, KOD FOX 1 μL, and aseptically make up to 50 μL.

[0154] The amplification conditions were as follows: pre-denaturation at 94°C for 3 min, denaturation at 98°C for 15 s, annealing at 57°C for 15 s, extension at 68°C for 60 s, 35 cycles, termination extension at 68°C for 5 min, and cooling at 16°C for 2 min.

[0155] The PCR products were identified by 1% agarose gel electrophoresis, and the SNP site of CDC42 gene (g.-359G>T) was verified as follows Figure 7 As shown, Figure 7 A is the electrophoresis diagram of the reverse PCR product of the mutant fragment, with a fragment size of 5412 bp. After verifying that the band was in the correct position, the Magen agarose gel DNA recovery kit was used for gel excision, recovery, and purification. All operations were performed according to the kit instructions.

[0156] (3) Dpn I digestion of the amplified product

[0157] Add 1 μL of Dpn I enzyme to the amplified product, gently pipette to mix, centrifuge briefly, and incubate at 37°C for 1-2 hours. Then, perform electrophoresis on a 1% agarose gel and recover the product. Remove the plasmid template to obtain the PCR product. For single-base mutations, the optimal amount of Dpn I digestion product to use is [0.02 × number of base pairs in the fragment] ng.

[0158] (4) Homologous recombination

[0159] Reaction system: 50-400 ng of Dpn I digestion product, 4 μL of 5xCE II Buffer, 2 μL of Exnase II, and make up to 20 μL with sterile water. Gently pipette to mix, briefly centrifuge, and incubate at 37°C for 30 min, then immediately cool on ice.

[0160] The recombinant plasmid pGL3-basic-CDC42-P1 was transformed, sequenced, identified, and extracted according to the same steps as in Example 3. The sequencing peak diagram of pGL3-basic-CDC42-SNP (g.-359G>T) is shown in FIG. Figure 7 As shown in B, it shows that the single point mutation plasmid of the SNP site was successfully constructed.

[0161] The same steps as in Example 4 were used to perform transient cell transfection and dual luciferase activity assay. The relative luciferase activity of the CDC42 SNP site (g.-359G>T) promoter expression vector was detected (n=3, *P<0.05, **P<0.01). Figure 7 As shown in Figure C, the activity of the control pGL3-basic was determined to be 1, and the activity of the SNP site (g.-359G>T) mutation was significantly reduced and lower than that of the non-mutated fragment, indicating that the SNP site (g.-359G>T) has an impact on the expression activity of the CDC42 gene and plays an important role in the pig's tolerance to hypoxia.

[0162] Therefore, the present invention obtains a SNP molecular marker related to pig hypoxia tolerance, g.-359G>T.

[0163] The contents not described in detail in this specification belong to the prior art known to those skilled in the art.

[0164] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A SNP molecular marker related to pig hypoxia tolerance based on the CDC42 gene, characterized in that: The SNP molecular marker is located at position 359 of the nucleotide sequence of the core promoter region of the CDC42 gene, and the base is G or T; the nucleotide sequence of the core promoter region of the CDC42 gene is -1bp to -619bp of the sequence shown in SEQ ID NO.15; the SNP site is located at 80034675bp on chromosome 6 of the international pig genome NCBI Sscrofa 11.1 version.

2. The SNP molecular marker associated with pig hypoxia tolerance based on the CDC42 gene according to claim 1, characterized in that: Under hypoxic conditions, T is the dominant allele.

3. A primer pair for amplifying the core promoter region of the CDC42 gene where the SNP molecular marker associated with porcine hypoxia tolerance according to claim 1 is located, characterized in that: The forward sequence of the primer pair is shown in SEQ ID NO.24; The reverse sequence of the primer pair is shown in SEQ ID NO.

25.

4. A reagent or kit containing the primers for the SNP molecular marker associated with pig hypoxia tolerance based on the CDC42 gene according to claim 1.

5. Use of the SNP molecular marker associated with pig hypoxia tolerance based on the CDC42 gene according to any one of claims 1 to 4 in the assisted breeding of hypoxia-tolerant pig breeds.

6. The SNP molecular marker associated with pig hypoxia tolerance based on the CDC42 gene according to claim 1, characterized in that: The core promoter region of the porcine CDC42 gene is detected, and recombinant plasmids pGL3-basic-CDC42-P1, pGL3-basic-CDC42-P2 and pGL3-basic-CDC42-P3 are constructed by constructing porcine CDC42 gene promoter truncations P1, P2 and P3, and then the relative luciferase activity of the recombinant plasmids is determined by using dual luciferase activity; the nucleotide sequence of the truncation P1 is the base sequence at positions 1-619 of SEQ ID NO.15; the nucleotide sequence of the truncation P2 is the base sequence at positions 1-1460 of SEQ ID NO.15; and the nucleotide sequence of the truncation P3 is the base sequence at positions 1-2000 of SEQ ID NO.

15.

7. The SNP molecular marker associated with pig hypoxia tolerance based on the CDC42 gene according to claim 6, characterized in that: The forward sequences of the primer pairs for amplifying the porcine CDC42 gene promoter truncation P1, P2 and P3 are shown in SEQ ID NO.16, SEQ ID NO.17 and SEQ ID NO.18, and the reverse sequences are shown in SEQ ID NO.

19.

8. A method for breeding hypoxia-tolerant pig breeds based on the SNP molecular marker of claim 1, characterized in that: The SNP molecular marker at position 359 in the core promoter region of the CDC42 gene is detected, and individuals with the T allele at this position are selected for breeding.

Images