Primer group for identifying six different genotypes of IBV epidemic strains and high-resolution melting curve detection method

Abstract

The invention discloses a primer group for identifying six different genotypes of IBV epidemic strains and a high-resolution melting curve detection method, and relates to the technical field of virus detection. The primer group for identifying the six IBV epidemic strains with different genotypes is HRM-F / HRM-R, and the nucleotide sequences of the primer group are shown as SEQ ID NO. 1 and SEQ ID NO. 2. By utilizing the specific primer group and the detection method disclosed by the invention, qualitative and quantitative analysis on single infection or mixed infection of IBV epidemic strain genotypes of LX4 (GI-19), Mass (GI-I), 4 / 91 (GI-13), LDT3-A (GI-28), Taiwan (GI-7) and CK / CH / LSC / 99I (GI-22) can be realized. The detection sensitivity is high, the specificity is good, the accuracy is high, the operation is simple and rapid, the cost is low, and the method is suitable for popularization.

Description

Technical Field

[0001] The present invention relates to the technical field of virus detection, and more particularly to a primer set for identifying six different genotypes of IBV epidemic strains and a high-resolution melting curve detection method. Background Art

[0002] Avian infectious bronchitis (IB) is an acute, highly contagious disease caused by the avian infectious bronchitis virus (IBV), resulting in severe economic losses for the poultry industry. IBV can infect chickens of all ages, primarily infecting respiratory epithelial cells and digestive tract tissues, as well as other tissues such as the kidneys, oviducts, and testicles. This can lead to slowed growth, low feed conversion rates, decreased chicken quality, and reduced egg production and quality. Vaccination is currently the primary prevention and control measure for IB, but the IBV genome is prone to mutation, with numerous genotypes / serotypes and little or no cross-protection between different genotypes / serotypes, posing significant challenges to disease prevention and control. Currently, the predominant IBV strains circulating in China are LX4 (GI-19), Mass (GI-I), 4 / 91 (GI-13), LDT3-A (GI-28), Taiwan (GI-7), and CK / CH / LSC / 99I (GI-22). LX4 (GI-19) is the predominant strain, and mixed infections with multiple genotypes / serotypes are common. Developing a rapid test capable of simultaneously identifying and detecting these six different genotypes of IBV circulating in China has important application value and practical significance.

[0003] Currently, the primary method for IBV genotyping is conventional RT-PCR followed by cloning and sequencing analysis. However, this method is cumbersome, lacks automation, is time-consuming (5-7 days), and carries high sequencing costs. Conventional RT-PCR followed by restriction fragment length polymorphism analysis (RT-PCR-RFLP) can also be used for IBV genotyping, but this method suffers from low throughput, is time-consuming and labor-intensive, has limited resolution, and lacks quantification. Therefore, there is an urgent need to develop a product or method that can rapidly identify the genotypes of clinically prevalent strains, thereby addressing the long-standing technical challenge of rapidly and accurately identifying IBV genotypes in infected chickens. Summary of the Invention

[0004] In view of this, the present invention provides a primer set and a high-resolution melting curve detection method for identifying six different genotypes of IBV epidemic strains.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] A primer set for identifying six different genotypes of IBV epidemic strains, the primer set is HRM-F / HRM-R, and its nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0007] Preferably, the six different genotypes of IBV epidemic strains are LX4 (GI-19), Mass (GI-I), 4 / 91 (GI-13), LDT3-A (GI-28), Taiwan (GI-7) and CK / CH / LSC / 99I (GI-22).

[0008] Another object of the present invention is to provide a product for identifying six different genotypes of IBV epidemic strains, wherein the product comprises the primer set according to claim 1.

[0009] Preferably, the product further comprises 2×HRM Analysis PreMix (Tiangen Biochemical Technology (Beijing) Co., Ltd.), primer pair HRM-F / HRM-R, RNase-Free ddH2O, and six different genotype IBV standard plasmids;

[0010] Among them, the six different genotype IBV standard plasmids are IBV LX4 (GI-19) type vaccine strain QXL87 standard plasmid pTOPO-TA / Blunt-QXL87, Mass (GI-I) type vaccine strain H120 standard plasmid pTOPO-TA / Blunt-H120, 4 / 91 (GI-13) type vaccine strain 4 / 91 standard plasmid pTOPO-TA / Blunt-4 / 91, LDT3-A (GI-28) type vaccine strain LDT3-A standard plasmid pTOPO-TA / Blunt-LDT3-A, Taiwan (GI-7) type wild strain GX-NN200723 standard plasmid pTOPO-TA / Blunt-GX-NN200723, CK / CH / LSC / 99I (GI-22) type wild strain GX-YL5 standard plasmid pTOPO-TA / Blunt-GX-YL5.

[0011] Preferably, the product is a kit.

[0012] Another object of the present invention is to provide the use of the above-mentioned primer set or any of the above-mentioned products in the preparation of IBV typing detection products, wherein the IBV typing includes one or more of LX4 (GI-19) type, Mass (GI-I) type, 4 / 91 (GI-13) type, LDT3-A (GI-28) type, Taiwan (GI-7) type and CK / CH / LSC / 99I (GI-22) type.

[0013] Another object of the present invention is to provide a method for qualitatively or quantitatively identifying IBV genotypes, comprising the following steps: extracting RNA from a test sample and reverse transcribing to obtain cDNA; then amplifying the cDNA using the above-mentioned primer set and / or any of the above-mentioned products, and finally determining whether the test sample is an LX4 (GI-19) type, Mass (GI-I) type, 4 / 91 (GI-13) type, LDT3-A (GI-28) type, Taiwan (GI-7) type, and CK / CH / LSC / 99I (GI-22) type strain based on a high-resolution melting curve of the test sample and a standard plasmid.

[0014] Preferably, the reaction system for cDNA amplification is: 1.2 μL of primer mixture, 10 μL of 2×HRM AnalysisPreMix, 1 μL of template cDNA, and filled to 20 μL with RNase-Free ddH2O; and the final concentrations of the upstream primer HRM-F and the downstream primer HRM-R in the reaction are both 0.3 μM.

[0015] Preferably, the reaction procedure for cDNA amplification is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 20 s, for 45 cycles; the melting temperature of the HRM analyzer is set to a temperature increase rate of 0.02°C per step from 65°C to 95°C to collect fluorescence signals.

[0016] Preferably, the qualitative judgment criteria are:

[0017] 1) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV LX4 (GI-19) type control sample, the test sample is IBV LX4 (GI-19) type;

[0018] 2) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV Mass (GI-I) type control sample, the test sample is IBV Mass (GI-I) type;

[0019] 3) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV 4 / 91 (GI-13) type control sample, the test sample is IBV 4 / 91 (GI-13) type;

[0020] 4) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV LDT3-A (GI-28) type control sample, the test sample is IBV LDT3-A (GI-28) type;

[0021] 5) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV Taiwan (GI-7) type control sample, the test sample is IBV Taiwan (GI-7) type;

[0022] 6) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV CK / CH / LSC / 99I (GI-22) type control sample, the test sample is IBV CK / CH / LSC / 99I (GI-22) type;

[0023] The quantitative judgment criteria are:

[0024] 1) If the high-resolution melting curve analysis identifies the sample as LX4 (GI-19) genotype, substitute the standard curve equation y = -3.4053x + 42.974 (where y is the Cp value and x is the logarithm of the corresponding viral copy number) to calculate its viral content;

[0025] 2) If the sample to be tested is identified as Mass (GI-I) by high-resolution melting curve analysis, the viral content is calculated by substituting the standard curve equation y = -2.9407x + 40.676 (where y is the Cp value and x is the logarithm of the corresponding viral copy number);

[0026] 3) If the sample to be tested is identified as genotype 4 / 91 (GI-13) by high-resolution melting curve analysis, the viral content is calculated by substituting the standard curve equation y = -3.1053 + 41.75 (where y is the Cp value and x is the logarithm of the corresponding viral copy number);

[0027] 4) If the sample to be tested is identified as LDT3-A (GI-28) by high-resolution melting curve analysis, the viral content is calculated by substituting the standard curve equation y = -3.181x + 42.956 (where y is the Cp value and x is the logarithm of the corresponding viral copy number);

[0028] 5) If the high-resolution melting curve analysis identifies the sample as Taiwan (GI-7) genotype, substitute the standard curve equation y = -3.275x + 44.422 (where y is the Cp value and x is the logarithm of the corresponding viral copy number) to calculate its viral content;

[0029] 6) If the high-resolution melting curve analysis identifies the sample as CK / CH / LSC / 99I (GI-22) genotype, substitute y = -2.6637x + 41.552 (where y is the Cp value and x is the logarithm of the corresponding viral copy number) into the standard curve equation to calculate its viral content.

[0030] Beneficial effects:

[0031] (1) Detection and identification of different prevalent IBV genotypes have traditionally relied on PCR amplification of target genes, followed by cloning and gene sequencing, a process that is complex, time-consuming, labor-intensive, and expensive. The product and detection method of the present invention have high sensitivity, low cost, short detection time, accurate results, are not affected by the detection site, and achieve a true closed-tube procedure.

[0032] (2) The IBV qRT-PCR-HRM identification and detection method disclosed in the present invention targets the currently widely prevalent IBV LX4 (GI-19), Mass (GI-I), LDT3-A (GI-28), 4 / 91 (GI-13), Taiwan (GI-7) and CK / CH / LSC / 99I (GI-22) strains. It only requires one pair of primers and one reaction. It can detect single infection of six different genotypes of IBV epidemic strains, as well as mixed infection of six different genotypes of IBV epidemic strains, greatly improving the efficiency of IBV clinical differential diagnosis.

[0033] (3) The IBV qRT-PCR-HRM identification and detection method disclosed in the present invention has good specificity and high sensitivity, and can achieve qualitative analysis of samples (including single infection and mixed infection); the standard curves of six different genotype strains are established, and quantitative detection of single-infected samples can be completed, providing a powerful means for disease diagnosis and prevention and control.

[0034] (4) The present invention relies on the Roche LightCycler 480 PCR instrument with high-resolution temperature detection performance and the saturation dye EvaGreen to achieve IBV genotyping. This method is simple, rapid, and low-cost to operate. It does not require subsequent operations such as electrophoresis and sequencing of conventional PCR amplification products, and does not require specific fluorescent labeled probes, breaking through the limitations of traditional qPCR methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0036] Figure 1 This is a schematic diagram of a standardized melting curve provided by an embodiment of the present invention.

[0037] Figure 2Schematic diagram of the peak melting curve provided by an embodiment of the present invention.

[0038] Figure 3 This is the specific detection result of the kit provided in the embodiment of the present invention (qRT-PCR-HRM method).

[0039] Figure 4 This is the specific detection result of the kit provided in the embodiment of the present invention (gel electrophoresis method).

[0040] Figure 5 This is the sensitivity amplification curve result of the kit provided in the embodiment of the present invention (qRT-PCR-HRM method).

[0041] Figure 6 This is the sensitivity melting curve result of the kit provided in the embodiment of the present invention (qRT-PCR-HRM method).

[0042] Figure 7 This is an example of a standard curve for quantitative analysis in the kit provided in an embodiment of the present invention.

[0043] Figure 8 This is the clinical application test result of the implementation case of the present invention. DETAILED DESCRIPTION

[0044] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0045] The "identification" mentioned in the present invention should be understood in a broad sense, such as identification / assisted identification, differentiation / assisted differentiation, identification / assisted identification, detection / assisted detection, etc.

[0046] Example 1

[0047] A high-resolution melting curve-based detection kit for rapid identification of six genetically distinct IBV epidemic strains

[0048] 1. The 1069-1230 bp region (ID: AF093793.1) in the S1 gene of IBV LX4 (GI-19), Mass (GI-I), 4 / 91 (GI-13), LDT3-A (GI-28), Taiwan (GI-7), and CK / CH / LSC / 99I (GI-22) strains, where the GC content is significantly different, was used as the detection target. A pair of specific primers, HRM-F / HRM-R, were designed based on the conserved sequences on both sides of the region.

[0049] HRM-F: 5'-CAAGGTGGGTGTAAGCAATC-3', SEQ ID NO.1;

[0050] HRM-R: 5'-ACGAGAGCCATCACTCTTAG-3', SEQ ID NO.2.

[0051] IBV LX4 (GI-19) type QXL87 toxic strain (ID: MH743141.1): <CAAGGTGGGTGTAAGCAGTCAGTTTTTAGTGGTAGGGCAACGTGTTGCT ATGCCTACTCTTACAATGGCCCGATAGCCTGTAAAGGTGTTTATTCAGGC GAATTACGGACTAATTTTGAATGTGGATTGCTGATTTATGTTACTAAGAGT GATGGTTCTCGT> ;SEQ ID NO.3;

[0052] IBV Mass (GI-I) type H120 toxic strain (ID: KR605489.1)

[0053] <CAAGGTGGTTGCAAGCAATCTGTCTTTAGTGGTAGAGCAACCTGTT GTTATGCTTACTCATATGGAGGTCCTTTGCTGTGTAAAGGTGTTTATTCAG GTGAGTTAGATCATAATTTTGAATGTGGACTGTTAGTTTATGTTACTAAGA GCGGTGGCTCTCGT> ;SEQ ID NO.4;

[0054] IBV 4 / 91 (GI-13) type 4 / 91 toxic strain (ID: AF093793.1)

[0055] <CAAGGTGGTTGTAAGCAATCTGTTTTTAGTAATAAAGCAACTTGTTG CTATGCTTATTCTTACCGAGGTCCTACTAGATGTAAGGGTGTTTATAGAGG GGAGCTAACGCAATACTTTGAATGTGGACTTCTAGTTTATGTAACTAAGA GTGATGGCTCTCGT> ;SEQ ID NO.5;

[0056] IBV LDT3-A (GI-28) type LDT3-A toxic strain (ID: KR608272.1)

[0057] <CAAGGTGGGTGTAAGCAGTCGGTTTTTAGTAGTAGAGCCACTTGTT GTTATGCTTATTCATATAATGGTCCTCGCGCATGTAAGGGTGTTTACGCAG GCGAGTTACTACAAAATTTTGAATGTGGACTGTTGGTTTATGTTACTAAG AGCGATGGCTCTCGT> ; SEQ ID NO.6;

[0058] IBV Taiwan (GI-7) strain GX-NN200723 (ID: MZ169543.1)

[0059] <CAAGGTGGGTGTAAGCAATCAGTTTATCAAGGCAGAGCTACTTGTT GTTATGCGTATTCCTATAACGGACCACGTATGTGTAAAGGTGTTTATAGT GGTCAGTTATTACAAGATTTTGAATGTGGACTGTTGGTTTATGTTACTAAG AGTGATGGCTCTCGT> ; SEQ ID NO.7;

[0060] IBV CK / CH / LSC / 99I (GI-22) GX-YL5 strain (ID: FJ907238.1)

[0061] <CAAGGTGGGTGTAAGCAGTCGGTCTTTAGTGGTAGAGCCACTTGTT GTTATGCCTATTCATATAATGGCCCTCGCGCTTGTAAAGGTGTTTACGGGG GTGAGTTGTCACAAAGTTTTGAATGTGGTTTGTTGGTTTTTGTTACTAAGA GCGATGGTTCTCGT> ; SEQ ID NO.8.

[0062] The detection kit includes: 2×HRM Analysis PreMix (Tiangen Biochemical Technology (Beijing) Co., Ltd.), primer pair HRM-F / HRM-R, RNase-Free ddH2O, and six different genotype IBV standard plasmids.

[0063] Preparation method of standard plasmid: (1) RNA extraction and reverse transcription: RNA of six IBV viruses was extracted using RNA extraction kit (Tiangen Biotechnology Co., Ltd.), and then quantitative reverse transcription was performed to obtain cDNA. For specific operations, please refer to the instruction manual (Kangwei Biotechnology); (2) The obtained cDNA was used as a template to amplify the S1 gene sequence, and the PCR product was purified and recovered. For specific operations, please refer to the instruction manual (Tiangen); (3) Ligation, transformation and identification: The gel-back product was connected to the pTOPO-TA / Blunt vector. For specific operations, please refer to the instruction manual (Aidelai Biotechnology); (4) Sequence alignment and determination of positive clones: positive The plasmids were sent to Shanghai Biotechnology for sequencing and identification, and the sequencing results were compared with the corresponding QXL87, H120, 4 / 91, LDT3-A, GX-NN200723 and GX-YL5 strains; (5) Positive clone plasmid extraction: The bacterial solution with the correct sequencing results was expanded, and then the plasmid was extracted. The specific method was referred to the instructions (Tian Gen); (6) Positive standard detection: The concentration of the extracted standard plasmid was determined, and the copy number was calculated according to the following formula. It was stored in a refrigerator at -80℃ and used as a positive control for the subsequent establishment of the standard curve and sample detection; copy number (copies / L) = 6.02×10 23 × plasmid concentration (g / L) / MW; MW (g / L) = plasmid gene size (bp) × 660 g / mol·bp.

[0064] Six different genotypes of IBV standard plasmids are IBV LX4 (GI-19) type vaccine strain QXL87 standard plasmid pTOPO-TA / Blunt-QXL87, Mass (GI-I) type vaccine strain H120 standard plasmid pTOPO-TA / Blunt-H120, 4 / 91 (GI-13) type vaccine strain 4 / 91 standard plasmid pTOPO-TA / Blunt-4 / 91, LDT3-A (GI-28) type vaccine strain LDT3-A standard plasmid pTOPO-TA / Blunt-LDT3-A, Taiwan (GI-7) type wild strain GX-NN200723 standard plasmid pTOPO-TA / Blunt-GX-NN200723, CK / CH / LSC / 99I (GI-22) type wild strain GX-YL5 standard plasmid pTOPO-TA / Blunt-GX-YL5.

[0065] 2. Use the kit in step 1 to amplify the standard plasmids of different IBV epidemic strains to prepare high-resolution melting curves (named qRT-PCR-HRM)

[0066] Using the six standard plasmids from step 1 as templates, perform qPCR amplification on the standard plasmids using the specific primer pair HRM-F / HRM-R to obtain qPCR products. qPCR amplification instrument: Roche LightCycler 480.

[0067] qRT-PCR-HRM reaction system: Prepare the reaction system in a 200 μL PCR tube with 1.2 μL of primer mix, 10 μL of 2× HRMAnalysis PreMix, and 1 μL of template cDNA. Make up to 20 μL with RNase-free ddH2O. The final concentration of upstream primer HRM-F and downstream primer HRM-R in the reaction is 0.3 μM.

[0068] The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 20 s, for 45 cycles; the melting temperature of the HRM analyzer was set at a rate of 0.02°C per step from 65°C to 95°C for fluorescence signal collection.

[0069] High-resolution melting curve analysis (HRM analysis): There are two forms: standardized melting curve and peak melting curve.

[0070] 1) Standardized melting curve

[0071] The schematic diagram of the standardized melting curve is shown in the attached Figure 1 As shown in the figure, the blue curve represents the IBV LX4 (GI-19) vaccine strain QXL87, the yellow curve represents the Mass (GI-I) vaccine strain H120, the golden curve represents the 4 / 91 (GI-13) vaccine strain 4 / 91, the green curve represents the LDT3-A (GI-28) vaccine strain LDT3-A, the navy blue curve represents the Taiwan (GI-7) field strain GX-NN200723, and the red curve represents the CK / CH / LSC / 99I (GI-22) field strain GX-YL5. As can be seen from the figure, the amplified products of the six different IBV genotypes exhibit significant differences in melting curves due to their different GC content.

[0072] 2) Peak shape melting curve

[0073] The peak melting curve diagram is shown in the attached Figure 2The red curve represents the IBV LX4 (GI-19) vaccine strain QXL87, the blue curve represents the Mass (GI-1) vaccine strain H120, the green curve represents the 4 / 91 (GI-13) vaccine strain 4 / 91, the black curve represents the LDT3-A (GI-28) vaccine strain LDT3-A, the yellow curve represents the Taiwan (GI-7) field strain GX-NN200723, and the purple curve represents the CK / CH / LSC / 99I (GI-22) field strain GX-YL5. As can be seen from the figure, the six different IBV genotypes exhibit distinct melting peaks and Tm values ​​due to their varying GC content.

[0074] 3. Use the kit in step 1 to amplify the test sample to obtain a high-resolution melting curve, and then analyze and identify it with the high-resolution melting curve of the standard plasmid obtained in step 2.

[0075] Extract RNA from the test sample and reverse transcribe to obtain cDNA. Amplify the cDNA using the specific amplification primers and kit from step 1, using the same reaction conditions as the standard plasmid amplification in step 2. Finally, determine whether the test sample is IBV LX4 (GI-19), Mass (GI-I), 4 / 91 (GI-13), LDT3-A (GI-28), Taiwan (GI-7), or CK / CH / LSC / 99I (GI-22) based on the high-resolution melting curve of the test sample and the standard plasmid.

[0076] Example 2

[0077] Specificity testing of a test kit for rapid identification of six genetically distinct IBV epidemic strains

[0078] Test nucleic acids: IBV LX4 (GI-19) vaccine strain QXL87, Mass (GI-I) vaccine strain H120, 4 / 91 (GI-13) vaccine strain 4 / 91, LDT3-A (GI-28) vaccine strain LDT3-A, Taiwan (GI-7) field strain GX-NN200723, and CK / CH / LSC / 99I (GI-22) field strain GX-YL5; avian influenza virus (AIV), Newcastle disease virus (NDV), avian metapneumovirus (aMPV), infectious laryngotracheitis virus (ILTV), infectious bursal disease virus (IBDV), Marek's disease virus (MDV), avian leukosis virus (ALV), Mycoplasma gallisepticum (MG), Mycoplasma synoviae (MS), Escherichia coli, and Salmonella.

[0079] 1. RNA extraction and processing

[0080] Viral nucleic acid (RNA) was extracted from the test viruses respectively, and the obtained viral RNA was reverse transcribed into cDNA.

[0081] 2. qRT-PCR-HRM amplification

[0082] The RT-qPCR-HRM method in Example 1 was used to detect the test virus cDNA to verify the specificity of the method. The results are shown in the attached figure. Figure 3-4 As shown, only six different IBV genotypes showed specific peaks in the RT-qPCR-HRM melting curve and specific bands in the amplification product gel electrophoresis, while the other common viruses were negative. This shows that the method has good specificity.

[0083] Example 3

[0084] Sensitivity testing of detection kits for six genetically distinct IBV epidemic strains

[0085] Test samples: Six different genotype IBV virus standard plasmids (IBV LX4 (GI-19) type vaccine strain QXL87 standard plasmid pTOPO-TA / Blunt-QXL87, Mass (GI-I) type vaccine strain H120 standard plasmid pTOPO-TA / Blunt-H120, 4 / 91 (GI-13) type vaccine strain 4 / 91 standard plasmid pTOPO-TA / Blunt-4 / 91, LDT3-A (GI-28) type vaccine strain LDT3-A standard) were respectively added. Plasmid pTOPO-TA / Blunt-LDT3-A, standard plasmid pTOPO-TA / Blunt-GX-NN200723 of Taiwan (GI-7) wild strain GX-NN200723, standard plasmid pTOPO-TA / Blunt-GX-YL5 of CK / CH / LSC / 99I (GI-22) wild strain GX-YL5) were diluted 10-fold to obtain diluted standard plasmid samples. -1 The concentration of the IBV LX4 (GI-19) vaccine strain QXL87 standard plasmid solution was 6.73×10 9 copies / μL; 10 -1 The concentration of the IBV Mass (GI-I) vaccine strain H120 standard plasmid solution was 4.25×10 9 copies / μL; 10 -1 The concentration of the IBV 4 / 91 (GI-13) vaccine strain 4 / 91 standard plasmid solution was 4.96×10 9 copies / μL; 10 -1The concentration of the IBVLDT3-A (GI-28) vaccine strain LDT3-A standard plasmid solution was 6.44×10 9 copies / μL; 10 -1 The concentration of the IBV Taiwan (GI-7) vaccine strain GX-NN200723 standard plasmid solution was 7.41×10 9 copies / μL; 10 -1 The concentration of the IBV CK / CH / LSC / 99I (GI-22) vaccine strain GX-YL5 standard plasmid solution was 5.79×10 9 copies / μL.

[0086] The RT-qPCR-HRM method in Example 1 was used to detect the test samples to verify the sensitivity of the method. Figure 5 , Attachment Figure 6 The results showed that six different genotypes of IBV showed high sensitivity, ranging from 10 -1 Dilute to 10 -9 Specific melting peaks were observed in all samples. Compared to conventional PCR detection, which requires at least 100 copies / μL, the minimum detection limits of the IBV LX4 (GI-19) vaccine strain QXL87, Mass (GI-I) vaccine strain H120, 4 / 91 (GI-13) vaccine strain 4 / 91, LDT3-A (GI-28) vaccine strain LDT3-A, Taiwan (GI-7) field strain GX-NN200723, and CK / CH / LSC / 99I (GI-22) field strain GX-YL5 in the method of the present invention were 33.65 copies / μL, 42.5 copies / μL, 49.6 copies / μL, 32.2 copies / μL, 37.05 copies / μL, and 57.9 copies / μL, respectively. This demonstrates that the method of the present invention has high sensitivity and is significantly superior to conventional PCR detection methods.

[0087] Example 4

[0088] Quantitative analysis of six genetically distinct IBV epidemic strains

[0089] 1. Take 10 -2 ~10 -6The standard plasmid solution was prepared and the standard plasmid was detected by the RT-qPCR-HRM method in Example 1. Three replicates were performed for each dilution. The logarithmic value of the standard plasmid copy number was then used as the horizontal axis, and the Cq value measured by the HRM analyzer (Roche, LightCycler480) was used as the vertical axis to establish standard curves for IBV LX4 (GI-19) type vaccine strain QXL87, Mass (GI-I) type vaccine strain H120, 4 / 91 (GI-13) type vaccine strain 4 / 91, LDT3-A (GI-28) type vaccine strain LDT3-A, Taiwan (GI-7) type wild strain GX-NN200723, and CK / CH / LSC / 99I (GI-22) type wild strain GX-YL5. The results are shown in the attached figure. Figure 7 The results show that the present invention selects 10 -2 ~10 -6 The five dilutions were used to establish the standard curve equations for six different genotypes of IBV.

[0090] The sample to be tested is tested, and the obtained Cq value is substituted into the corresponding standard curve to obtain the virus concentration and realize quantitative analysis.

[0091] 1) If the high-resolution melting curve analysis identifies the sample as LX4 (GI-19) genotype, substitute the standard curve equation y = -3.4053x + 42.974 (where y is the Cp value and x is the logarithm of the corresponding viral copy number) to calculate its viral content;

[0092] 2) If the sample to be tested is identified as Mass (GI-I) by high-resolution melting curve analysis, the viral content is calculated by substituting the standard curve equation y = -2.9407x + 40.676 (where y is the Cp value and x is the logarithm of the corresponding viral copy number);

[0093] 3) If the sample to be tested is identified as genotype 4 / 91 (GI-13) by high-resolution melting curve analysis, the viral content is calculated by substituting the standard curve equation y = -3.1053 + 41.75 (where y is the Cp value and x is the logarithm of the corresponding viral copy number);

[0094] 4) If the sample to be tested is identified as LDT3-A (GI-28) by high-resolution melting curve analysis, the viral content is calculated by substituting the standard curve equation y = -3.181x + 42.956 (where y is the Cp value and x is the logarithm of the corresponding viral copy number);

[0095] 5) If the high-resolution melting curve analysis identifies the sample as Taiwan (GI-7) genotype, substitute the standard curve equation y = -3.275x + 44.422 (where y is the Cp value and x is the logarithm of the corresponding viral copy number) to calculate its viral content;

[0096] 6) If the high-resolution melting curve analysis identifies the sample as CK / CH / LSC / 99I (GI-22) genotype, substitute y = -2.6637x + 41.552 (where y is the Cp value and x is the logarithm of the corresponding viral copy number) into the standard curve equation to calculate its viral content.

[0097] Example 5

[0098] Repeatability testing of a kit for rapid identification of different genotypes of IBV

[0099] Test samples: 10 samples from Example 3 from different batches (within batch and between batches) were selected. -2 Different strain standard plasmid solutions with different dilutions, 10 -3 Different strain standard plasmid solutions with different dilutions, 10 -4 Different strain standard plasmid solutions with different dilutions, 10 -5 Different strain standard plasmid solutions with different dilutions, 10 -6 Dilution of different strain standard plasmid solutions.

[0100] Repeatability tests were performed on the test samples using the RT-qPCR-HRM method described in Example 1 under the same reaction conditions. The results are shown in Tables 1 to 6. The results showed that the intra-assay coefficient of variation for IBV LX4 (GI-19) vaccine strain QXL87, Mass (GI-I) vaccine strain H120, 4 / 91 (GI-13) vaccine strain 4 / 91, LDT3-A (GI-28) vaccine strain LDT3-A, Taiwan (GI-7) field strain GX-NN200723, and CK / CH / LSC / 99I (GI-22) field strain GX-YL5 did not exceed 2.0%, and the inter-assay coefficient of variation exceeded 3.0%.

[0101] Table 1 Intra-batch and inter-batch reproducibility test of pTOPO-TA / Blunt-QXL87

[0102]

[0103] Table 2 Intra-batch and inter-batch repeatability test of pTOPO-TA / Blunt-H120

[0104]

[0105] Table 3 Intra-batch and inter-batch repeatability test of pTOPO-TA / Blunt-4 / 91

[0106]

[0107]

[0108] Table 4 Intra-batch and inter-batch repeatability test of pTOPO-TA / Blunt-LDT3-A

[0109]

[0110] Table 5 Intra-batch and inter-batch reproducibility test of pTOPO-TA / Blunt-GX-NN200723

[0111]

[0112] Table 6 Intra-batch and inter-batch repeatability test of pTOPO-TA / Blunt-GX-YL5

[0113]

[0114] Example 6

[0115] Detection of clinical samples by a kit for rapid identification of IBV epidemic strain genotypes

[0116] Test samples: 92 clinical samples collected and preserved by this research group

[0117] The RT-qPCR-HRM method in step (2) of Example 1 was used to detect 113 suspected IB clinical samples. The results showed that the positive detection rate was 93.3% (106 / 113), which was 100% consistent with the IBV qPCR method established by our research group. Among them, 45 samples were LX4 type, 37 samples were LDT3-A type, 15 samples were Taiwan type, 2 samples were Mass type, 4 samples were CK / CH / LSC / 99I type, and 1 sample was mixed infection of Mass+Taiwan type ( Figure 8 A), CK / CH / LSC / 99I+Taiwan type mixed infection 1 ( Figure 8 B), 4 / 91+Taiwan type mixed infection 1 ( Figure 8 C) This indicates that the HRM method established in the present invention has high accuracy for clinical detection of IBV and is simple to operate, making it suitable for promotion.

[0118] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0119] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer set for identifying six different genotypes of IBV epidemic strains, characterized in that: The primer set is HRM-F / HRM-R, and the nucleotide sequences thereof are shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. The primer set for identifying six different genotypes of IBV epidemic strains according to claim 1, characterized in that: The six different genotypes of IBV epidemic strains are LX4 (GI-19), Mass (GI-I), 4 / 91 (GI-13), LDT3-A (GI-28), Taiwan (GI-7) and CK / CH / LSC / 99I (GI-22).

3. A product for identifying six different genotypes of IBV epidemic strains, characterized by: The product comprises the primer set according to claim 1.

4. The product for identifying six different genotypes of IBV epidemic strains according to claim 3, characterized in that: The product also includes 2×HRM Analysis PreMix, primer pair HRM-F / HRM-R, RNase-Free ddH2O, and six different genotype IBV standard plasmids; Among them, the six different genotype IBV standard plasmids are IBV LX4 (GI-19) type vaccine strain QXL87 standard plasmid pTOPO-TA / Blunt-QXL87, Mass (GI-I) type vaccine strain H120 standard plasmid pTOPO-TA / Blunt-H120, 4 / 91 (GI-13) type vaccine strain 4 / 91 standard plasmid pTOPO-TA / Blunt-4 / 91, LDT3-A (GI-28) type vaccine strain LDT3-A standard plasmid pTOPO-TA / Blunt-LDT3-A, Taiwan (GI-7) type wild strain GX-NN200723 standard plasmid pTOPO-TA / Blunt-GX-NN200723, CK / CH / LSC / 99I (GI-22) type wild strain GX-YL5 standard plasmid pTOPO-TA / Blunt-GX-YL5.

5. The product for identifying six different genotypes of IBV epidemic strains according to claim 3, characterized in that: The product is a test kit.

6. Use of the primer set according to claim 1 or 2 or the product according to any one of claims 3 to 5 in preparing an IBV typing detection product, characterized in that: The IBV typing includes one or more of LX4 (GI-19), Mass (GI-I), 4 / 91 (GI-13), LDT3-A (GI-28), Taiwan (GI-7) and CK / CH / LSC / 99I (GI-22).

7. A method for qualitatively or quantitatively identifying IBV genotypes, characterized in that: The following steps are involved: Extract RNA from the test sample and reverse transcribe to obtain cDNA; then amplify the cDNA using the primer set described in claim 1 or 2 and / or the product described in any one of claims 3-5, and finally determine whether the test sample is an IBV LX4 (GI-19) type, Mass (GI-I) type, 4 / 91 (GI-13) type, LDT3-A (GI-28) type, Taiwan (GI-7) type or CK / CH / LSC / 99I (GI-22) type strain based on the high-resolution melting curve of the test sample and the standard plasmid.

8. The method for qualitatively or quantitatively identifying IBV genotypes according to claim 7, characterized in that: The reaction system for cDNA amplification was as follows: 1.2 μL of primer mix, 10 μL of 2×HRM Analysis PreMix, 1 μL of template cDNA, and RNase-Free ddH2O was used to make up to 20 μL. The final concentrations of the upstream primer HRM-F and the downstream primer HRM-R in the reaction were both 0.3 μM.

9. The method for qualitatively or quantitatively identifying IBV genotypes according to claim 7, characterized in that: The reaction procedure for cDNA amplification was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 20 s, for 45 cycles; the melting temperature of the HRM analyzer was set at a rate of 0.02°C per step from 65°C to 95°C to collect fluorescence signals.

10. The method for qualitatively or quantitatively identifying IBV genotypes according to claim 7, characterized in that: The qualitative judgment criteria are: 1) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV LX4 (GI-19) type control sample, the test sample is IBV LX4 (GI-19) type; 2) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV Mass (GI-I) type control sample, the test sample is IBV Mass (GI-I) type; 3) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV 4 / 91 (GI-13) type control sample, the test sample is IBV 4 / 91 (GI-13) type; 4) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV LDT3-A (GI-28) type control sample, the test sample is IBV LDT3-A (GI-28) type; 5) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV Taiwan (GI-7) type control sample, the test sample is IBV Taiwan (GI-7) type; 6) If the Tm value of the high-resolution melting curve of the test sample is consistent with the Tm value of the high-resolution melting curve of the IBV CK / CH / LSC / 99I (GI-22) type control sample, the test sample is IBV CK / CH / LSC / 99I(GI-22) type; The quantitative judgment criteria are: 1) If the high-resolution melting curve analysis identifies the sample as LX4 (GI-19) genotype, substitute the standard curve equation y = -3.4053x + 42.974 (where y is the Cp value and x is the logarithm of the corresponding viral copy number) to calculate its viral content; 2) If the sample to be tested is identified as Mass (GI-I) by high-resolution melting curve analysis, the viral content is calculated by substituting the standard curve equation y = -2.9407x + 40.676 (where y is the Cp value and x is the logarithm of the corresponding viral copy number); 3) If the sample to be tested is identified as genotype 4 / 91 (GI-13) by high-resolution melting curve analysis, the viral content is calculated by substituting the standard curve equation y = -3.1053 + 41.75 (where y is the Cp value and x is the logarithm of the corresponding viral copy number); 4) If the sample to be tested is identified as LDT3-A (GI-28) by high-resolution melting curve analysis, the viral content is calculated by substituting the standard curve equation y = -3.181x + 42.956 (where y is the Cp value and x is the logarithm of the corresponding viral copy number); 5) If the high-resolution melting curve analysis identifies the sample as Taiwan (GI-7) genotype, substitute the standard curve equation y = -3.275x + 44.422 (where y is the Cp value and x is the logarithm of the corresponding viral copy number) to calculate its viral content; 6) If the high-resolution melting curve analysis identifies the sample as CK / CH / LSC / 99I (GI-22) genotype, substitute y = -2.6637x + 41.552 (where y is the Cp value and x is the logarithm of the corresponding viral copy number) into the standard curve equation to calculate its viral content.

Images