Application of Zyxin protein in preparation of product for treating renal interstitial fibrosis caused by hypertension

Abstract

The invention discloses application of zyxin protein in preparation of a product for treating renal interstitial fibrosis caused by hypertension, and belongs to the technical field of biological medicine. The core effect of the zyxin protein in hypertensive nephropathy treatment through targeted regulation of a CDK8 / YAP signal axis is found for the first time, the target limitation of existing anti-renal fibrosis drugs is broken through, and clinical transformation can be achieved through the following modes that 1, a gene treatment preparation is constructed based on a zyxin coding sequence; the method comprises the steps of (1) screening a small molecule compound library for regulating and controlling the activity of a zyxin-CDK8 / YAP axis, (3) developing an HN typing diagnosis system with the zyxin expression level as a biomarker, and (4) exploring and developing the industrialization prospect of a new drug or a combination therapy on the basis of deeply researching the dose-effect relation of the zyxin in the aspects of reversing renal interstitial fibrosis and improving renal functions.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the application of zyxin protein in preparing products for treating renal interstitial fibrosis caused by hypertension. Background Art

[0002] With the rapid global increase in the prevalence of hypertension, hypertensive nephropathy (HN) has become the second leading cause of end-stage renal disease. Renal fibrosis, particularly progressive tubulointerstitial fibrosis (TIF), plays a key role in the progression of hypertensive patients to end-stage renal disease. However, the molecular mechanisms underlying hypertension-induced renal fibrosis remain incompletely understood, and no specific drug is currently available to reverse this process. Angiotensin II (Ang II) plays a crucial role in hypertensive renal damage, not only through hemodynamic effects but also through multiple mechanisms that contribute to the fibrotic process in renal tubular epithelial cells (TECs). For example, Ang II enhances TGF-β expression and activates the Smad3 pathway, upregulating CTGF levels, promoting the transformation of TECs into myofibroblasts and increasing the production of extracellular matrix proteins. Furthermore, Ang II can trigger renal inflammation and tissue remodeling by activating the NF-κB pathway and the NLRP3 inflammasome, while also regulating NADPH oxidase-mediated reactive oxygen species production, inducing tubular hypertrophy and TEC apoptosis. Therefore, current clinical interventions primarily involve renin-angiotensin II system inhibitors (such as losartan and enalapril). However, numerous lines of evidence indicate that traditional inhibitors have limited efficacy in slowing renal function deterioration. Furthermore, in recent years, single-target inhibitors of classic profibrotic factors, such as TGF-β and CTGF, have generally encountered insufficient efficacy or toxicity in clinical trials. Therefore, exploring the underlying mechanisms and novel targets of hypertension-induced TIF is crucial for optimizing treatment strategies for hypertensive renal damage.

[0003] Zyxin is a phosphorylated protein primarily localized in focal adhesions and actin stress fibers. Its structure consists of a proline-rich N-terminus, a C-terminus containing three LIM domains (Lin11, Isl-1, and Mec-3), and a central region. The N-terminus regulates the stability and dynamics of the actin cytoskeleton. The C-terminal LIM domain serves as a protein-protein / DNA interface, enabling zyxin to bind to a variety of partner molecules. Two lysine-rich nuclear export sequences in the central region mediate zyxin's shuttling between the nucleus and cytoplasm, participating in intracellular signaling. These unique structures endow zyxin with a wide range of complex physiological functions.

[0004] Zyxin has been reported to play a role in the development of hypertension and kidney-related diseases. Under conditions of arterial hypertension, zyxin in endothelial cells migrates to the nucleus, regulates gene expression, and drives arterial remodeling. In mechanically stretched podocytes, zyxin redistributes from focal adhesions to actin filaments, thereby maintaining podocyte stability during hypertension. In mouse inner medullary collecting duct cells, zyxin that enters the nucleus stimulates hepatocyte nuclear factor-1β-dependent gene expression to regulate renal epithelial differentiation. Furthermore, bioinformatics analysis has revealed that zyxin may serve as a potential biomarker for focal segmental glomerulosclerosis, membranous nephropathy, and minimal change disease. However, the role of zyxin in fibrosis is significantly contradictory: in contrast, in another model, zyxin has a promoting effect on skin fibrosis. This tissue-specific difference precludes zyxin from being a direct therapeutic target, and in vitro and in vivo studies are needed to clarify the role of zyxin in TIF.

[0005] The transcriptional coactivator Yes-associated protein (YAP) is a key effector of the Hippo pathway. The profibrotic role of YAP in various renal diseases has been widely demonstrated. Upon activation, YAP translocates to the nucleus and regulates gene expression, a process regulated by zyxin. In mesenchymal stem cells, zyxin regulates YAP localization and activity: zyxin knockdown inhibits dynamic stretch-induced YAP nuclear translocation, while zyxin overexpression significantly attenuates YAP activation induced by increased matrix stiffness. Cyclin-dependent kinase 8 (CDK8) is a serine-threonine protein kinase that regulates the cell cycle. Studies have shown that CDK8 promotes pulmonary fibrosis by regulating various fibrogenic growth factors. Furthermore, zyxin has been shown to participate in the development of colorectal cancer by regulating the CDK8 / YAP signaling pathway. However, existing studies have only demonstrated that YAP activation alone can aggravate renal fibrosis, but have not identified its upstream co-regulators. The function of CDK8 in renal disease remains unclear.

[0006] Transient receptor potential canonical 3 (TRPC3) is a calcium-permeable, non-selective cation channel widely expressed in renal vascular and epithelial cells. TRPC3 is closely associated with the progression of hypertension and promotes TIF induced by unilateral ureteral obstruction. TRPC3 plays a key role in mechanical stretch-induced activation of zyxin in vascular cells. In endothelial and smooth muscle cells lacking TRPC3, zyxin nuclear translocation is significantly inhibited under stress. Although direct regulation of YAP activity by TRPC3 remains unclear, TRPC6, which shares similar structure and function with TRPC3, can activate the YAP homolog TAZ in breast cancer cells. In the field of hypertensive nephropathy, existing research has focused solely on its calcium channel function and has failed to identify its connection to fibrosis regulatory networks. The regulatory relationship between TRPC3 activity and zyxin has not yet been established, hindering the development of anti-fibrotic strategies targeting this pathway. Summary of the Invention

[0007] The present invention provides the use of zyxin protein, its coding gene or a recombinant adenovirus containing the protein coding gene in preparing a product for treating renal interstitial fibrosis caused by hypertension.

[0008] In one embodiment of the present invention, the nucleotide sequence of the protein encoding gene is shown as SEQ ID NO.19.

[0009] SEQ ID NO.19:

[0010] GCGGACCCGGCGCCGAGGCGGCCACCCGAGACGCGGCGCGCACGCTCCGGCCTGCGCAGCCCGGCCCGGCC ATGGCGGCCCCCCGCCCGTCTCCCGCGATCTCCGTTTCGGTCTCGGCTCCGGCTTTTTACGCCCCGCAGAAGA AGTTCGGCCCTGTGGTGGCCCCAAAGCCCAAAGTGAATCCCTTCCGGCCCGGGGACAGCGAGCCTCCCCCGGCACC CGGGGCCCAGCGCGCACAGATGGGCCGGGTGGGCGAGATTCCCCCGCCGCCCCCGGAAGACTTTCCCCTGCCTCCA CCTCCCCTTGCTGGGGATGGCGACGATGCAGAGGGTGCTCTGGGAGGTGCCTTCCCGCCGCCCCCTCCCCCGATCG AGGAATCATTTCCCCCTGCGCCTCTGGAGGAGGAGATCTTCCCTTCCCCGCCGCCTCCTCCGGAGGAGGAGGGAGG GCCTGAGGCCCCCATACCGCCCCCACCACAGCCCAGGGAGAAGGTGAGCAGTATTGATTTGGAGATCGACTCTCTG TCCTCACTGCTGGATGACATGACCAAGAATGATCCTTTCAAAGCCCGGGTGTCATCTGGATATGTGCCCCCACCAG TGGCCACTCCATTCAGTTCCAAGTCCAGTACCAAGCCTGCAGCCGGGGGCACAGCACCCCTGCCTCCTTGGAAGTC CCCTTCCAGCTCCCAGCCTCTGCCCCAGGTTCCGGCTCCGGCTCAGAGCCAGACACAGTTCCATGTTCAGCCCCAG CCCCAGCCCAAGCCTCAGGTCCAACTCCATGTCCAGTCCCAGACCCAGCCTGTGTCTTTGGCTAACACCCAGCCCC GAGGGCCCCCAGCCTCATCTCCGGCTCCAGCCCCTAAGTTTTCTCCAGTGACTCCTAAGTTTACTCCTGTGGCTTC CAAGTTCAGTCCTGGAGCCCCAGGTGGATCTGGGTCACAACCAAATCAAAAATTGGGGCACCCCGAAGCTCTTTCT GCTGGCACAGGCTCCCCTCAACCTCCCAGCTTCACCTATGCCCAGCAGAGGGAGAAGCCCCGAGTGCAGGAGAAGC AGCACCCCGTGCCCCCACCGGCTCAGAACCAAAACCAGGTGCGCTCCCCTGGGGCCCCAGGGCCCCTGACTCTGAA GGAGGTGGAGGAGCTGGAGCAGCTGACCCAGCAGCTAATGCAGGACATGGAGCATCCTCAGAGGCAGAATGTGGCT GTCAACGAACTCTGCGGCCGATGCCATCAACCCCTGGCCCGGGCGCAGCCAGCCGTCCGCGCTCTAGGGCAGCTGT TCCACATCGCCTGCTTCACCTGCCACCAGTGTGCGCAGCAGCTCCAGGGCCAGCAGTTCTACAGTCTGGAGGGGGC GCCGTACTGCGAGGGCTGTTACACTGACACCCTGGAGAAGTGTAACACCTGCGGGGAGCCCATCACTGACCGCATG CTGAGGGCCACGGGCAAGGCCTATCACCCGCACTGCTTCACCTGTGTGGTCTGCGCCCGCCCCCTGGAGGGCACCT CCTTCATCGTGGACCAGGCCAACCGGCCCCACTGTGTCCCGACTACCACAAGCAGTACGCCCCGAGGTGCTCCGT CTGCTCTGAGCCCATCATGCCTGAGCCTGGCCGAGATGAGACTGTGCGAGTGGTCGCCCTGGACAAGAACTTCCAC ATGAAGTGTTACAAGTGTGAGGACTGCGGGAAGCCCCTGTCGATTGAGGCAGATGACAATGGCTGCTTCCCCCTGG ACGGTCACGTGCTCTGTCGGAAGTGCCACACTGCTAGAGCCCAGACCTGA GTGAGGACAGGCCCTCTTCAGACCGCAGTCCATGCCCCATTGTGGACCACCCACACTGAGACCACCTGCCCCCACCTCAGTTATTGTTTTGATGTCTAGCCCCTCCCATTTCCAACCCCTCCCTAGCATCCCAGGTGCCCTGACCCAGGACCCAACATGGTCTAGGGATGCAGGATCCCGCCCTGGGGTCTGGTCCTCGCCCATCCTGCAGGG ATTGCCCACCGTCTTCCAGACACCCCACCTGAGGGGGGCACCAGGTTTAGTGCTGCTGCTTTCACTGCTGCACCCGCGCCCTCGGCCGGCCCCCCGAGCAGCCTTTGTACTCTGCTTGCGGAGGGCTGGGAGACCCTCCAGGACATTCCCACCCTCCCCCATGCTGCCAAGTTGTAGCTATAGCTACAAATAAAAAAAAACCTTGTTTTCCAG.

[0011] In one embodiment of the present invention, the product is a medicine.

[0012] In one embodiment of the present invention, zyxin protein is the only active ingredient in the drug.

[0013] In one embodiment of the present invention, the drug is a pharmaceutical composition.

[0014] In one embodiment of the present invention, the drug further contains a pharmaceutically acceptable carrier.

[0015] In one embodiment of the present invention, when the protein is the active ingredient of the product, the product also contains a protein stabilizer.

[0016] In one embodiment of the present invention, when the nucleic acid molecule containing the encoding gene or the recombinant adenovirus is the active ingredient of the product, the product also contains a nucleic acid stabilizer.

[0017] In one embodiment of the present invention, the product is a pharmaceutical composition, which, in addition to the protein as the active pharmaceutical ingredient, the nucleic acid molecule containing the protein-encoding gene, or the recombinant adenovirus containing the protein-encoding gene, further comprises at least one auxiliary therapeutic agent.

[0018] In one embodiment of the present invention, the product is a drug, and the dosage form of the drug is a lyophilized preparation or an injection.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] This study reveals for the first time the central role of zyxin protein in the treatment of hypertensive nephropathy by targeting and regulating the CDK8 / YAP signaling axis. The study confirmed that: (1) zyxin expression is significantly negatively correlated with the progression of hypertensive renal fibrosis, and exogenous zyxin intervention can specifically inhibit the profibrotic activity of CDK8 / YAP; (2) zyxin's renal protective effect is dose-dependent, and it regulates the pathological microenvironment through a dual regulatory mechanism of the Ang II-TRPC3 signaling pathway; and (3) a molecular regulatory network of zyxin-CDK8-YAP-extracellular matrix remodeling has been constructed for the first time, providing a new direction for the development of small molecule inhibitors, gene therapy vectors, or antibody drugs targeting this pathway. This discovery breaks through the target limitations of existing anti-renal fibrosis drugs and can be achieved clinical translation through the following methods: 1) constructing gene therapy preparations based on the zyxin coding sequence; 2) screening a library of small molecule compounds that regulate the activity of the zyxin-CDK8 / YAP axis; 3) developing an HN typing diagnostic system using zyxin expression levels as a biomarker; and 4) exploring the industrial prospects for developing a new class of drugs or combination therapies based on in-depth research on the dose-effect relationship of zyxin in reversing renal interstitial fibrosis and improving renal function. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1Figure 1 shows the reduced expression of zyxin in the renal tubules of HN mice. A. Systolic blood pressure (SBP) in the tail artery of control and HN mice on days -14, 0, 7, and 21 of modeling. B. Serum creatinine (Scr) levels in control and HN mice. C. Blood urea nitrogen (BUN) levels in control and HN mice. D. Representative immunohistochemistry and Masson staining images showing deposition of type I collagen (Col I), α-smooth muscle actin (α-SMA), and collagen fibers in the tubulointerstitial region of control and HN mice. Scale bar: 100 μm. EF. Representative Western blot images and quantitative data for zyxin, Fn, Col I, and α-SMA in renal tissues of control and HN mice. G. Representative immunofluorescence staining images of zyxin (green) in the kidneys of control and HN mice. Scale bar: 100 μm.

[0022] Figure 2 In Example 1, Ang Ⅱ stimulation leads to down-regulation of zyxin expression in HK-2 cells, wherein AB. In 10 -6 Representative Western blot images and quantitative data of zyxin, Fn, Col I and α-SMA in HK-2 cells of control and stimulated groups after stimulation with Ang II at a concentration of 10 M for 24 h. -6 Relative mRNA levels of zyxin, Fn, Col I, and α-SMA in HK-2 cells in the control and stimulated groups after 24 hours of stimulation with Ang II at a concentration of 1 M. D. Representative immunofluorescence staining images of zyxin (green) in HK-2 cells in the control and stimulated groups. Scale bar: 100 μm.

[0023] Figure 3 Figure 1 shows that overexpressing zyxin in the kidneys alleviates TIF in HN mice. AB. Representative Western blot images and quantitative data of zyxin in the kidneys of mice infected with a control AAV virus and an AAV virus overexpressing zyxin. C. Relative mRNA levels of zyxin in the kidneys of mice infected with a control AAV virus and an AAV virus overexpressing zyxin. D. SBP of the four groups of mice on days -14, 0, 7, and 21 of modeling. E. Scr levels of the four groups of mice. F. BUN levels of the four groups of mice. GH. Representative Western blot images and quantitative data of Fn, Col I, and α-SMA in renal tissues of the four groups of mice. I. Representative immunohistochemistry and Masson staining show deposition of Col I, α-SMA, and collagen fibers in the tubulointerstitial regions of the four groups of mice.

[0024] Figure 4 Figure 1 shows the inhibition of Ang II-induced fibrosis in HK-2 cells by Zyxin. AB. Representative Western blot images and quantitative data of zyxin in HK-2 cells treated with control lentivirus and zyxin-overexpressing lentivirus. C. Relative mRNA levels of zyxin in HK-2 cells treated with control lentivirus and zyxin-overexpressing lentivirus. DE. Representative Western blot images and quantitative data of Fn, Col I, and α-SMA in the four groups of cells shown. FG. Representative Western blot images and quantitative data of zyxin in HK-2 cells treated with control shRNA and shRNA targeting zyxin. H. Relative mRNA levels of zyxin in HK-2 cells treated with control shRNA and shRNA targeting zyxin. IJ. Representative Western blot images and quantitative data of Fn, Col I, and α-SMA in the four groups of cells shown.

[0025] Figure 5 Figure 1 shows Zyxin ameliorating TIF caused by hypertension by inhibiting YAP. AB. Representative Western blot images and quantitative data of YAP in renal tissues of the control and hypertensive groups. CD. Representative Western blot images and quantitative data of YAP in HK-2 cells of the control and Ang II-treated groups. E. Representative immunofluorescence staining images of YAP (red) in HK-2 cells of the control and Ang II-treated groups. Scale bar: 10 μm. F. Relative mRNA levels of YAP in HK-2 cells treated with control siRNA and YAP-targeting siRNA. GH. Representative Western blot images and quantitative data of Fn, Col I, and α-SMA in the four groups of cells shown. IJ. Representative Western blot images and quantitative data of YAP in renal tissues of the four groups of mice shown. KL. Representative Western blot images and quantitative data of YAP in the four groups of cells shown.

[0026] Figure 6In Example 1, zyxin regulates YAP expression by targeting CDK8 under hypertensive conditions. AB. Representative Western blot images and quantitative data of CDK8 in kidney tissues of the control and HN groups. CD. Representative Western blot images and quantitative data of CDK8 in HK-2 cells treated with Ang II and the control group. EF. Representative Western blot images and quantitative data of YAP, Fn, Col I, and α-SMA in the three groups of cells shown. GH. Representative Western blot images and quantitative data of CDK8 in the four groups of cells shown. IJ. Representative Western blot images and quantitative data of CDK8 in the four groups of mice shown. KL. Representative Western blot images and quantitative data of CDK8 in the four groups of cells shown.

[0027] Figure 7 In Example 1, TRPC3 inhibition restored Ang II-induced downregulation of zyxin and alleviated the elevation of CDK8 / YAP and fibrosis markers. A and B. Representative Western blot images and quantitative data of TRPC3 in renal tissues of the control and HN groups. C. Representative immunohistochemical staining of TRPC3 in renal tubules of the control and HN groups. Scale bar: 50 μm. D and E. Representative Western blot images and quantitative data of TRPC3 in control and Ang II-treated HK-2 cells. F and H. Representative Western blot images and quantitative data of zyxin, CDK8, YAP, Fn, Col I, and α-SMA in the three cell groups shown. DETAILED DESCRIPTION

[0028] The English abbreviations involved in the following embodiments have the following meanings:

[0029] HN hypertensive nephropathy;

[0030] Ang II angiotensin II;

[0031] DOCA deoxycorticosterone acetate;

[0032] SBP, caudal artery systolic blood pressure;

[0033] Scr serum creatinine;

[0034] BUN blood urea nitrogen;

[0035] AAV adeno-associated virus;

[0036] HK-2 human proximal tubular epithelial cells;

[0037] Senexin A CDK8 / 19 inhibitor;

[0038] Pyr3 Pyr3 / TRPC3 channel selective inhibitor.

[0039] Example 1

[0040] 1. Animal Model

[0041] Eight-week-old male C57BL / 6 mice (Shulaibao Biotechnology, Wuhan, China) were housed at the Laboratory Animal Center of Tongji Medical College. All mice were housed at a temperature of 23 ± 2°C, a humidity range of 30–70%, and a 12-h dark / light cycle with ample food and water.

[0042] (1) Construction of a mouse model of hypertensive renal damage

[0043] C57BL / 6 mice were randomly divided into a control (sham) group and a hypertensive renal injury (HN) group. The HN model was established by unilateral nephrectomy combined with subcutaneous implantation of Ang II and sustained-release deoxycorticosterone acetate (DOCA) particles. The procedure was as follows: Under 1.0% pentobarbital anesthesia, the left nephrectomy was performed on the mice (day -14). Two weeks later (day 0), a skin incision was made in the neck of the mice, and a 50 mg sustained-release DOCA tablet (IRA, Sarasota, FL, USA) was subcutaneously implanted. The drinking water was then replaced with 1% hypertonic saline for three weeks. One week later (day 7), an osmotic minipump (1002, ALZET, Cupertino, CA, USA) was subcutaneously implanted near the incision site. Ang II (ab120183, Abcam, Cambridge, MA, USA) was delivered at a rate of 1500 ng / kg body weight per minute for two weeks. Two weeks later (day 21), the mice were killed and samples were collected.

[0044] (2) Physiological parameter assessment

[0045] The tail artery systolic blood pressure (SBP) of each group of mice was monitored using a non-invasive mouse blood pressure monitor (BP2010A, Softron, Beijing, China) on days −14, 0, 7, and 21. Kidney and blood samples were collected on day 21. Serum creatinine (Scr) and blood urea nitrogen (BUN) were measured using an automated biochemical analyzer (ADVIA 2400, Siemens, Erlangen, Germany).

[0046] (3) Local delivery of adeno-associated virus (AAV) to the kidney

[0047] Adeno-associated virus (Vigenebio, Shandong, China) overexpressing zyxin (Genbank accession number: NM_011777) was delivered into the kidneys of mice by intrarenal injection. Briefly, 14 days before unilateral nephrectomy, mice were anesthetized, and the right kidney was exposed by dorsal incision. Using a 31G needle, 100 μL of 2 × 10 11 pfu / mL of zyxin-targeted adeno-associated virus AAV9 or control adeno-associated virus were slowly injected into the renal cortex of the right kidney at multiple points.

[0048] 2. Cell Culture and Treatment

[0049] (1) Cell culture

[0050] Human proximal tubule epithelial cell line (HK-2 cells) was purchased from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured in DMEM / F12 medium supplemented with 10% fetal bovine serum (Thermo Fisher, Waltham, MA, USA) and 1% penicillin-streptomycin solution at 37°C in a humidified incubator containing 5% CO2. After serum starvation for 12 h, cells were incubated with 10 -6 Ang II (ab120183, Abcam, Cambridge, MA, USA) was applied continuously for 24 hours at a concentration of 5 μM to observe its effects on HK-2 cells. HK-2 cells were treated with varying Ang II concentrations and durations to investigate the concentration- and time-dependent effects of Ang II on zyxin. Prior to Ang II exposure, HK-2 cells were pretreated with 5 μM Senexin A (S8520, Selleck, Houston, TX, USA) or 3 μM Pyr3 (GC14649, Glpbio, Montclair, TN, USA) for 24 hours to specifically inhibit CDK8 or TRPC3 activity in HK-2 cells.

[0051] (2) Cell interference

[0052] To overexpress or knockdown zyxin, HK-2 cells (Obio Technology, Shanghai, China) were transfected with lentivirus carrying either the overexpression zyxin (underlined portion of SEQ ID NO. 19) or a short hairpin RNA (shRNA) targeting zyxin (SEQ ID NO. 20: CAGTTCCAAGTCCAGTACCAA). The cells were also transfected with the corresponding control vectors according to the manufacturer's instructions. Transfection efficiency was assessed 48 hours later using fluorescence microscopy.

[0053] YAP was knocked down in cells using small interfering RNA (siRNA). HK-2 cells were seeded in 6-well plates and transfected with YAP-targeting siRNA (sense strand SEQ ID NO. 21: GGUCAAAGAUACUUCUUAATT; antisense strand SEQ ID NO. 22: UUAAGAAGUA UCUUUGACCTT) or control siRNA (Tsingke Biotechnology, Beijing, China) using Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA) in serum-free OPTI-MEM medium (Thermo Fisher, Waltham, MA, USA). After 4 hours, normal culture medium was restored for subsequent experiments.

[0054] 3. Immunohistochemical Staining

[0055] Mouse kidney tissue was dehydrated with graded ethanol, fixed with 4% formaldehyde, and embedded in paraffin. 4 μm thick sections were obtained and stained with HE and Masson's trichrome according to the manufacturer's instructions. Sections were incubated overnight at 4°C with the following primary antibodies: zyxin (1:200, ab109316, Abcam, Cambridge, MA, USA), CDK8 (1:200, 22067-1-AP, Proteintech, Rosemont, IL, USA), YAP (1:200, 14074, Cell Signaling Technology, Danvers, MA, USA), TRPC3 (1:200, ab300142, Abcam, Cambridge, MA, USA), collagen I (Col I) (1:800, GB11022-3, Servicebio, Wuhan, China), and α-smooth muscle actin (α-SMA) (1:200, BM0002, Boster, Wuhan, China). Sections were incubated with the corresponding secondary antibodies for 1 h at room temperature and then counterstained with hematoxylin and observed under a light microscope the next day.

[0056] 4. Immunofluorescence Staining

[0057] For tissue sections, paraffin-embedded sections (4 μm) were deparaffinized, made cell-permeable with 0.3% Triton X-100, and then treated with 5% bovine serum albumin for 1 hour at room temperature to block nonspecific binding. Sections were then incubated with the primary antibody overnight at 4°C. The following day, sections were incubated with the corresponding secondary antibody for 1 hour at 37°C in the dark. Cell nuclei were visualized by staining with DAPI (Beyotime, Shanghai, China) for 10 minutes.

[0058] HK-2 cells were cultured on slides and grown to 60% confluency. Cells were fixed with 4% PFA for 15 minutes, followed by the same permeabilization, fixation, incubation, and nuclear staining procedures as described above. The following primary antibodies were used for immunofluorescence staining: zyxin (1:200, ab109316, Abcam, Cambridge, MA, USA) and YAP (1:200, 14074, Cell Signaling Technology, Fosbury, MA, USA). Fluorescent images of tissues and cells were acquired using a confocal laser scanning microscope.

[0059] 5. Quantitative Real-time Polymerase Chain Reaction (qRT-PCR) Analysis

[0060] Total RNA was extracted from collected rat kidney tissue and HK-2 cells using TRIzol reagent (Servicebio, Wuhan, China), and its concentration and purity were measured spectrophotometrically. The extracted RNA was reverse transcribed into cDNA using the Prime Script RT Replication Kit (Vazyme, Nanjing, China). Quantitative PCR analysis was performed using SYBR Green Mix (Vazyme, Nanjing, China) according to the manufacturer's instructions.The primers used in this example are as follows: zyxin (human): forward: 5'-TCTCCCGCGATCTCCGTTT-3' (SEQ ID NO. 1), reverse: 5'-CCGAAGGGATTCACTTTGGG-3' (SEQ ID NO. 2); zyxin (mouse): forward: 5'-CCGATGATCGAGGAACCATTC-3' (SEQ ID NO. 3), reverse: 5'-CGTTCTTGGTCATGTCGTCCA-3' (SEQ ID NO. 4); YAP (human): forward: 5'-TAGCCCTGCGTAGCCAGTTA-3' (SEQ ID NO. 5), reverse: 5'-TCATGCTTAGTCCACTGTCTGT-3' (SEQ ID NO. 6); fibronectin (Fn) (human): forward: 5'-CGGTGGCTGTCAGTCAAAG-3' (SEQ ID NO. 7), reverse: 5'-AAACCTCGGCTTCCTCCATAA-3' (SEQ ID NO.8); Fn (mouse): forward primer: 5'-ATGTGGACCCCTCCTGATAGT-3' (SEQ ID NO.9), reverse primer: 5'-GCCCAGTGATTTCAGCAAAGG-3' (SEQ ID NO.10); Col I (human): forward primer: 5'-GAGGGCCAAGACGAAGACATC-3' (SEQ ID NO.11), reverse primer: 5'-CAGATCACGTCATCGCACAAC-3' (SEQ ID NO.12); Col I (mouse): forward primer: 5'-GCTCCTCTTAGGGGCCACT-3' (SEQ ID NO.13), reverse primer: 5'-ATTGGGGACCCTTAGGCCAT-3' (SEQ ID NO.14); α-SMA (human): forward primer: 5'-AAAAGACAGCTACGTGGGTGA-3' (SEQ ID NO.15), reverse primer: 5'-GCCATGTTCTATCGGGTACTTC-3' (SEQ ID NO.16); α-SMA (mouse): forward primer: 5'-CCCAGACATCAGGGAGTAATGG-3' (SEQ ID NO.17), reverse primer: 5'-TCTATCGGATACTTCAGCGTCA-3' (SEQ ID NO.18).

[0061] 6. Western blotting

[0062] Total protein was extracted from collected rat kidney tissue and HK-2 cells using RIPA isolation buffer (Beyotime, Shanghai, China), and protein concentration was determined using a BCA protein assay kit (Beyotime, Shanghai, China). Proteins were then separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (Merck Millipore, Billerica, MA, USA). After blocking nonspecific binding sites with 5% skim milk at room temperature for 1 hour, the membranes were incubated with primary antibodies overnight at 4°C and with corresponding secondary antibodies for 1 hour. The membranes were then detected using a chemiluminescence analyzer the following day. The primary antibodies used in this example are as follows: zyxin (1:5000, ab109316, Abcam, Cambridge, MA, USA), CDK8 (1:1000, 22067-1-AP, Proteintech, Rosemont, IL, USA), YAP (1:1000, 14074, Cell Signaling Technology, Darwinville, MA, USA), TRPC3 (1:500, DF13397, Affinity Biosciences, Melbourne, Australia), Fn (1:5000, F3648, Sigma-Aldrich, St. Louis, MO, USA), α-SMA (1:2000, 14395-1-AP, Proteintech, Rosemont, IL, USA), Col (1:1000, 14074, Cell Signaling Technology, Darwinville, MA, USA). I (1:2000, ab260043, Abcam, Cambridge, MA, USA), GAPDH (1:10000, 10494-1-AP, Proteintech, Rosemont, IL, USA). Western blot images were analyzed using ImageJ software (NIH, Bethesda, MD, USA).

[0063] To verify the induction effect of the mouse hypertension model, we monitored the tail artery systolic blood pressure (SBP) of the two groups of mice on days -14, 0, 7, and 21 after modeling. The results showed that from day 0, the SBP of HN mice was significantly higher than that of the control group ( Figure 1 A). In addition, Scr and BUN levels were significantly increased in HN mice ( Figure 1 BC). Subsequently, we assessed the degree of renal fibrosis by detecting the expression of fibrosis-related proteins Fn, Col I, and α-SMA, and analyzed changes in zyxin expression. Immunohistochemical staining showed increased expression of Col I and α-SMA in the renal interstitium of HN mice, and Masson staining further confirmed enhanced collagen fiber deposition ( Figure 1D). Western blot analysis showed that the protein levels of Fn, Col I, and α-SMA in the renal cortex of HN mice were significantly increased compared with the control group, while the protein level of zyxin was significantly decreased ( Figure 1 EF). Immunofluorescence staining results showed that zyxin was widely distributed in the renal tubules of normal mice, but was significantly reduced in HN mice ( Figure 1 G). These results suggest that hypertension can lead to downregulation of zyxin expression in renal tubules.

[0064] To investigate the effects of Ang II on renal tubular epithelial cell injury, we treated HK-2 cells with Ang II at different concentrations and durations. Western blot analysis revealed that, compared with the control group, 1 μM Ang II treatment for 24 hours significantly decreased zyxin protein levels in HK-2 cells, while also increasing the expression of fibrosis markers ( Figure 2 AB). qRT-PCR results showed that zyxin mRNA levels showed the same trend of change ( Figure 2 C), which is consistent with the results of in vivo experiments. Immunofluorescence staining showed that zyxin was mainly distributed in the cytoplasm of HK-2 cells. After Ang II stimulation, its expression intensity was weakened, but its localization did not change significantly ( Figure 2 D).

[0065] To clarify the role of zyxin in TIF caused by hypertension, we overexpressed zyxin by intrarenal injection of AAV carrying zyxin (AAV-OE-ZYX), using AAV-Flag as a negative control. Western blot and qRT-PCR results showed that the protein and mRNA levels of zyxin were significantly increased in the AAV-OE-ZYX group compared with the control group (only injected with the corresponding virus without other surgical procedures). Figure 3 AC). Although zyxin overexpression had no significant effect on SBP in HN mice ( Figure 3 D), but significantly reduced Scr and BUN levels ( Figure 3 EF). In addition, AAV-OE-ZYX treatment significantly inhibited the upregulation of fibrosis marker proteins in the kidneys of HN mice ( Figure 3 GH) Immunohistochemistry and Masson staining results showed that zyxin overexpression could inhibit the increase of Col I, α-SMA and collagen fiber deposition in the renal interstitium of HN mice ( Figure 3 I). These results indicate that zyxin overexpression can alleviate TIF induced by hypertension.

[0066] To investigate the effects of zyxin on HK-2 cells, we established HK-2 cells stably overexpressing zyxin (oeZYX) by lentiviral transfection in vitro and evaluated the transfection efficiency by Western blotting and qRT-PCR analysis ( Figure 4 AC). Western blot results showed that the increase of fibrotic markers induced by Ang II was suppressed in shZYX cells compared with oeZYX cells ( Figure 4 D, E). Subsequently, we transfected HK-2 cells with zyxin-targeting shRNA lentivirus to knock down zyxin (shZYX). The results showed that the protein and mRNA levels of zyxin in shZYX cells were significantly reduced compared with cells transfected with control RNA ( Figure 4 FH), and the protein levels of fibrosis markers induced by Ang II increased more significantly ( Figure 4 I, J).

[0067] Western blot results showed that YAP expression was significantly increased in hypertensive kidneys ( Figure 5 AB), and the YAP protein level in HK-2 cells stimulated by Ang II was also significantly increased ( Figure 5 CD). Immunofluorescence staining showed that Ang II enhanced the expression of YAP in the nucleus ( Figure 5 E). After knocking down YAP by siRNA, the mRNA level of YAP in HK-2 cells was significantly decreased ( Figure 5 F), while the increase of fibrosis-related proteins induced by Ang II was inhibited ( Figure 5 GH). These results indicate that hypertension can lead to upregulation of YAP in the kidney and promote TIF. Further studies found that zyxin overexpression significantly inhibited HN-mediated YAP upregulation ( Figure 5 IJ). In addition, Ang II-induced YAP upregulation was significantly attenuated in oeZYX cells ( Figure 5 These results indicate that zyxin is a negative regulator of YAP upregulation in HN, which may alleviate TIF by inhibiting YAP.

[0068] To investigate the regulatory effect of zyxin on the CDK8 / YAP signaling pathway in renal tubules under hypertension, we detected the expression of CDK8 in renal tubules. Western blot results showed that the CDK8 protein level in the kidney was significantly increased under hypertension ( Figure 6 AB), and Ang II treatment can induce increased expression of CDK8 in HK-2 cells ( Figure 6CD). Subsequently, we used Senexin A to target CDK8 in HK-2 cells. The results showed that after 24h pretreatment with 5μM Senexin A, the upregulation of fibrotic markers and increase in YAP induced by Ang II were effectively inhibited ( Figure 6 EF). In contrast, CDK8 expression was not affected after YAP knockdown ( Figure 6 GH). In addition, zyxin overexpression significantly inhibited the upregulation of CDK8 in the kidneys of HN mice ( Figure 6 IJ). In HK-2 cells overexpressing zyxin, Ang II-induced CDK8 upregulation was attenuated ( Figure 6 These results indicate that zyxin regulates YAP expression in HN by targeting CDK8.

[0069] Western blot showed that the TRPC3 protein level in the kidneys of HN mice was significantly increased compared with the control group ( Figure 7 AB). Immunohistochemistry results showed that TRPC3 was expressed in mouse renal tubules and its expression was upregulated in HN ( Figure 7 C), Ang II treatment can promote the expression of TRPC3 in HK-2 cells ( Figure 7 DE), suggesting that hypertension activates TRPC3. Further studies found that we pretreated HK-2 cells with 3μM Pyr3 (TRPC3 inhibitor) for 24 hours before Ang II stimulation. The results showed that inhibition of TRPC3 could reverse the effects of Ang II on zyxin, CDK8, and YAP ( Figure 7 FH), confirmed that activated TRPC3 regulates the zyxin / CDK8 / YAP signaling pathway in hypertensive kidneys.

[0070] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art shall fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of Zyxin protein, its encoding gene or a recombinant adenovirus containing the protein encoding gene in the preparation of products for treating renal interstitial fibrosis caused by hypertension.

2. The use according to claim 1, characterized in that The nucleotide sequence of the protein encoding gene is shown in SEQ ID NO.

19.

3. The use according to claim 1, characterized in that The product is a drug.

4. The use according to claim 3, characterized in that The zyxin protein is the only active ingredient in the drug.

5. The use according to claim 3, characterized in that The medicine is a pharmaceutical composition.

6. The use according to claim 4 or 5, characterized in that The medicine also contains a pharmaceutically acceptable carrier.

7. The use according to claim 1, characterized in that When the protein is the active ingredient of the product, the product also contains a protein stabilizer.

8. The use according to claim 1, characterized in that When the nucleic acid molecule containing the coding gene or the recombinant adenovirus is the active ingredient of the product, the product also contains a nucleic acid stabilizer.

9. The use according to claim 1, characterized in that The product is a pharmaceutical composition, which contains at least one auxiliary therapeutic agent in addition to the protein as a pharmaceutical active ingredient, the nucleic acid molecule containing the protein encoding gene, or the recombinant adenovirus containing the protein encoding gene.

10. The use according to any one of claims 1 to 5 or 7 to 9, characterized in that: The product is a medicine, and the dosage form of the medicine is a lyophilized preparation or an injection.

Images