SNP (Single Nucleotide Polymorphism) molecular marker related to carcass length and muscle color value of pig as well as detection primer, kit and application of SNP molecular marker

Abstract

The invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to an SNP molecular marker related to pig carcass length and muscle color value, and a detection primer, a kit and application thereof, the SNP molecular marker has GG, CC and CG genotypes, and the meat quality character of a pig individual with the GG genotype is superior to that of a pig individual with the CG genotype and that of a pig individual with the CC genotype. By detecting the genotype of the molecular marker, phenotype judgment can be converted into genotype identification, a detection technical means is provided for simultaneously carrying out early breeding of multiple traits and improving the breeding efficiency of boars with excellent meat quality, and a reliable targeting site is also provided for genetic improvement of pork quality traits; by selecting the breeding pigs with the GG genotypes reserved, the frequency of the GG genotypes of the groups is gradually increased, the breeding pig groups with high meat yield and good meat quality can be rapidly bred, and a rapid and effective way is provided for improving the groups with long pig carcasses and muscle color values.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and in particular to a SNP molecular marker associated with pig carcass length and muscle color value, a detection primer and a kit thereof, and applications thereof. Background Art

[0002] Pork is one of the most widely consumed meats worldwide. Carcass and muscle color are important economic traits of pork. Carcass traits reflect meat production performance, while muscle color reflects muscle quality. Healthy pork muscle should be bright or vivid red with a lustrous sheen, making it a key quality indicator of concern to consumers. Genetic improvement of these traits directly impacts the economic benefits of pig farming and is a core breeding goal of pig genetic improvement.

[0003] Currently, the carcass and meat quality traits of pigs are usually measured after they are slaughtered alive. This has problems such as high measurement cost, long measurement cycle, and large workload, which greatly increases the breeding cost and lengthens the generation interval, making the breeding work based on phenotypic selection progress slowly, greatly limiting the selection of high-quality meat quality reserve pigs in production.

[0004] Genetic factors are key to improving meat quality. Meat quality traits are mostly quantitative, controlled by multiple genes and exhibiting major gene effects. The rapid development of molecular biology techniques and the construction of genetic linkage maps for the porcine genome have enabled the identification of major genes controlling meat quality traits or closely linked molecular markers at the DNA level. These markers can be used for marker-assisted selection in breeding, facilitating genetic improvements in carcass and meat quality traits. Several key candidate genes influencing pork quality have been identified, including leptin, leptin receptor, adiponectin, adiponectin receptor, lipoprotein lipase, and forkhead transcription factor group O1. However, there is currently insufficient analysis of the functional genes that affect both carcass and meat quality traits, and there are relatively few molecular markers that can be used in genetic breeding. Therefore, finding key molecular genetic markers that control pig carcass and meat quality traits and applying them to molecular marker-assisted breeding to simultaneously improve meat production and meat quality has become one of the current hot topics in pig genomics and genetic breeding research.

[0005] Single nucleotide polymorphism (SNP) molecular markers refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level, including single-base transversions, transitions, insertions, and deletions. They are the most numerous and widely distributed molecular markers in the genome, offering advantages such as ease of genotyping, good genetic stability, and ease of automated and mass-produced testing. They are considered the most valuable next-generation genetic markers. The discovery and application of SNP markers associated with pig carcass and muscle color is of great significance for improving the overall economic benefits and healthy and sustainable development of the pig industry. Summary of the Invention

[0006] In view of the problems existing in the prior art, the present invention provides a SNP molecular marker related to pig carcass length and muscle color value, which can accurately predict the carcass length, muscle color value L1 and muscle color value L2 of pigs with different genotype groups. 24 The phenotypic traits differ significantly, with individuals with the GG genotype having longer carcasses and better muscle color values. Therefore, by detecting the genotype of this molecular marker, it is possible to convert phenotypic judgment into genotypic identification, providing a detection technology means for simultaneously carrying out early breeding of multiple traits and improving the breeding efficiency of excellent meat quality pigs, and also providing a reliable targeting site for the genetic improvement of pork quality traits. Therefore, the present invention provides the use of this SNP molecular marker, its detection primers or kit in meat quality trait evaluation or breeding. The present invention is specifically implemented through the following technical solutions:

[0007] The first aspect of the present invention provides a SNP molecular marker associated with pig carcass length and muscle color value, and its detection primer or kit for use in pork quality trait evaluation or breeding; the SNP molecular marker is located at the 62nd base of the nucleotide sequence shown in SEQ ID NO.1, S is selected from G or C, and the SNP molecular marker has GG, CC and CG genotypes; wherein, the meat quality traits of pig individuals with the GG genotype are better than those of pig individuals with the CG genotype and CC genotype.

[0008] Furthermore, the meat quality traits include carcass length, muscle color value L1 and / or muscle color value L 24 Among them, the carcass length, muscle color value L1 and / or muscle color value L of pigs with GG genotype 24 Better than pigs with CG and CC genotypes.

[0009] Furthermore, the individual pig is a Sedu black pig.

[0010] The second aspect of the present invention provides a detection primer for detecting a SNP molecular marker related to pig carcass length and muscle color value, wherein the SNP molecular marker is located at the 62nd base of the nucleotide sequence shown in SEQ ID NO.1, and S is selected from G or C; the detection primer includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0011] A third aspect of the present invention provides a kit for detecting SNP molecular markers associated with pig carcass length and muscle color value, the kit comprising the detection primers described above.

[0012] A fourth aspect of the present invention provides a method for evaluating pork quality traits, comprising the following steps:

[0013] Extracting genomic DNA from the pig individuals to be tested;

[0014] Amplifying the genomic DNA by polymerase chain reaction (PCR) using the detection primers shown in SEQ ID NO. 2-3 to obtain an amplified product;

[0015] detecting the genotype of the 62nd base of the amplified product, wherein the 62nd base has a genotype of GG, CC, and CG;

[0016] The meat quality traits of the pig individuals to be tested are evaluated based on the genotype detection results of the 62nd base. The meat quality traits of the pig individuals to be tested with the GG genotype are better than those of the pig individuals to be tested with the CG genotype and the CC genotype.

[0017] Furthermore, the meat quality traits include carcass length, muscle color value L1 and / or muscle color value L 24 Among them, the carcass length, muscle color value L1 and / or muscle color value L of pigs with GG genotype 24 Better than pigs with CG and CC genotypes.

[0018] A fifth aspect of the present invention provides a method for genetically improving pork quality traits, comprising the following steps:

[0019] Extracting genomic DNA from the pig individuals to be tested;

[0020] Amplifying the genomic DNA by polymerase chain reaction (PCR) using the detection primers shown in SEQ ID NO. 2-3 to obtain an amplified product;

[0021] detecting the genotype of the 62nd base of the amplified product, wherein the 62nd base has a genotype of GG, CC, and CG;

[0022] According to the detection result of the genotype of the 62nd base, the pig individual to be tested with the GG genotype is retained as a breeding pig.

[0023] Furthermore, the pig individual to be tested is a Sedu black pig.

[0024] The advantages and positive effects of the present invention are:

[0025] 1. The SNP molecular markers provided by the present invention and pig carcass traits and muscle color values ​​(L1 and L 24 ) are significantly associated with each other. By determining the genotype of this SNP molecular marker, rapid, accurate, and high-throughput identification or early breeding of meat quality traits such as pig carcass length and muscle color value can be achieved at the molecular level, providing an effective and reliable detection technology for breeding genetically stable and multi-trait excellent meat quality pigs, which is conducive to accelerating breeding efficiency and accuracy.

[0026] 2. The SNP molecular markers of the present invention provide reliable targeting sites for the genetic improvement of pork quality traits. By selecting breeding pigs that retain the GG genotype, the frequency of the GG genotype in the population can be gradually increased, which is conducive to the rapid cultivation of a breeding pig population with high meat production and good meat quality. It provides a fast and effective way for the population improvement of pig carcass length and muscle color value, which is of great significance to improving the economic benefits of pig breeding enterprises. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0028] Figure 1 This is an agarose gel electrophoresis diagram of the SNP molecular marker amplification product according to an embodiment of the present invention;

[0029] Figure 2 This is a peak diagram of nucleotide sequence sequencing of different genotypes of SNP molecular markers in the embodiment of the present invention. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0031] Given the information contained herein, it will be readily apparent to those skilled in the art that various modifications may be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the processes, properties, or components defined herein, as these embodiments and other descriptions are intended only to illustrate specific aspects of the present invention. Indeed, various modifications to the embodiments of the present invention that are apparent to those skilled in the art or related fields are intended to be within the scope of the appended claims.

[0032] For a better understanding of the present invention and not to limit the scope of the present invention, all numerals and other numerical values ​​used in the present invention to express amounts, percentages, etc. should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant digits and by conventional rounding methods.

[0033] The terms "comprises," "includes," "contains," "having," and similar expressions are non-restrictive, meaning that other steps and other components that do not affect the result may be added. The term "and / or" should be considered as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is considered to include the following: (i) A, (ii) B, and (iii) A and B.

[0034] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below.

[0035] The present invention screened out a variant site (g.11537602G>C) in the pig CREB3L2 gene and found that it was related to pig carcass traits and muscle color values ​​(L1 and L 24 ) were significantly associated with three genotypes, GG, CC and GC. The carcass length, muscle color value L1 and muscle color value L 24 The phenotypic traits were significantly different, among which the carcass length, muscle color value L1 and muscle color value L of pigs with GG genotype were significantly different. 24 The values ​​are significantly higher than those of pigs with the CG and CC genotypes, and they have longer carcasses and better muscle color. The g.11537602G>C variant site of the present invention can be independently developed as a SNP molecular marker, providing a new and reliable means for breeding genetically stable pigs with excellent meat quality traits, and enriching genetic resources for breeding.

[0036] The g.11537602G>C mutation site mentioned above is located in the intron of the CREB3L2 gene (Ensembl number: ENSSSCG00000016520.4), specifically at the 11537602bp base of chromosome 18 (GeneBank number: CM000829.5) of the pig (Sus scrofa) reference genome Sscrofa11.1 (assembly number: GCF 000003025.6). Compared with the reference genome, there is a G>C base variation, and the corresponding site number in the Ensembl database is rs345463196.

[0037] Based on this, one embodiment of the present invention provides a SNP molecular marker related to pig carcass length and muscle color value, and its detection primer or kit for use in pork quality trait evaluation or breeding; the SNP molecular marker is located at the 62nd base of the nucleotide sequence shown in SEQ ID NO.1, S is selected from G or C, and the SNP molecular marker has GG, CC and CG genotypes; wherein, the meat quality traits of pig individuals with GG genotype are better than those of pig individuals with CG genotype and CC genotype.

[0038] Specifically, the meat quality traits include carcass length, muscle color value L1 and / or muscle color value L 24 Among them, the carcass length, muscle color value L1 and / or muscle color value L of pigs with GG genotype 24 That is, the carcass length of pigs with GG genotype is longer than that of pigs with CG genotype and CC genotype, and the muscle color value L1 and / or muscle color value L 24 Better than pigs with CG and CC genotypes.

[0039] The present invention can achieve rapid, accurate and high-throughput identification of meat quality traits such as pig carcass length and muscle color value at the molecular level by detecting the genotype of the above-mentioned SNP molecular markers, and can also carry out breeding selection based on genetic background, which is beneficial to predict meat quality by detecting SNP molecular markers at any stage of breeding, especially in the early stage of development, and to screen out individuals with excellent traits in advance, thereby improving the accuracy and reliability of breeding selection, shortening the cycle of excellent breeding pigs, and accelerating breeding efficiency. Specifically, when the SNP site in the pig to be tested is detected to be the GG genotype, it can be judged as having better pig carcass length, muscle color value L1 and muscle color value L 24 , the meat production of individual pigs is higher and the muscle quality is better; when the SNP site in the tested pig individual is detected to be CC genotype, it can be judged to have poor pig carcass length, muscle color value L1 and muscle color value L 24, the meat yield of individual pigs is low and the muscle quality is poor; when the SNP variant site is detected in the tested pig individual as the CG genotype, its traits are intermediate. In addition, the discovery of this SNP molecular marker has important application value for the genetic improvement of pork quality traits. By retaining individuals with the GG genotype for seed production during the breeding process, the proportion of excellent genes in the offspring is gradually increased, which is beneficial to enhancing the meat quality of the group; or, by using the SNP molecular marker site of the present invention as an improvement target for genetic breeding, using gene mutation and other methods to improve CC and CG genotypes to GG genotypes, achieving enrichment of GG genotypes, it is beneficial to provide a fast and effective way for group improvement of pig carcass length and muscle color value.

[0040] In the present invention, the determination of pig carcass length and muscle color value is carried out with reference to the agricultural industry standard of the People's Republic of China "NY / T 821-2019 Technical Specification for the Determination of Pork Traits". Among them, the pig carcass length is generally the straight length of the carcass, which refers to the straight length from the center point of the front edge of the pubic symphysis to the front edge of the first cervical vertebra; the muscle color value L1 refers to the meat color value measured within 45 minutes after slaughter, and the muscle color value L 24 It refers to the meat color value measured 24 hours after slaughter. The meat color value is obtained by measuring the longissimus dorsi muscle at the junction of the thoracic and lumbar vertebrae at multiple points using a meat color meter and calculating the average value.

[0041] The detection of the SNP molecular marker genotype of the present invention can adopt the methods commonly used in the prior art, such as gene chip technology, competitive allele-specific PCR (KASP) technology, Taqman probe technology, high-resolution melting curve (HRM) method, allele-specific PCR (AS-PCR) technology, direct sequencing and matrix-assisted laser desorption ionization time-of-flight mass spectrometry technology.

[0042] The present invention preferably adopts the direct sequencing method of PCR products, including the steps of extracting genomic DNA of the pig individual to be tested, PCR amplifying the target fragment and sequencing the target fragment. In the sequencing peak diagram, the SNP molecular marker genotype appears as a single peak when it is homozygous, and as overlapping peaks when it is heterozygous.

[0043] Another embodiment of the present invention provides a detection primer for detecting the SNP molecular marker as described above, wherein the detection primer includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer (F) is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer (R) is shown in SEQ ID NO.3.

[0044] Forward primer F: AACTGTTACCTACCTGCTCT (see SEQ ID NO. 2);

[0045] Reverse primer R: TCTTGACCTCTAATCCCTC (see SEQ ID NO. 3).

[0046] The present invention uses the genomic DNA of the individual pig to be tested as a template, utilizes the above-mentioned detection primers to perform PCR amplification, and can obtain accurate base information of the SNP site through sequencing and other means. Its genotyping effect is good, the primer detection result is highly consistent with the actual situation, and has good specificity, which is conducive to the rapid and accurate identification of the genotype of the SNP molecular marker.

[0047] Another embodiment of the present invention provides a kit for detecting the SNP molecular marker described above, wherein the kit includes the detection primer described above.

[0048] The advantages of the kit over the prior art are the same as those of the detection primers described above, and will not be repeated here.

[0049] Optionally, the kit further comprises a PCR amplification reagent. The present invention does not particularly limit the source of the PCR amplification reagent, and conventional commercially available products in the art can be used. In a typical embodiment, the PCR amplification reagent comprises DNA polymerase, dNTPs, and a buffer.

[0050] Based on the same inventive concept as above, another embodiment of the present invention provides a method for evaluating pork quality traits, comprising the following steps:

[0051] Extracting genomic DNA from the pig individuals to be tested;

[0052] Amplifying the genomic DNA by polymerase chain reaction (PCR) using the detection primers shown in SEQ ID NO. 2-3 to obtain an amplified product;

[0053] detecting the genotype of the 62nd base of the amplified product, wherein the 62nd base has a genotype of GG, CC, and CG;

[0054] The meat quality traits of the pig individuals to be tested are evaluated based on the genotype detection results of the 62nd base. The meat quality traits of the pig individuals to be tested with the GG genotype are better than those of the pig individuals to be tested with the CG genotype and the CC genotype.

[0055] Specifically, the meat quality traits include carcass length, muscle color value L1 and / or muscle color value L 24 Among them, the carcass length, muscle color value L1 and / or muscle color value L of pigs with GG genotype 24 Better than pigs with CG and CC genotypes.

[0056] Based on the same inventive concept as above, an embodiment of the present invention further provides a method for genetically improving pork quality traits, comprising the following steps:

[0057] Extracting genomic DNA from the pig individuals to be tested;

[0058] Amplifying the genomic DNA by polymerase chain reaction (PCR) using the detection primers shown in SEQ ID NO. 2-3 to obtain an amplified product;

[0059] detecting the genotype of the 62nd base of the amplified product, wherein the 62nd base has a genotype of GG, CC, and CG;

[0060] According to the detection result of the genotype of the 62nd base, the pig individual to be tested with the GG genotype is retained as a breeding pig.

[0061] In the present invention, individuals with excellent genotype GG are selected according to the genotype of SNP molecular markers and used as breeding pigs, and individuals with GC and CC genotypes at this site are gradually eliminated, which can significantly improve the group carcass length, muscle color value L1 and / or muscle color value L 24 etc. phenotypes, speeding up the breeding process of pigs with good meat quality.

[0062] The above-mentioned individual pigs are preferably Sedu Black Pigs.

[0063] The present invention will be further described below with reference to specific examples. Experimental methods in the following examples where specific conditions are not specified were generally performed under conventional conditions, such as those described in the Molecular Cloning Laboratory Manual (4th Edition) published by Cold Spring Harbor Laboratory, or under conditions recommended by the manufacturer.

[0064] 1. Determination of phenotypic traits of carcass length and muscle color value in the experimental group of pigs

[0065] The experimental pigs of the present invention are 243 Selenium City Black Pig castrated boars jointly bred by the Institute of Animal Husbandry and Veterinary Medicine of Hubei Academy of Agricultural Sciences and Hubei Tianzhili High-quality Pig Breeding Co., Ltd. They are raised in an indoor environment with the ambient temperature controlled at 25°C. They are fed with corn and soybean meal complete feed, and have free access to food and drinking water throughout the whole process. When the pigs weigh 100 kg, they are slaughtered at the Breeding Pig Quality Supervision and Inspection and Testing Center of the Ministry of Agriculture of Huazhong Agricultural University (Wuhan). The pork traits are measured in accordance with the agricultural industry standard of the People's Republic of China "NY / T 821-2019 Technical Specifications for the Determination of Pork Traits", including carcass length and muscle color value.

[0066] Carcass length: Use a tape measure to measure the straight line length from the front edge of the pubic symphysis to the front edge of the first cervical vertebra of the carcass, in cm.

[0067] Muscle color value: Take the cross section of the longissimus dorsi muscle at the junction of the thoracic and lumbar vertebrae to measure the meat color. The muscle color value measured within 45 minutes of slaughter is L1. After measuring the muscle color value L1, store it in a 4℃ refrigerator for 24 hours, and the measured muscle color value is L 24 .

[0068] 2. Extraction of genomic DNA from experimental pig populations

[0069] Pig ear tissue was collected and a cell / tissue genomic DNA extraction kit (catalog number: DP1901) produced by Beijing Biotech Biotechnology Co., Ltd. was used according to the instructions of the kit. The concentration and quality of the extracted DNA were tested and stored at -20°C for future use.

[0070] 3. Screening of SNP molecular markers (g.11537602G>C) of CREB3L2 gene in experimental pig population

[0071] 3.1. PCR amplification of CREB3L2 gene

[0072] Primer pairs were designed based on the porcine CREB3L2 gene sequence (GenBank accession number: NC_010460), and their sequences (5'-3') are as follows:

[0073] Forward primer F: AACTGTTACCTACCTGCTCT (see SEQ ID NO. 2);

[0074] Reverse primer R: TCTTGACCTCTAATCCCTC (see SEQ ID NO. 3).

[0075] The above primer pairs were used to perform PCR amplification in a mixed genomic DNA pool of 30 Xidu black pigs. The PCR reaction system was 50 μL, including: 100 ng of genomic DNA, 1 μL of upstream primer, 1 μL of downstream primer, 25 μL of PCR mix (trade name Taq 2XPCRMix with Dye V2, purchased from Wuhan Aibote Biotechnology Co., Ltd., product number: RK20608), and ddH2O was added to make up the total volume to 50 μL; the PCR program was as follows: pre-denaturation at 98°C for 45 s; denaturation at 98°C for 10 s, annealing at 59°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min; and storage at 4°C.

[0076] The PCR products were detected by 1.5% agarose gel electrophoresis. Figure 1 As shown in Figure 1, the marker lane is the molecular marker DL1000, and lanes 1-5 are the PCR amplification products. The results show that the amplified product fragment is approximately 664 bp in size and exhibits a single target band, demonstrating the good specificity of the primers.

[0077] 3.2 PCR product purification

[0078] The above gel electrophoresis band was cut out and purified using the Gel Extraction Kit of Shanghai Shenggong Bioengineering Co., Ltd. (follow the instructions of the kit). The specific steps are as follows: first, the gel containing the target fragment was cut out from the agarose gel, placed in a 1.5 mL centrifuge tube, 400 μL of sol solution was added, and the gel was completely melted in a 50-60 ° C water bath. When the gel was heated to melt, it was mixed every 2 minutes and cooled to room temperature; the centrifuge column was placed in a collection tube, the mixed solution was transferred to the centrifuge column, and it was placed at room temperature for 2 minutes; centrifuged at 12000 r / min for 1 minute, at which time the DNA was adsorbed. Discard the waste liquid in the collection tube, place the centrifuge column in the same collection tube, add 700μL eluent, and centrifuge at 12000r / min for 1min; discard the waste liquid in the collection tube, and centrifuge at 12000r / min for 1min; place the centrifuge column in a pre-prepared sterilized 1.5mL centrifuge tube, add 40μL eluent or double distilled water (pH>7.0), and place at room temperature or 37℃ for 2-3min; centrifuge at 12000r / min for 1min. The liquid in the centrifuge tube is the recovered DNA fragments.

[0079] 3.3. Acquisition of SNP sites

[0080] The recovered DNA fragments were sent to Wuhan Aoko Dingsheng Biotechnology Co., Ltd. for reverse sequencing using an ABI3730XL sequencer. The sequencing results showed that there was a variant site g.11537602G>C in the intron of the CREB3L2 gene. The sequencing peak results of the complementary chain of the sequence where the molecular marker g.11537602G>C is shown in Figure 2 , from top to bottom are CC homozygous type, CG heterozygous type and GG homozygous type. The results showed that there were G and / or C bases at the 62nd base site of the amplified product (reflected as C and / or G on the peak graph, that is, the peak graph was determined to be G base, and the molecular marker site was C base), thereby confirming the existence of the SNP molecular marker. When the sequencing result of the variant site is only a single peak of G, it is a CC genotype; when the sequencing result of the variant site is only a single peak of C, it is a GG genotype; when the sequencing result of the variant site is a double peak of G and C, it is a CG genotype. In addition, the genomic DNA of Selenium City Black Pig individuals with CC homozygous, CG heterozygous and GG homozygous genotypes at the SNP sites were selected as templates, showing that the primer detection results were highly consistent with the actual situation, and the genotyping effect was good.

[0081] The sequence of the amplified product containing the molecular marker g.11537602G>C is shown below. The molecular marker g.11537602G>C is located at the 62nd S base, where S is selected from G or C:

[0082] AACTGTTACCTACCTGCTCTTAAAAATAGAAGTTGCCCGAGGCTGGGATTTCCATGTCTCCSAGGTGCCTTCTGTGAGCCATCAGGAGCAATGTTTTTCTCGTTTGATTAGTTATGACGACTTCTTGGTCCAGAAGGACAAAGACTTAGAGACATGTTCAGAGTCTACAAAATAATGAAGCACCTAGGTAGAGCGAATGGATTTACTCGTTAGATCCTGAATTATTAGAGCTTTGGGCTTCCTCTTAAAGCTGAAAAAAATAGTTCCCATACAGACGATGAGATATCATTTTAAACCAGTAAGTAGTGCTTTTAGGAGAGCTATTGTTTCTAGAGTGGATTCAGGCTAAAAGTGGTTTCAGAAAATATGGCTGGTATAAAAATGAGGAGTGCGTGTTTTCAAGTCATTGTGCGAACCCTTGTCCCTTCCCTTAAACCTAGCTGGGTGTTGGACATTTCTAACATTCATGTATTTCCTGTCCGCTTCTGCGCAAATTACATTGCTGGGAATTTACTGTGGGGTTTTGCAATTTAAGGAGCAAAACAGTCCATACTTTTTATCTTAGGTATCCTATTATATGCATTGACTCTATCTGGAAGGGTGCTCAAGAAACAGGTAATTGATATTTTTCTGGTAAGAAGTCTTGAGGGATTAGAGGTCAAGA (see SEQ ID NO.1), where S = G or C.

[0083] The g.11537602G>C mutation described above is located at base 11537602 (chr18:11537602) on chromosome 18 of the pig (Sus scrofa) reference genome Sscrofa11.1. Compared to the reference genome, there is a G>C base variation, corresponding to locus rs345463196 in the Ensembl database. The CREB3L2 gene is accessioned as ENSSSCG00000016520.4 in the Ensembl database and is located at bases 11533183 to 11666113 on chromosome 18 of the pig (Sus scrofa) reference genome Sscrofa11.1, i.e., position information 18:11533183-11666113. The NCBI database assembly number of the pig (Sus scrofa) reference genome Sscrofa11.1 is GCF000003025.6, and the NCBI GeneBank database number of chromosome 18 is CM000829.5.

[0084] 4. Association analysis between meat quality traits of the experimental population and SNP molecular marker genotypes

[0085] To determine whether the G>C mutation at bp 11537602 on chromosome 18 is associated with differences in pork quality traits, the SNP site polymorphism was detected in 243 Xidu black pigs using the above-established detection method. The experimental population was divided into groups based on the genotype of the SNP site. Among the total sample of 243 individuals, 6 were found to be CC-type, 79 were CG-type, and 158 were GG-type. The correlation between different genotypes of this polymorphic site (CC homozygous, CG heterozygous, and GG homozygous) and meat quality traits was analyzed.

[0086] The carcass length and muscle color value (L1 and L 24 ) statistical data as phenotypic values, and variance analysis was performed on different SNP genotype groups using the GLM procedure of SAS statistical software (SAS Institute Inc, Version 9.4). The results were expressed as least squares mean ± standard error, and P < 0.05 was considered significant.

[0087] The analysis model used is: Y ijl =μ+G i +W j +e ijl In the model, Y ijl is the phenotypic value of the trait, μ is the average value, G iis the genotype effect (including gene additive effect and dominant effect, additive effect uses 1, 0 and -1 to represent GG, CG and CC genotypes respectively, dominant effect uses 1, -1 and 1 to represent GG, CG and CC genotypes respectively, W j is age in days; e ijl is the residual effect.

[0088] The results of the association analysis are shown in Table 1. In Table 1, different lowercase letters indicate that the data in the same row are significantly different (P<0.05). Additive effect refers to the effect of alleles on traits that can be linearly accumulated through "dose", that is, the effect of each allele is independent and superimposable. Dominant effect refers to the interaction between alleles that causes the phenotype of heterozygotes to deviate from the mean of homozygotes, that is, a certain allele has a dominant effect on another allele. It can be seen that the pig carcass length, muscle color value L1 and muscle color value L corresponding to different genotypes are significantly different. 24 The numerical differences were significant, among which the carcass length, muscle color value L1 and muscle color value L of pigs with GG genotype were significantly different. 24 The values ​​were significantly higher than those of pigs with CG genotype and CC genotype, indicating that individuals with GG genotype had longer carcasses and better muscle color values; GG genotype was an excellent genotype.

[0089] Table 1 Association analysis between the G>C mutation at bp 11537602 on chromosome 18 of the pig genome and meat quality traits

[0090]

[0091] In summary, the SNP molecular marker g.11537602G>C provided by the present invention and the PCR detection primers developed based on the molecular marker can be used for the carcass length, muscle color value L1 and muscle color value L 24 The identification or early breeding of phenotypic traits such as GG can convert phenotypic judgment into genotypic identification, thereby quickly identifying or screening pigs with excellent traits at the genotypic level. In addition, marker-assisted selection can be carried out simultaneously for the two traits of carcass length and muscle color value, providing a detection technology means for the simultaneous early breeding of multiple traits and improving the breeding efficiency of high-quality meat pigs. It also provides a reliable target site for the genetic improvement of pork quality traits. By selecting pigs that retain the GG genotype, the frequency of the GG genotype in the herd can be gradually increased, which is conducive to the rapid cultivation of a herd of pigs with high meat production and good meat quality, thereby improving the economic benefits of pig farming enterprises.

[0092] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with pig carcass length and muscle color value, and its detection primer or kit for use in pork quality trait evaluation or breeding, characterized in that: The SNP molecular marker is located at the 62nd base of the nucleotide sequence shown in SEQ ID NO.1, S is selected from G or C, and the SNP molecular marker has GG, CC and CG genotypes; among them, the meat quality traits of pig individuals with GG genotype are better than those of pig individuals with CG genotype and CC genotype.

2. The use of the SNP molecular marker associated with pig carcass length and muscle color value, its detection primer or kit in pork quality trait evaluation or breeding according to claim 1, characterized in that: The meat quality traits include carcass length, muscle color value L1 and / or muscle color value L 24 Among them, the carcass length, muscle color value L1 and / or muscle color value L of pigs with GG genotype 24 Superior to pig individuals with CG genotype and CC genotype; the pig individuals are Sedu Black Pigs.

3. The use of the SNP molecular marker associated with pig carcass length and muscle color value, its detection primer or kit in pork quality trait evaluation or breeding according to claim 1, characterized in that: The detection primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

4. The use of the SNP molecular marker associated with pig carcass length and muscle color value, its detection primer or kit in pork quality trait evaluation or breeding according to claim 1, characterized in that: The kit includes the detection primers, which include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

5. A detection primer for detecting SNP molecular markers related to pig carcass length and muscle color value, characterized in that: The SNP molecular marker is located at the 62nd base of the nucleotide sequence shown in SEQ ID NO.1, and S is selected from G or C; the detection primer includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

6. A kit for detecting SNP molecular markers associated with pig carcass length and muscle color value, characterized in that: The kit comprises the detection primer according to claim 5.

7. A method for evaluating pork quality traits, characterized in that: The following steps are involved: Extracting genomic DNA from the pig individuals to be tested; Amplifying the genomic DNA by polymerase chain reaction (PCR) using the detection primers shown in SEQ ID NO. 2-3 to obtain an amplified product; detecting the genotype of the 62nd base of the amplified product, wherein the 62nd base has a genotype of GG, CC, and CG; The meat quality traits of the pig individuals to be tested are evaluated based on the genotype detection results of the 62nd base. The meat quality traits of the pig individuals to be tested with the GG genotype are better than those of the pig individuals to be tested with the CG genotype and the CC genotype.

8. The method for evaluating pork quality traits according to claim 7, wherein: The meat quality traits include carcass length, muscle color value L1 and / or muscle color value L 24 Among them, the carcass length, muscle color value L1 and / or muscle color value L of pigs with GG genotype 24 Superior to pig individuals with CG genotype and CC genotype; the pig individuals are Sedu Black Pigs.

9. A method for genetic improvement of pork quality traits, characterized in that: The following steps are involved: Extracting genomic DNA from the pig individuals to be tested; Amplifying the genomic DNA by polymerase chain reaction (PCR) using the detection primers shown in SEQ ID NO. 2-3 to obtain an amplified product; detecting the genotype of the 62nd base of the amplified product, wherein the 62nd base has a genotype of GG, CC, and CG; According to the detection result of the genotype of the 62nd base, the pig individual to be tested with the GG genotype is retained as a breeding pig.

10. The method for genetic improvement of pork quality traits according to claim 9, characterized in that: The meat quality traits include carcass length, muscle color value L1 and / or muscle color value L 24 The pig individual to be tested is the Sedu Black Pig.

Images