Application of miR-30d-5p and CYP24A1 inhibitors in steroid-induced femoral head necrosis

By targeting and inhibiting the CYP24A1 gene through miR-30d-5p and CYP24A1 inhibitors, the vitamin D metabolic pathway was regulated, which solved the treatment problem of steroid-induced femoral head necrosis, achieved osteoblast differentiation and bone microstructure repair, delayed femoral head collapse, and provided a new treatment strategy.

CN120643588AActive Publication Date: 2025-09-16WEST CHINA HOSPITAL SICHUAN UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511132112.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-13
Publication Date
2025-09-16
Estimated Expiration
2045-08-13

AI Technical Summary

Technical Problem

Existing technologies are not ideal for the treatment of steroid-induced osteonecrosis of the femoral head (SONFH). Long-term use of glucocorticoids leads to the progression of osteonecrosis, and patients face the risk of multiple revision surgeries. There is a lack of effective early intervention methods.

Method used

By using miR-30d-5p and CYP24A1 inhibitors, we can regulate the vitamin D metabolic pathway by targeting the CYP24A1 gene, promote osteoblast differentiation and bone matrix mineralization, and provide a new treatment strategy.

Benefits of technology

It significantly promotes osteoblast differentiation and bone microstructure repair, delays the process of femoral head collapse, provides a solution for the lack of targeted drug treatment in clinical practice, blocks disease progression, and lays the foundation for conservative treatment and hip preservation surgery.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120643588A_ABST
    Figure CN120643588A_ABST
Patent Text Reader

Abstract

The invention provides an application of miR-30d-5p and CYP24A1 inhibitors in steroid-induced femoral head necrosis, and belongs to the technical field of biological medicines. The invention provides a treatment strategy for steroid-induced femoral head necrosis based on a miR-30d-5p simulant for the first time by defining a molecular mechanism that miR-30d-5p targeted inhibition CYP24A1 regulates a vitamin D metabolic pathway, and has the direct effects of remarkably promoting osteoblast differentiation and bone matrix mineralization, effectively improving bone microstructure destruction and delaying a femoral head collapse process; in the aspect of application, a brand new solution is provided for the dilemma of lack of targeted drug treatment clinically, disease progression is blocked through specific molecular intervention, and a transformation foundation is laid for conservative treatment and hip protection operation combined treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to the application of miR-30d-5p and CYP24A1 inhibitor in steroid-induced femoral head necrosis. Background Art

[0002] Osteonecrosis of the femoral head (ONFH) is a structural abnormality of the subchondral bone, resulting in bone necrosis and microcirculatory abnormalities caused by a variety of factors, including abnormal bone metabolism and impaired microcirculation. In ONFH, osteoblasts and bone marrow cells partially die within the bone tissue, leading to bone necrosis, ultimately causing structural changes and collapse of the femoral head, and subsequently developing secondary hip osteoarthritis. Clinical symptoms include severe hip pain and dysfunction. ONFH is a common and difficult-to-treat disease, primarily affecting young and middle-aged adults. According to a recent UK epidemiological study, the average age of onset in the UK population is 58.3 years. A domestic epidemiological survey showed that approximately 8.12 million cases of ONFH occur in people aged 15 and older, with a peak incidence in the 40-49 age group. The prevalence in males is approximately twice that of females. ONFH can be categorized as traumatic or non-traumatic. The main causes of non-traumatic ONFH are hormone use and alcohol consumption. Steroid-induced osteonecrosis of the femoral head (SONFH) is the most common form, closely associated with glucocorticoid use, accounting for 25% to 50% of non-traumatic osteonecrosis of the femoral head. Corticosteroids and prednisolone, used as first-line treatments and immunomodulators for a variety of infectious diseases (such as severe acute respiratory syndrome) and immune disorders (such as systemic lupus erythematosus and acute lymphoblastic leukemia), can lead to avascular necrosis of the femoral head (SONFH). Due to its increasing incidence, younger age, and severe impact on hip joint dysfunction and activities of daily living, SONFH is becoming a growing global health concern.

[0003] Because ONFH typically develops at a young age, the 2019 guidelines for the diagnosis and treatment of ONFH in adults, guidelines developed by the Chinese Medical Association, and guidelines published by the American College of Rheumatology / American Association of Hip and Knee Physicians all recommend prioritizing various hip-preserving treatment techniques. These include conservative treatments such as vasodilators, orthoses, and hyperbaric oxygen therapy, as well as hip-preserving surgeries such as core decompression, bone transport, and osteotomy. However, these treatments are not ideal, and as the disease progresses, patients may require debridement of necrotic areas and hip replacement. According to a North American study, approximately 5% to 18% of ONFH patients undergo total hip replacement surgery. Due to the limited lifespan of prosthesis materials and construction, these patients often face the risk of multiple revision surgeries. Therefore, identifying new treatments and preventing ONFH progression in its early stages may be of great value in the management of ONFH. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of miR-30d-5p in hormone-induced femoral head necrosis, providing an effective means for ONFH intervention.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides the use of miR-30d-5p in preparing a medicine for treating hormone-induced femoral head necrosis. The nucleotide sequence of the miR-30d-5p is shown in SEQ ID NO.1.

[0006] The present invention also provides the use of agomiR-30d-5p in preparing a drug for treating hormone-induced femoral head necrosis. The nucleotide sequence of agomiR-30d-5p is shown in SEQ ID NO.2.

[0007] The present invention also provides use of a pharmaceutical composition in preparing a drug for treating hormone-induced femoral head necrosis, wherein the pharmaceutical composition comprises miR-30d-5p as shown in SEQ ID NO.1.

[0008] The present invention also provides an application of a pharmaceutical composition in preparing a drug for treating steroid-induced femoral head necrosis, wherein the pharmaceutical composition comprises agomiR-30d-5p as shown in SEQ ID NO.2.

[0009] Preferably, the pharmaceutical composition further comprises a transfection reagent.

[0010] The present invention also provides the use of a CYP24A1 inhibitor in developing, screening or preparing a product for preventing and / or treating hormone-induced femoral head necrosis.

[0011] Preferably, the inhibitor is siRNA targeting the CYP24A1 gene.

[0012] Preferably, the pharmaceutical composition further comprises a CYP24A1 inhibitor.

[0013] Preferably, the CYP24A1 inhibitor is siRNA targeting the CYP24A1 gene.

[0014] Preferably, the nucleotide sequence of the siRNA includes a sense strand as shown in SEQ ID NO.8 and an antisense strand as shown in SEQ ID NO.9.

[0015] Beneficial effects of the present invention: The present invention clarifies the molecular mechanism by which miR-30d-5p targets and inhibits CYP24A1 to regulate the vitamin D metabolic pathway, and for the first time provides a treatment strategy for hormonal femoral head necrosis based on miR-30d-5p mimics. Its direct effect is to significantly promote osteoblast differentiation and bone matrix mineralization, effectively improve bone microstructure destruction and delay the process of femoral head collapse. In terms of application significance, this invention provides a new solution to the dilemma of lack of targeted drug treatment in clinical practice, blocks disease progression through specific molecular intervention, and lays a transformative foundation for the combined treatment of conservative treatment and hip-preserving surgery. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a schematic diagram of the principle of the present invention; Figure 2 This is a map of the vectors used in the examples, where A is vector GV716 and B is GV272; Figure 3 Binding of the target gene miR-30d-5p to the target gene CYP24A1 reporter gene is shown in Figure 1. (A) Predicted binding sites for miR-30d-5p and CYP24A1; (B) Changes in relative luciferase activity demonstrate the binding relationship between miR-30d-5p and CYP24A1. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns indicates no significant difference. Figure 4Transfection of the target gene miR-30d-5p promotes alkaline phosphatase production and calcium deposition. (A) BCIP / NBT alkaline phosphatase staining and semi-quantification after miR-30d-5p transfection, n = 3, scale bar 500 μm; (B) ARS staining and semi-quantification after miR-30d-5p transfection, n = 3, scale bar 500 μm. Mean ± SD, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns indicates no significant difference. miR-30d-5p group refers to the miR-30d-5p mimic experimental group, miR-NC group refers to the non-functional mimic control group, inh-30d-5p group refers to the miR-30d-5p inhibition experimental group, and inh-NC group refers to the non-functional inhibition control group. Figure 5 Figure 3: Cyp24a1 knockdown to promote osteogenic differentiation. (A) BCIP / NBT alkaline phosphatase staining, ARS staining, and semi-quantitative results after Cyp24a1 transfection. Scale bar: 500 μm, n = 3. (B) Immunofluorescence and 3D visualization of osteogenic differentiation indicator cells after Cyp24a1 transfection. Blue represents the nucleus, yellow represents the cytoskeleton, and green represents the target protein. Scale bar: 50 μm. (C) Semi-quantitative immunofluorescence results of osteogenic differentiation indicator cells after Cyp24a1 transfection. n = 3. Mean ± SD, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. siCYP24A1 group represents Cyp24a1 knockdown group, and si-NC group represents nonfunctional siRNA knockdown control group. Figure 6 Figure 3 Gross and micro-CT images of the femoral head show that miR-30d-5p promotes bone repair in the ONFH model. (A) Micro-CT coronal, sagittal, transverse, and 3D-reconstructed images and gross images of the femoral head in each group. Scale bar: 0.1 mm. (B) Bone morphology of the subchondral zone of the femoral head in each group. n = 5, mean ± SD, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns, no significant difference. ago-30d-5p refers to the miR-30d-5p in vivo mimic group, and ago-NC refers to the nonfunctional miR-NC in vivo mimic group. DETAILED DESCRIPTION

[0017] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0018] Figure 1This is a schematic diagram of the effects of the present invention. Supplementation of miR-30d-5p can inhibit Cyp24a1, preventing the active 1,25(OH)2D3 from being decomposed into inactive 24,25(OH)2D3, thereby promoting bone formation.

[0019] Example Plasmid and vector construction: The plasmid and overexpression vector used in this experiment were designed and constructed by GeneCare. rno-miR-30d-5p (UGUAAACAUCCCCGACUGGAAG) was inserted into the insertion site -BamHI / AgeI of vector GV716. The vector map is shown in Figure 2 As shown in A. The wild-type and mutant overexpression vectors are both GV272, as shown in the figure. Figure 2 As shown in B, the insertion site is XbaI / XbaI.

[0020] Cell transfection: The designed target miRNA reporter plasmid, target gene-3'UTR, and target gene-3'UTR-MUT (mutant) were transfected into MC3T3-E1 cells according to the experimental design. Six groups were divided into: miR-NC+3'UTR-NC, miR-NC+3'UTR, miR-NC+3'UTR-MUT, miR-target+3'UTR-NC, miR-target+3'UTR, and miR-target+3'UTR-MUT.

[0021] Assay procedure: After 48 hours, luciferase activity was measured according to the instructions for the Dual-Luciferase Reporter Kit. Briefly, the cells were discarded from the culture medium, washed with PBS, and lysed on ice for 5 minutes. The cells were transferred to an EP tube and centrifuged at 12,000 g for 2 minutes at 4°C. 20 μL of the supernatant was aspirated and transferred to a 96-well plate with a black bottom and protected from light. 50 μL of the firefly luciferase reaction solution, equilibrated to room temperature, was added to the 96-well plate and immediately placed in a microplate reader. The plate was linearly shaken for 8 seconds, and the luminescence was measured. Subsequently, 50 μL of freshly prepared sea cucumber substrate working solution was immediately added to the plate reader. The plate was linearly shaken for 8 seconds, and the luminescence was measured. Relative activity was expressed as the ratio of the firefly luciferase fluorescence value to the Renilla luciferase fluorescence value.

[0022] For the in vitro validation of miRNA, the cell transfection groups were divided into: target miRNA mimic experimental group (transfection target miRNA mimic, miR-target group), non-functional mimic control group (transfection mimic-NC, miR-NC group), target miRNA inhibitor experimental group (transfection target miRNA inhibitor, inh-target miRNA group) and non-functional inhibitor control group (transfection inhibitor-NC, inh-NC group).

[0023] For in vitro verification of target genes, cell transfection groups were divided into siRNA interference target gene experimental group (transfection target gene-siRNA, siCYP24A1 group) and non-functional siRNA interference control group (transfection siRNA-NC, si-NC group).

[0024] The miR-30d-5p mimics, miR-30d-5p inhibitor, mimic-NC, inhibitor-NC, Cyp24a1-siRNA, and siRNA-NC-related sequences are listed here ( Table 1 ).

[0025] Table 1 Sequences related to in vitro mechanism verification name Sequence (5'-3') miR-30d-5p mimic Sense: UGUAAACAUCCCCGACUGGAAG, as shown in SEQ ID NO.1; Antisense: UCCAGUCGGGGAUGUUUACAUU, as shown in SEQ ID NO.3; mimic-NC Sense: UCACAACCUCCUAGAAAGAGUAGA, as shown in SEQ ID NO.4; Antisense: UCUACUCUUUCUAGGAGGUUGUGA, as shown in SEQ ID NO.5; miR-30d-5p inhibitor Sense: CUUCCAGUCGGGGAUGUUUACA, as shown in SEQ ID NO.6; inhibitor-NC Sense: UCUACUCUUUCUAGGAGGUUGUGA, as shown in SEQ ID NO.7; Cyp24a1-siRNA Sense: AAAUUUUAAAAUGUUUACA(dT)(dT), as shown in SEQ ID NO.8; Antisense: UGUAAACAUUUUAAAAUUU(dT)(dT), as shown in SEQ ID NO.9; According to the instructions for the Lipo8000 transfection reagent, the prepared solution containing the corresponding transfection material was added to the cell culture system according to the different groupings. The cells were cultured in α-MEM medium without fetal bovine serum. After 6 hours, the medium was replaced with α-MEM medium containing 10% fetal bovine serum. For each well of the six-well plate to be transfected, 125 μL of α-MEM medium without antibiotics and serum was added, along with 2.5 μg of miRNA or siRNA, and the mixture was gently pipetted. Then, 4 μL of Lipo8000 transfection reagent was added and the mixture was gently pipetted. Do not vortex or centrifuge.

[0026] Only the control group received 0.9% saline injected into the gluteal muscle, while all other groups received MPS (20 mg / kg / day) injected into the gluteal muscle to establish the model. The model group, ago-target miRNA group, and ago-NC group received tail vein injections of PBS, agomiR-target (a target miRNA in vivo mimic, synthesized by Beijing Qingke Biotechnology Co., Ltd.), and agomiR-NC (a non-functional miR-NC in vivo mimic), respectively. Model establishment and intervention frequency and duration are shown in Table 2.

[0027] Table 2 Intervention regimens for rats in different groups Group Intervention Program control group Inject 0.9% saline solution, 100 μL, into the gluteal muscle once a day for 3 consecutive days per week for 3 weeks Model Group MPS was injected into the gluteal muscle at 20 mg / kg / d, 100 μL, once a day for 3 consecutive days per week for 3 weeks; PBS (100 μL) was injected into the tail vein for 3 weeks. ago-target miRNA group MPS was injected into the gluteal muscle at the same dose as the model group; the target miRNA mimic (250 nmol / kg / d) was injected into the tail vein once a day for 3 consecutive days per week for 3 weeks. ago-NC group MPS was injected into the gluteal muscle at the same dose as the model group; non-functional miRNA mimics were injected into the tail vein once a day for 3 consecutive days per week for 3 weeks. miRNA in vivo mimic agomiR-30d-5p sequence: UGUAAACAUCCCCGACUGCAAG, as shown in SEQ ID NO. 2; 3. Results There are four binding sites between miR-30d-5p and the target gene CYP24A1, such as Figure 3As shown in A, the binding sequence of Cyp24a1-3'UTR (miR-30d-5p) is TGTTTAC, and the same site of cyp24a1-3'UTR (miR-30d-5p)-MUT is designed to be GTGGGCA. In order to verify the binding relationship between the target gene miR-30d-5p and the target gene Cyp24a1, a dual luciferase gene reporter experiment was designed, and the results are shown in Figure 3 As shown in B, after co-transfection of miR-30d-5p mimics with WT-CYP24A1 3'UTR (wild type) vector, the relative luciferase activity of the miR-30d-5p mimics group was significantly different compared with the mimics NC control group, NC-3'UTR, and MUT-CYP24A1 3'UTR (mutant type) ( P <0.0001); however, the relative luciferase activity detected by co-transfection of NC-3'UTR, MUT-CYP24A1 3'UTR and miR-30d-5p mimics was not significantly different from that of the mimics NC control group, indicating that the target gene miR-30d-5p can bind to the target gene Cyp24a1.

[0028] BCIP / NBT and ARS staining results showed that miR-30d-5p promoted alkaline phosphatase production and calcium deposition in MC3T3-E1 cells: osteogenic induction was performed 3 days after transfection, and the BCIP / NBT alkaline phosphatase color development results and semi-quantitative decomposition results were as follows 7 days later. Figure 4 As shown in A. Compared with the other groups, the color reaction of the miR-30d-5p group was significantly enhanced ( P <0.001), indicating that miR-30d-5p promotes the production of alkaline phosphate in MC3T3-E1 cells. ARS staining was performed on day 21, and the results were as follows Figure 4 As shown in B, compared with the other groups, the ARS staining reaction in the miR-30d-5p group was significantly enhanced ( P <0.001), and the difference was statistically significant, indicating that miR-30d-5p promoted calcium deposition in MC3T3-E1 cells.

[0029] Osteogenesis staining and differentiation-related indexes Cell immunofluorescence results showed that inhibition of CYP24A1 promoted alkaline phosphatase production and calcium deposition in MC3T3-E1 cells: Osteogenesis induction was performed 3 days after transfection, and the BCIP / NBT alkaline phosphatase colorimetric results and semi-quantitative analysis results were shown in Figure 5. Figure 5 As shown in A, the color reaction of the siCYP24A1 group was significantly enhanced compared with the si-NC group ( P <0.001). ARS staining was performed on day 21. Compared with the si-NC group, the color reaction of the siCYP24A1 group was significantly enhanced (P <0.001). The results of immunofluorescence and semi-quantitative analysis of cells after transfection are shown in Figure 2. Figure 5 B and Figure 5 As shown in C, compared with the si-NC group, the expressions of BMP2, RUNX2, COLⅠA1 and OCN in the siCYP24A1 group were increased ( P <0.01), the difference was statistically significant, indicating that CYP24A1 had an inhibitory effect on the osteogenic differentiation of MC3T3-E1 cells and the expression of osteogenic differentiation-related proteins under hormone conditions.

[0030] Gross view and micro-CT imaging of the femoral head Figure 6 A shows that the macroscopic appearance of the femoral heads of the rats in the model group and the ago-NC group was redder than that of the cartilage surface of the control group and the ago-30d-5p group. The subchondral bone structure of the femoral heads in the model group and the ago-NC group showed different degrees of destruction of the trabecular morphology, the formation of cavities in the subchondral region of the femoral head, disordered trabecular structure, irregular arrangement, and uneven density. The degree of destruction of the subchondral trabecular morphology of the rats in the ago-30d-5p group was very slight, the trabeculae were relatively intact and distributed more evenly, and the cartilage surface was more uniform, indicating that the subchondral bone structure of the femoral head was close to normal after the injection of miR-30d-5p mimics. Quantitative analysis of bone morphological parameters of the femoral heads in each group is shown in Figure 2. Figure 6 Figure B shows that compared with the model and ago-NC groups, the ago-30d-5p group showed significant increases in BV / TV, Tb.Th, Tb.Sp, Tb.N, and BMD (P < 0.01), and a significant decrease in BS / BV (P < 0.01). Micro-CT images and quantitative analysis of bone morphology and trabecular bone morphology in the subchondral region of the femoral head confirmed the positive effect of miR-30d-5p injection on bone repair in ONFH rats.

[0031] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Application of miR-30d-5p in the preparation of a drug for treating steroid-induced femoral head necrosis, characterized in that: The nucleotide sequence of miR-30d-5p is shown in SEQ ID NO.

1.

2. Use of agomiR-30d-5p in the preparation of a drug for treating steroid-induced femoral head necrosis, characterized in that: The nucleotide sequence of agomiR-30d-5p is shown in SEQ ID NO.

2.

3. Use of a pharmaceutical composition in the preparation of a drug for treating steroid-induced femoral head necrosis, characterized in that: The pharmaceutical composition comprises miR-30d-5p as shown in SEQ ID NO.

1.

4. Use of a pharmaceutical composition in the preparation of a drug for treating steroid-induced femoral head necrosis, characterized in that: The pharmaceutical composition comprises agomiR-30d-5p as shown in SEQ ID NO.

2.

5. The use according to claim 3 or 4, characterized in that The pharmaceutical composition also includes a transfection reagent.

6. Use of CYP24A1 inhibitors in the development, screening or preparation of products for preventing and / or treating steroid-induced femoral head necrosis.

7. The use according to claim 6, characterized in that The inhibitor is siRNA targeting the CYP24A1 gene.

8. The use according to claim 3 or 4, characterized in that The pharmaceutical composition also includes a CYP24A1 inhibitor.

9. The use according to claim 8, characterized in that The CYP24A1 inhibitor is siRNA targeting the CYP24A1 gene.

10. The use according to claim 7 or 9, characterized in that: The nucleotide sequence of the siRNA includes a sense strand as shown in SEQ ID NO.8 and an antisense strand as shown in SEQ ID NO.9.

Citation Information

Patent Citations

  • Microrna-based methods and compositions for the diagnosis, prognosis and treatment of solid cancers

    CN101389770A

  • Application of miR-99a in steroid-induced femoral head necrosis

    CN109628572A

  • Cell-based RNA interference and related methods and compositions

    US20090217404A1