Primer group, kit and detection method for individual recognition of treponema pallidum

Abstract

The invention provides a primer group, a kit and a detection method for individual identification of treponema pallidum, the primer group comprises 12 pairs of primers with nucleotide sequences respectively corresponding to SEQ ID NO.1-SEQ ID NO.24. The invention provides a specific DNA fingerprint spectrum of treponema pallidum strains formed by 12 loci, a variable number tandem repeat sequence (microsatellite sequence) of a genome is analyzed, and the specific DNA fingerprint spectrum of the treponema pallidum strains is obtained. The method is used for realizing individual identification of treponema pallidum strains. The primer group provided by the invention has high sensitivity, accuracy and specificity, and the detection method based on the primer group can carry out individual identification, genetic identification and genetic typing analysis at the same time, and has wide application prospects in the fields of population genetics and the like.

Description

Technical Field

[0001] The present invention belongs to the field of gene engineering technology, and in particular relates to a primer set, a kit and a detection method for individual identification of Treponema pallidum. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Syphilis is a systemic infectious disease with a high incidence rate in clinical practice and is highly contagious. T. pallidum ) is the causative agent of syphilis, a human-transmitted pathogen. One of the key measures for syphilis control is to detect the pathogen, trace the source of infection, treat the individual, and interrupt the chain of transmission to achieve a complete cure. Currently, there are no effective molecular biology methods that can both detect the pathogen and trace its transmission chain. Whole-genome sequencing can precisely locate the individual pathogen, but requires a large amount of the pathogen in the specimen to extract genomic DNA sufficient for sequencing.

[0004] Currently, the typing method of Treponema pallidum is widely used by the US CDC. It uses traditional polymerase chain reaction to target polA, tpp47, bmp and tp0319 genes for PCR amplification, and performs genotyping based on the sequencing results of the PCR amplification products. This method is extremely complex, and the result is a combination of numbers and letters to form a string of genotypes. For example, the genotype of a certain strain is: 14d10 / g, which is not easy to understand.

[0005] Tandem repeats (TRs) are a type of DNA sequence widely found in microbial genomes, with core sequences ranging from 2 to several hundred bases. These sequences are highly discriminatory between individuals and serve as effective markers for identifying DNA from different individuals. Therefore, TR amplification detection technology is widely used in individual identification, parentage testing, and genotyping analysis. Only 1ng of template DNA is required, while whole-genome sequencing requires over 1ug of template DNA, 1,000 times the amount required for TR amplification detection.

[0006] At present, there is no STR test kit for Treponema pallidum at home and abroad, but there are a large number of suspected syphilis patients at home and abroad, and an efficient and sensitive detection technology is urgently needed. Summary of the Invention

[0007] In order to overcome the shortcomings of the existing technology, the present invention provides a primer set, a kit and a detection method for individual identification of Treponema pallidum, which can be used for individual identification of Treponema pallidum, tracing the source of infection of the pathogen, and the transmission chain relationship.

[0008] In order to achieve the above objectives, the present invention provides the following technical solutions: As a first aspect of the present invention, a marker combination for individual identification of Treponema pallidum is provided, characterized in that the DNA fingerprint of the Treponema pallidum individual is composed of the tandem repeat number of 12-site tandem repeat sequence units, and the tandem sequence units of the 12 sites are respectively: the repeating unit of Syp01 is TATGGGGCT; the repeating unit of Syp02 is TGAAACGGT; the repeating unit of Syp03 is CGGTACAAGTT; the repeating unit of Syp04 is AGAGCAGCAGCACCAGGAACTGCACCAGGGACCGCCCCAGGAACTGCACCA; the repeating unit of Syp05 is The repeating unit of Syp06 is CTCCGG; the repeating unit of Syp07 is AGTGTCGGGGTATCATGGAAGGCGGTACAGGCACTGCGTGCACGGCGCGCTTGTGCGTCGCGC; the repeating unit of Syp08 is GGTGGC; the repeating unit of Syp09 is TTC; the repeating unit of Syp10 is TAG; the repeating unit of Syp11 is ACAGCA; and the repeating unit of Syp12 is CGTGAGGTGGAGGACGCGCCGAAGGTAGTGGAGCCGGCCTCTGAGCGTGAGGGAGGGGAG. Treponema pallidum strains have the same repeating unit but different numbers of tandem repeats.

[0009] As a second aspect of the present invention, a primer set of a marker combination for individual identification of Treponema pallidum is provided, which is used to detect the marker combination, wherein the number of tandem repeats is obtained by PCR amplification of 12 pairs of primers, and the primer set comprises the following 12 pairs of primers, namely Syp01-F, Syp01-R, Syp02-F, Syp02-R, Syp03-F, Syp03-R, Syp04-F, Syp0 Syp04-R, Syp05-F, Syp05-R, Syp06-F, Syp06-R, Syp07-F, Syp07-R, Syp08-F, Syp08-R, Syp09-F, Syp09-R, Syp10-F, Syp10-R, Syp11-F, Syp11-R, Syp12-F, and Syp12-R, and the nucleotide sequences of the upstream and downstream primers are shown in SEQ ID NO.1 to SEQ ID NO.24.

[0010] As a third aspect of the present invention, a detection method for individual identification of Treponema pallidum is also provided, in which the DNA fingerprint of individual Treponema pallidum is composed of the number of tandem repeats of the tandem repeat sequence units of the 12 sites, which is used for individual identification of Treponema pallidum strains.

[0011] As a fourth aspect of the present invention, a product for individual identification of Treponema pallidum strains is provided. The product is a reagent or a kit comprising a primer set of the above-mentioned marker combination.

[0012] Furthermore, the detection kit includes: 15 μL each of 10 μM F and R primers, 12.5 μL of 2×ES TaqMasterMix 3, 182.5 μL of double-distilled water, 100 μL of positive control genomic DNA, and 100 μL of negative control genomic DNA.

[0013] As a fifth aspect of the present invention, at least one of the following applications of the product is provided: (1) Individual identification of Treponema pallidum strains; (2) determine the relationship between Treponema pallidum strains; (3) Genotyping of Treponema pallidum strains and subsequent population genetics studies.

[0014] Furthermore, the present invention provides a set of DNA fingerprints consisting of 12 sites unique to Treponema pallidum strains for confirming individual identification of Treponema pallidum strains.

[0015] Furthermore, the application includes collecting DNA fingerprints of strains collected in a certain area, comparing the fingerprints, and determining the relationship between the strains.

[0016] Furthermore, the application includes performing cluster analysis on the DNA fingerprints of strains collected in a certain area to obtain genotyping results and then perform population genetics analysis.

[0017] As a sixth aspect of the present invention, a method for constructing a fingerprint of Treponema pallidum is also provided, comprising the following steps: (1) Extracting genomic DNA from the strain to be tested or blood sample; (2) using the genomic DNA extracted in step (1) as a template, and performing PCR amplification using the above primer set; (3) The PCR amplification products of step (2) are subjected to agarose gel electrophoresis or capillary electrophoresis sequencing to obtain the DNA length of the PCR product. The tandem repeat number of the site is determined by comparing the corresponding relationship table between the DNA length of the PCR product and the tandem repeat number. The tandem repeat numbers of the 12 sites constitute the characteristic fingerprint of each strain.

[0018] Preferably, in step (2), the conditions for PCR amplification include the following: the PCR amplification reaction system is 25 μL: 4 μL of genomic DNA template, 0.6 μL each of 10 μM F and R primers, 12.5 μL of 2×ES Taq MasterMix, and 7.3 μL of double-distilled water; the PCR amplification reaction program is: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 45 cycles, final extension at 72°C for 5 min, and storage at 4°C.

[0019] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention provides a primer set, a kit, and a detection method for the individual identification of Treponema pallidum. This invention is the first to develop a primer set, a kit, and a detection method for analyzing variable number tandem repeat sequences (microsatellite sequences) in the genome. This method can be used to identify individuals with Treponema pallidum, track the source of infection of the pathogen, and determine its transmission chain.

[0020] 2. The primer set provided by the present invention has high sensitivity, accuracy, and specificity. It can be used for individual identification and simultaneous kinship determination, genotyping, and population genetics analysis.

[0021] 3. The amplification system provided by the present invention is simple to operate, saves raw materials, has low cost, and the entire amplification process takes a short time, is easy to operate, and the results are easy to analyze. It is more accurate and sensitive, and can be used for large-scale detection and analysis of clinical samples, providing test results faster and more accurately. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0023] Figure 1 Gel electrophoresis of 12-locus PCR amplification products from genomic DNA of five blood specimens. M: DNA marker and DNA molecular weight. Numbers 1, 2, 3, 4, and 5 correspond to genomic DNA from blood specimens from China TL-1, China TL-2, China TL-3, China TL-4, and China TL-5, respectively.

[0024] Figure 2Cluster analysis of tandem repeat numbers at 12 loci in 189 strains. DETAILED DESCRIPTION

[0025] It should be noted that the following detailed descriptions are exemplary and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.

[0026] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0027] Multilocus variable number tandem repeat analysis (MLVA) is a PCR-based typing method. It distinguishes bacterial strains by differentiating the number of repeats at multiple polymorphic tandem repeat (VNTR) sites within the bacterial genome. VNTRs are short, regularly arranged sequences on the chromosomal genome, also known as microsatellites. They are characterized by their diversity, wide distribution, high polymorphism, reproducibility, and individual specificity. This method offers high resolution, excellent reproducibility, speed, and simplicity, making it widely used in molecular epidemiological surveys and traceability analyses.

[0028] Like most bacteria, the genome of Treponema pallidum contains numerous short, repetitive DNA sequences with a tandem repeat structure. The key to the MLVA method lies in the selection of VNTR loci. Loci with excessive sequence polymorphism increase the complexity of typing results, thereby underestimating interstrain homology. Loci with low sequence polymorphism reduce the resolution of typing results, thereby overestimating interstrain homology.

[0029] Materials used in the examples of the present invention include: PCR amplification equipment (SensoQuest LabCycler, Germany), gel imaging system (BioRad Gel doc XR, USA), electrophoresis apparatus (Bio-Rad Hercules, USA), 2× EsTaq MasterMix (Kangwei Century Biotechnology Co., Ltd., China), primer synthesis (Shanghai Bioengineering Co., Ltd., China), blood / cell / tissue genomic DNA extraction kit (DNeasy Blood & Tissue Kit QIAGEN, Germany), and bacterial genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., China).

[0030] In the examples of the present invention, the strains and the method for preparing the strain genomic DNA template are as follows: A total of 189 Treponema pallidum strains were used for MLVA typing. Full genome sequence data for 184 strains were obtained from the National Center for Biotechnology Information (NCBI) website. Genomic DNA for the remaining five strains was extracted from blood specimens of five different patients at the same hospital in China. The template for VNTR PCR was genomic DNA, extracted using a bacterial genomic DNA extraction kit.

[0031] The genomic DNA of Escherichia coli ATCC 5922 strain was used as the negative control for PCR amplification in this study, and the genomic DNA of Treponema pallidum strain was used as the positive control for PCR amplification.

[0032] In an embodiment of the present invention, a marker combination for individual identification of Treponema pallidum is provided, which is composed of the tandem repeat numbers of tandem repeat sequence units of 12 sites to form a DNA fingerprint of the Treponema pallidum individual, wherein the tandem sequence units of the 12 sites are: the repeating unit of Syp01 is TATGGGGCT; the repeating unit of Syp02 is TGAAACGGT; the repeating unit of Syp03 is CGGTACAAGTT; the repeating unit of Syp04 is AGAGCAGCAGCACCAGGAACTGCACCAGGGACCGCCCCAGGAACTGCACCA; the repeating unit of Syp05 is GGGG CT; the repeating unit of Syp06 is CTCCGG; the repeating unit of Syp07 is AGTGTCGGGGTATCATGGAAGGCGGTACAGGCACTGCGTGCACGGCGCGCTTGTGCGTCGCGC; the repeating unit of Syp08 is GGTGGC; the repeating unit of Syp09 is TTC; the repeating unit of Syp10 is TAG; the repeating unit of Syp11 is ACAGCA; the repeating unit of Syp12 is CGTGAGGTGGAGGACGCGCCGAAGGTAGTGGAGCCGGCCTCTGAGCGTGAGGGAGGGGAG.

[0033] In an embodiment of the present invention, a primer set for detecting the marker combination is provided, and the number of tandem repeats of the marker combination is obtained by PCR amplification of 12 pairs of primer sets, wherein the primer sets are: the upstream primer sequence of Syp01 is shown in SEQ ID NO.1, and the downstream primer sequence of Syp01 is shown in SEQ ID NO.2; the upstream primer sequence of Syp02 is shown in SEQ ID NO.3, and the downstream primer sequence of Syp02 is shown in SEQ ID NO.4; the upstream primer sequence of Syp03 is shown in SEQ ID NO.5, and the downstream primer sequence of Syp03 is shown in SEQ ID NO.6; the upstream primer sequence of Syp04 is shown in SEQ ID NO.7, and the downstream primer sequence of Syp04 is shown in SEQ ID NO.8; the upstream primer sequence of Syp05 is shown in SEQ ID NO.9, and the downstream primer sequence of Syp05 is shown in SEQ ID NO.10; the upstream primer sequence of Syp06 is shown in SEQ ID NO.11. The upstream primer sequence of Syp07 is shown in SEQ ID NO.13, and the downstream primer sequence of Syp07 is shown in SEQ ID NO.14; the upstream primer sequence of Syp08 is shown in SEQ ID NO.15, and the downstream primer sequence of Syp08 is shown in SEQ ID NO.16; the upstream primer sequence of Syp09 is shown in SEQ ID NO.17, and the downstream primer sequence of Syp09 is shown in SEQ ID NO.18; the upstream primer sequence of Syp10 is shown in SEQ ID NO.19, and the downstream primer sequence of Syp10 is shown in SEQ ID NO.20; the upstream primer sequence of Syp11 is shown in SEQ ID NO.21, and the downstream primer sequence of Syp11 is shown in SEQ ID NO.22; the upstream primer sequence of Syp12 is shown in SEQ ID NO.23, and the downstream primer sequence of Syp12 is shown in SEQ ID NO. As shown in ID NO.24.

[0034] In some embodiments of the present invention, a method for detecting individual identification of Treponema pallidum is provided, wherein the number of tandem repeats of the tandem repeat sequence units of the 12 sites constitutes a DNA fingerprint of the individual Treponema pallidum, which is used for individual identification of Treponema pallidum strains.

[0035] In some embodiments of the present invention, a product for individual identification of Treponema pallidum strains is provided. The product is a reagent or a kit comprising a primer set of the above-mentioned marker combination.

[0036] In some embodiments of the present invention, at least one of the following applications of the product is also provided: (1) Individual identification of Treponema pallidum strains; (2) determine the relationship between Treponema pallidum strains; (3) Genotyping of Treponema pallidum strains and subsequent population genetics studies.

[0037] In some embodiments of the present invention, a method for using the primer set is also provided.

[0038] In one embodiment of the present invention, the full genome nucleotide sequence of Treponema pallidum strain Nichols (GenBank: CP004010.2) is taken as an example, and the sequence is: 1. Site Syp01: AATGAGGCCCATCGTTTCAGCGCTTCCAGTGTTGATTCGATGTCTTATATAATTTTGACGCCGGGGGGGGGTATGGGGCTTATGGGGTGCGAGTGTAGTGTTCCGCCTT (SEQ ID NO. 25); 2. Site Syp02: ATGGGGTGCGAGTGTAGTGTTCCGCCTTTTGAAACGGTTGAAACGGGCAAACGGTCAGTGGATGCGGACAGGATTATGCGTCTGTCCCGGGATGGCTACGCGTTCTTAAAGGTCAATGACCTT GAGAGGGCAGAGAGCGAGTTCGGTAAAATTCTCCAAATTGAAGCGGATAACAACTATGCCCTCGTGGGGCTCGGGGATGCGGCGCGCAAGAGACGCGCGTACCAAGAGGCATCTGACTATTACACGAGG (SEQ ID NO.26); 3. Site Syp03: GCTCAAGGAAAGCGAGAAGTTTAGCAGTGACAACTCTTGGATCGGAAGAGCGGAAGACATCACGTACTCCTTGCTCTATGTTCGGTACAAGTTGCGATACAAGCGCCGCGAGCGCCAGCGGCTAGCACGGTTTGAATGGCGCTGCCGAGCGTTCCTTCTGCAATCAAAGCAGCAAGTCCTACCATCTCTA (SEQ ID NO. 27); 4. Locus Syp04: GCACGCAACCCATAAGATGTTGGCTGGGGGTTGGGCTGGGGGAAATAGACGTGCGGCGTGCGTTGGGGCGATACCCACAATATCCTGCCTTCCACTTCGTAAGAGCAGCAGCACCAGGAACTGCACCAGGGACCGCCCCAGGAACTGCACCAGGAGCAGCATCGTTTTTCTTGTTCGTACCGCGCCTGTGTGCCTTTGTGCGCGCAGCGCGTCCCTGCTGCTGGGGCGCCCGTGTTTGACTTGCCCTCCCAGTCGGTGTGAGGCAGGCCGCGTCTATCCCTCAGTGCGCATGT (SEQ ID NO.28); 5. Locus Syp05: ATAAGATGGCGTTGTTGGCTGGGGCTGGGGCTGGGGCTGGGGCTTTCCAATGGACGGGCATGTACGTACGGTCCTATGGAACTTCGTTGTGG (SEQ ID NO.29); 6. Locus Syp06: CCTATGGAACTTCGTTGTGGGCTGCGGCTCCGGGTAGGGCTGGGACTCCGGCTGCGGCTCCGGCTGCTTGGGCATAGCCGCTAGACAGTGTGGAGTTCCTCCGGGCGACTGCGAGCCGAGAAGTAGATGTCAACT (SEQ ID NO.30); 7. Locus Syp07: TATCCGCTATCACCTCTGACGCGCGCATCCGCCGAGTCCTGGGCATGCCGCCGAATGCAGTACATCGTGTTGCGCGCCGCGCAGTGTCGGGGTATCATGGAAGGCGGTACAGGCACTGCGTGCACGGCGCGCTTGTGCGTCGCGCGCGGTCGCATACCAAAACAATACGCAGGGCGCTTAGCTCAGCGGGCAGAGCGCTTGGTTTACACCCAAGAGGTCAGCGGTTCAAACCCGTTAGCGCCCAACATGCAGCCGCGTTTCTGCTATCGGATAAAGGACGACTGGGCTGGCAGCGGGTGTGGGTTCCCACCTCCTGTTCGTGTCTTTTCAGGGTGTGTGCGCGTTCCGAGAAGAGGGCGTTTTGTGTGTGGGGAGGAGTACGATGGATACGCAG (SEQ ID NO.31); 8. Locus Syp08: CAAGCACCTCTACACCAAAAACGGCTCGTCCAGCGCGGGACCGGCGCAGTGTCCCGGTGGCGGTGGCGGCGGAGGCAGCAGCGGGGGTGGGGGTTCCTCGGAGTACACCAAAGCTTCCTGTTCCTTTTCCACGCCCATTCTGGCAAGCGTCAGC (SEQ ID NO.32); 9. Locus Syp09: TTCCTCCGCTGCGTCGTCACCAGCCTCGTGTCCCTCTTCCCCTTCTTCTTCTTCCTCCTCCTCGACGAATGCGGGATGCGAGGTGGAGCACGGGGTGGACGACCCGCTGTGTCTTGCGATTTTTAAACACAACGGCTGCGAATACTTGC (SEQ ID NO.33); 10. Locus Syp10: CTGGTAATAGACGGCGTGCTGGTAGGGCGCGGGTGGAGCGAAGACGCAAAGAAAAACACCGGAGACCTGCTGCTCCACCACTGGATTGAGTTCCGCTGGCCGCTGGCGCACGGCATTGTGTCCTTTGACTTTTTCTTTGATGCGGCAATGGTGTACAACATCGAAAGTCAGTCCCCAAACGGGTCATCGTCCGCCAGCAGCTCCAGCAGCAGCAGTAGTAGTAGCAGTAGCACCACCAGCTCTGAAGGACTGTACAAAATGAGCTACGGTCCGGGGCTGCGCTTTACATTGCCGCAATTTCCGTTAAAATTGGCGTTCGCAAACACCTTCACGTCA (SEQ ID NO.34); 11. Locus Syp11: CAAGGAACTTAAACGGAGCGGTCAACGCAACACGTACCGGATTTAATATCCTATCCATCATCACAAAAAATAACGTATGAACATTTACATTCATACGATCGGAAACAAATCGAACAGCAAAAAGAATCAATAAAAACTCCAACACAAACTTGCACAACGACCACAGCAACAGCATCAGCATTTGCAGCAGTAACTTTAACACAGAAACCGAACCGACAAGGAAAATAGTTCCGACAGTGTTTGAGAGTATGGTGAGCACCCCAATCGCAATCATGGGAGA (SEQ ID NO.35);

[0039] Example 1, design of primer set 1. First, we experimentally selected 12 loci, including the tandem repeat unit sequences of Syp01, Syp02, Syp03, Syp04, Syp05, Syp06, Syp07, Syp08, Syp09, Syp10, Syp11, and Syp12. The locations of the genomic DNA of the strains where they are located and the encoding gene information are shown in Table 1. The reference strain was the complete genome nucleotide sequence of the Nichols strain (CP004010.2).

[0040] Table 1. Information about the 12 loci (Nichols strain as reference)

[0041] Identification of tandem repeat sequences Tandem Repeat Finder software (version 4.09) (https: / / tandem.bu. / trf / advanced_submit, accessed January 1, 2024) was used to identify tandem repeat sites in genomic DNA.

[0042] The parameters for searching for repeat sequences were as follows: alignment parameters (matches, mismatches, insertions, and deletions) were 2, 5, and 7, respectively. The maximum TR array size (millions of base pairs) was 2. Variable number tandem repeat loci in genomic DNA were initially screened from four strains: Nichols (subtype pallidum), SS14 (subtype pallidum), Iraq B (subtype endemicum), and Sei Geringging K403 (subtype pertenue).

[0043] 184 strains used T. pallidum The complete genome sequence of the strain was used to further optimize the VNTR loci. The primers used for amplification of all loci are shown in Table 2. Primers were designed based on the principle that the amplified product would be suitable for gel electrophoresis, contain tandem repeats, and the PCR product size could be converted to the number of tandem repeats at each locus. Each PCR reaction and gel electrophoresis for each locus were performed independently.

[0044] Table 2. Upstream and downstream nucleotide sequences of primer sets

[0045] Example 2, construction of fingerprint 1. Extraction of genomic DNA of the strain to be tested Take 200 μL of the blood sample to be tested and extract genomic DNA according to the instructions of the blood / cell / tissue genomic DNA extraction kit. The final eluent is 100 μL.

[0046] 2. PCR Amplification A 25 μl PCR reaction system consisted of 4 μL genomic DNA template, 0.6 μL each of 10 μM primers F and R, 12.5 μL 2× ESTAq MasterMix, and 7.3 μL double-distilled water. The PCR amplification protocol was as follows: initial denaturation at 94°C for 4 min, followed by 45 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, with a final extension at 72°C for 5 min. The reaction mixture was then stored at 4°C. PCR amplification of the template DNA was performed using 12 primer pairs. 3. Agarose Gel Electrophoresis 3 μl of PCR product was electrophoresed on 2% agarose gel at 6 V / cm for 2 h, stained with Goldview, and marked with 100 bp DNA ladder marker.

[0047] 4. Result analysis and fingerprint construction The DNA lengths of the PCR amplified products were detected by gel electrophoresis. Then, according to the correspondence between the DNA lengths of the PCR products and the number of tandem repeats in Table 3, these DNA lengths were converted into the number of tandem repeats to obtain the characteristic fingerprint of each strain.

[0048] Table 3. Correspondence between PCR product DNA length and tandem repeat number

[0049] 5. MLVA repeat unit repeat number and cluster analysis The length of the PCR product DNA was calculated using the molecular weight calculation software in the UVP gel imaging analysis system. The length of the PCR-amplified DNA was converted to the number of tandem repeats in the tandem repeat sequence according to Table 3. Cluster analysis was performed using the Bionumerics (version 4.0) software package (Applied Maths Belgium, Brussels), using the number of tandem repeats at each of the 12 loci as a variable.

[0050] 6. Results 6.1. Identification and Characterization of Tandem Repeat Sites The number of bases and tandem repeats (TRs) in the whole genome of four strains (Nichols-CP004010.2, SS14-20230727, Iraq B-NZ_CP032303.1, and Seieringging K403-NZ_CP024089.1) was as follows: 1,13,633 bp, 349 TRs; 1,139,589 bp, 344 TRs; 1,137,52 bp, 339 TRs; and 1,138,688 bp, 342 TRs. Ultimately, 12 VNTRs were identified and assigned nomenclature. These 12 TR markers (Table 1) were used for 189 T. pallidum Genotyping of Isolates. The DNA lengths of the PCR products were determined by gel electrophoresis and then converted to tandem repeat numbers based on the correspondence between PCR product DNA lengths and tandem repeat numbers in Table 3. Figure 1 Shown are the gel electrophoresis patterns of PCR amplification products of 12 loci from genomic DNA of five specimens (China TL-1, China TL-2, China TL-3, China TL-4, and China TL-5).

[0051] 6.2 Individual Identification of Treponema pallidum Strains The genomic DNA extracted from the blood samples of 5 patients in a hospital was unique, and the fingerprint patterns of the 12 loci (Syp01-Syp12) were all (2, 2, 2, 1, 5, 8, 1, 1, 4, 15, 3, 12).

[0052] 6.3 Determination of the relationship between Treponema pallidum strains Genomic DNA extracted from blood samples of five patients in a hospital showed identical fingerprints at 12 loci (Syp01-Syp12), indicating that they came from the same source of infection and were closely related.

[0053] 6.4 Genotyping and Population Genetics Analysis of Treponema pallidum Strains Cluster analysis By constructing a phylogenetic tree, the relationship between the tandem repeat numbers of 12 loci in 189 strains was determined, and 75 different genotypes were formed using the MLVA-12 detection method. T. pallidum There are two groups of strains (A and B), such as Figure 2 The genotype polymorphism index (HGDI) was 0.121.

[0054] Cluster A was divided into subclusters A1-A6, with the majority of subspecies pallidum strains located within cluster A. Cluster B was further divided into subclusters B1-B2. Subspecies endemicum and pertenue strains were concentrated in subcluster B1, with subspecies endemicum strains located in a separate clade.

[0055] As the "gold standard" for diagnosis in this field, Smibert divided Treponema pallidum into three subspecies based on the disease manifestations, transmission patterns and geographical distribution caused by Treponema pallidum, including: (1) T. p. ssp. Pallidum (TPA) subspecies, strains include: Nichols, DAL-1, Mexico A, SS14, Chicago, etc. (2) T. p. ssp. pertenue (TPE) subspecies, strains include: DC-2, Gauthier, Samoa D, Fribourg-Blanc, etc. (3) T. p. sp. endemic (TEN) subspecies, strains such as Bosnia A.

[0056] The cluster analysis diagram of the present invention shows that the genotyping of the strains is completely consistent with the traditional three subspecies. The advantage of the present invention is that the three subspecies are further subdivided into more types, which can identify strains isolated from different regions, which is impossible with traditional typing methods. In addition, based on the method of the present invention, it was found that Treponema pallidum strains in the same region have the same genotype or the same group relationship and other population genetic characteristics.

[0057] Example 3, sensitivity experiment This method can obtain 12-site fingerprint maps of all Treponema pallidum and has excellent sensitivity. It is manifested in that the 12-site fingerprint maps can be detected for all Treponema pallidum strains, and the minimum detection limit is 512 bacterial nucleic acid DNA copies. However, the typing method of the US CDC, due to sequencing errors, leads to incorrect sequence results of some strains and cannot be used for genetic typing.

[0058] Example 4, specificity experiment This method is only applicable to the detection of Treponema pallidum, and is not applicable to other strains. For example, the DNA fingerprint of the 12 sites of the present invention cannot be obtained from the genomic DNA of the Leptospira species genome; for another example, the strain R3-SAL-007 submitted to NCBI was identified as Treponema pallidum subspecies pertenue. The fingerprint of the 12 sites was not obtained by the patented method of the present invention. The 16S rRNA gene sequence analysis of the strain was found to be similar to the rabbit syphilis Treponema pallidum strain L2 ( T.paraluiscuniculi ) 16SrRNA gene nucleotide sequence has 99% (11909 / 1926) identity, confirming that the strain is rabbit syphilis Treponema pallidum, further verifying the specificity of the present invention.

[0059] Example 5, a detection kit Includes the primer set described in Example 1.

[0060] The detection kit (25 copies / box) includes: 15 μL each of 10 μM F and R primers, 12.5 μL of 2×ES Taq MasterMix, 182.5 μL of double-distilled water, 100 μL of positive control genomic DNA, and 100 μL of negative control genomic DNA.

[0061] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A marker combination for individual identification of Treponema pallidum, characterized in that: The DNA fingerprint of a Treponema pallidum individual is composed of the repetition numbers of the tandem repeat sequence units of the 12 sites, wherein the tandem sequence units of the 12 sites are: the repeat unit of Syp01 is TATGGGGCT; the repeat unit of Syp02 is TGAAACGGT; the repeat unit of Syp03 is CGGTACAAGTT; the repeat unit of Syp04 is AGAGCAGCAGCACCAGGAACTGCACCAGGGACCGCCCCAGGAACTGCACCA; the repeat unit of Syp05 is GGGGCT; the repeat unit of Syp06 is CTC CGG; the repeating unit of Syp07 is AGTGTCGGGGTATCATGGAAGGCGGTACAGGCACTGCGTGCACGGCGCGCTTGTGCGTCGCGC; the repeating unit of Syp08 is GGTGGC; the repeating unit of Syp09 is TTC; the repeating unit of Syp10 is TAG; the repeating unit of Syp11 is ACAGCA; the repeating unit of Syp12 is CGTGAGGTGGAGGACGCGCCGAAGGTAGTGGAGCCGGCCTCTGAGCGTGAGGGAGGGGAG.

2. A primer set of a marker combination for individual identification of Treponema pallidum, characterized in that: The primer set contains the following 12 pairs of primers, namely Syp01-F, Syp01-R, Syp02-F, Syp02-R, Syp03-F, Syp03-R, Syp04-F, Syp04-R, Syp05-F, Syp05-R, Syp06-F, Syp06-R, Syp07-F, Syp07-R, Syp08-F, Syp08-R, Syp09-F, Syp09-R, Syp10-F, Syp10-R, Syp11-F, Syp11-R, Syp12-F, and Syp12-R, and the nucleotide sequences of the upstream primers and downstream primers are shown in SEQ ID NO.1 to SEQ ID NO.

24.

3. A method for detecting individual identification of Treponema pallidum, characterized in that: The DNA fingerprint of a Treponema pallidum individual is composed of the number of tandem repeats of the 12-site tandem repeat sequence unit according to claim 1, and is used for individual identification of Treponema pallidum strains.

4. A product for individual identification of Treponema pallidum strains, characterized in that: The product is a reagent or a kit, comprising the primer set according to claim 2.

5. At least one of the following uses of the product according to claim 3: (1) Individual identification of Treponema pallidum strains; (2) determine the relationship between Treponema pallidum strains; (3) Genotyping of Treponema pallidum strains and subsequent population genetics studies.

6. The use according to claim 5, characterized in that The DNA fingerprint of a Treponema pallidum individual is composed of the number of tandem repeats of the 12-site tandem repeat sequence unit according to claim 1, and is used for individual identification of Treponema pallidum strains.

7. The use according to claim 5, characterized in that The application includes collecting DNA fingerprints of strains collected in a certain area, comparing the fingerprints, and determining the relationship between the strains.

8. The use according to claim 5, characterized in that The application includes performing cluster analysis on DNA fingerprints of strains collected in a certain area to obtain genotyping results.

9. A method for constructing a fingerprint of Treponema pallidum, characterized in that: The following steps are involved: (1) Extracting genomic DNA from the strain to be tested or blood sample; (2) using the genomic DNA extracted in step (1) as a template and performing PCR amplification using the primer set described in claim 2; (3) The PCR amplification product of step (2) is subjected to agarose gel electrophoresis or capillary electrophoresis sequencing to obtain the DNA length of the PCR amplification product. The tandem repeat number of the site of the strain to be tested is determined by comparing the corresponding relationship table between the DNA length of the PCR product and the tandem repeat number. The tandem repeat numbers of the 12 sites constitute the characteristic fingerprint of the strain to be tested.

10. The method for constructing a fingerprint of Treponema pallidum according to claim 9, characterized in that: In step (2), the conditions for PCR amplification include the following: the PCR amplification reaction system is 25 μL: 4 μL of genomic DNA template, 0.6 μL each of 10 μM F and R primers, 12.5 μL of 2×ES Taq MasterMix, and 7.3 μL of double-distilled water; the PCR amplification reaction program is: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 45 cycles, final extension at 72°C for 5 min, and storage at 4°C.

Images