Longissimus bifidobacterium longum subsp. alleviates pathological features of mice with chronic kidney disease induced by adenine

Abstract

The application discloses a Bifidobacterium longum subsp.longum strain for relieving pathological characteristics of mice with chronic kidney disease induced by adenine, and belongs to the technical fields of microorganisms and medicines.The application provides a biomarker combination related to end-stage renal disease of peritoneal dialysis, wherein the corresponding species abundance in the biomarker combination presents significant difference in matched healthy control population and peritoneal dialysis population, can effectively distinguish the end-stage renal disease population of peritoneal dialysis and the healthy population, and has high sensitivity and specificity.The application also provides a Bifidobacterium longum subsp.longum strain CCFM1375 capable of delaying the progression of renal failure, which can be used for preparing products for improving chronic kidney disease.

Description

Technical Field

[0001] This invention relates to a long subspecies of Bifidobacterium longum that targets gut microbiota to alleviate pathological features of adenine-induced chronic kidney disease in mice, belonging to the fields of microbial technology and pharmaceutical technology. Background Technology

[0002] Chronic kidney disease (CKD) leads to a gradual loss of kidney function, eventually progressing to end-stage renal disease (ESRD), clinically characterized by a glomerular filtration rate (GFR) <15 mL / min. It is a disease with a high incidence, poor prognosis, and complex complications, requiring lifelong drug treatment and placing a heavy burden on individuals and the socioeconomic system. End-stage renal disease patients require renal replacement therapy (RRT), including hemodialysis (HD), peritoneal dialysis (PD), and kidney transplantation. Currently, the total number of registered dialysis patients in my country is close to 880,000, and it is projected that by 2030, the global RRT population will increase to 5.439 million, with the most rapid growth in Asia. These data highlight the urgent need to understand the impact of dialysis on the body and to improve treatment methods to reduce disease complications and mortality.

[0003] In recent years, as the role of gut microbiota in diseases has been gradually discovered, attention has focused on new strategies targeting gut microbiota to intervene in host diseases. Existing research indicates that the progression of chronic kidney disease (CKD) and end-stage renal disease (ESRD) is closely related to the composition and function of the gut microbiota. Uremic toxins and their precursors, such as indole, indoleacetic acid, phenol, p-cresol, and trimethylamine, are metabolic products of gut microbiota. Further products, such as uremic toxins indolesulfonate, phenyl sulfate, p-cresol sulfate, and trimethylamine oxide, can lead to nephrotoxicity and promote the development of complications. Besides the impact of chronic kidney disease itself on the gut microbiota, common renal replacement therapy (RRT) therapies—hemodialysis and peritoneal dialysis—may also have further impacts on the human microbiota. However, compared to hemodialysis, research on the effects of peritoneal dialysis on the gut microbiota is relatively limited, especially in-depth exploration at the species level and in terms of microbial functional composition. Furthermore, existing research has failed to effectively adjust for differences in dietary and lifestyle habits between patients with renal failure and healthy individuals. Therefore, there is an urgent need to gain a deeper understanding of the impact of peritoneal dialysis on the gut microbiota and to reduce disease complications and mortality through improved treatment methods.

[0004] In summary, analyzing the impact of peritoneal dialysis on the gut microbiota of patients with end-stage renal disease (ESRD) can provide a more comprehensive understanding of the characteristics of the gut microbiota in patients with renal failure, and is expected to reveal the unique effects of peritoneal dialysis therapy at the microbial level. This will provide a foundation for discovering more precise gut microbiota intervention targets, thereby screening for probiotics or dietary factor combinations that can modulate such targets. This offers a safer and more efficient option for adjuvant treatment of ESRD and for slowing the progression of renal failure. Summary of the Invention

[0005] This invention studies the gut microbiota of end-stage renal disease patients undergoing peritoneal dialysis, and screens for biomarkers related to this disease. The biomarkers of this invention can effectively distinguish between end-stage renal disease patients undergoing peritoneal dialysis and healthy individuals, exhibiting high sensitivity and specificity. Based on *Bifidobacterium longum*, a strain of *Bifidobacterium longum* subsp. *longum* (CCFM1375) was discovered through animal experiments. This strain can reduce serum creatinine and blood urea nitrogen levels in mice with adenine-induced chronic kidney disease and slow the progression of renal fibrosis.

[0006] This invention provides a set of biomarkers, including *Bifidobacterium longum*, *Romboutsia timonensis*, *Clostridiales bacterium_KLE1615*, *Faecalibacterium prausnitzii*, *Anaerofustisstercorihominis*, *Lachnospira eligens*, *Clostridium butyricum*, *Phocaeicola dorei*, an unknown candidate bacterial species (*Candidatus Cibionibacter quicibialis*), *Tyzzerella nexilis*, *Roseburia faecalis*, *Clostridium symbiosum*, *Erysipelatoclostridium ramosum*, and *Bacteroides*. The biomarkers include *Cellulosilyticus*, *Bacteroides intestinalis*, and *Gemmigerformicilis*. This combination of biomarkers can effectively distinguish between end-stage renal disease patients undergoing peritoneal dialysis and healthy individuals, exhibiting high sensitivity and specificity.

[0007] This invention provides a strain of *Bifidobacterium longum* subsp. *longum* CCFM1375, characterized in that it was isolated from a fecal sample derived from an infant. Sequencing analysis of this strain, including 16S rRNA sequence comparison in GenBank, showed a 100% similarity to the nucleic acid sequence of *Bifidobacterium longum* subsp. *longum*, indicating that this strain belongs to the genus *Bifidobacterium* and is named *Bifidobacterium longum* subsp. *longum* CCFM1375. It has been deposited at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC No.: 64269).

[0008] In one embodiment of the present invention, the gut microbiota biomarker is derived from the subject's test sample, wherein the test sample includes the subject's feces and serum.

[0009] In one embodiment of the present invention, the raw sequences from metagenomic sequencing were quality controlled and host sequences removed using Trimmomatic (version 0.39), BWA (version 0.7.17), Samtools (version 1.9), and BEDTools (version 2.30.0). Metaphlan (version 4.0.6) was used to annotate the high-quality sequences after quality control and calculate their species composition and relative abundance, ultimately resulting in a species abundance table containing 1552 species.

[0010] In one embodiment of the present invention, the characteristic importance of each bacterium in the gut microbiota biomarker in distinguishing whether a subject has or is susceptible to end-stage renal disease is as follows: Bifidobacterium longum > Romboutsia timonensis > Clostridium kLE1615 > Faecalibacterium prausnitzii > Anaerofustis stercorihominis > Lachnospira eligens > Clostridium butyricum > Phocaeicola dorei > Unknown candidate bacterial species (Candidatus Cibionibacter quicibialis) > Clostridium tyzzerella nexilis) > Roseburia faecis > Clostridium symbiosum > Erysipelatoclostridium ramosum > Bacteroides cellulosilyticus, Bacteroides intestinalis > Gemmigerformicilis.

[0011] In one embodiment of the present invention, the present invention also provides the application of the above-mentioned biomarkers as targets for screening drugs to delay the progression of end-stage renal disease or as adjunctive treatment of end-stage renal disease. Specifically, the effects of candidate drugs on biomarkers before and after use are utilized to determine whether candidate drugs can be used to delay or as adjunctive treatment of end-stage renal disease.

[0012] In one embodiment, the growth characteristics of the Bifidobacterium longum subsp. longum CCFM1375 are as follows: This strain is a strict anaerobic bacterium, and when inoculated into the culture medium, it is cultured at 37°C for 24-36 hours in an anaerobic workstation.

[0013] In one embodiment of the present invention, the culture medium is MRS culture medium.

[0014] In one embodiment of the present invention, the formulation of the MRS culture medium is as follows: peptone 10 g / L, beef extract 10 g / L, yeast powder 5 g / L, anhydrous glucose 20 g / L, anhydrous sodium acetate 5 g / L, magnesium sulfate (MgSO4·7H2O) 0.1 g / L, manganese sulfate (MnSO4·H2O) 0.05 g / L, diammonium hydrogen citrate 2 g / L, dipotassium hydrogen phosphate (K2HPO4·3H2O) 2 g / L, and Tween 80 1 mL / L;

[0015] In one embodiment of the present invention, the culture medium is MRS culture medium.

[0016] In one embodiment of the present invention, the colony characteristics of Bifidobacterium longum subsp. longum CCFM1375 are as follows: on MRS solid medium, the colonies are milky white, glossy, with neat edges, round, and convex in the center.

[0017] This invention also provides products obtained using the aforementioned *Bifidobacterium longum* subsp. *longum* CCFM1375. These products include, but are not limited to, general foods, specialty foods, and pharmaceuticals.

[0018] In one embodiment of the present invention, the quantity of *Bifidobacterium longum* subsp. *longum* CCFM1375 in the product is not less than 5 × 10⁻⁶. 8 CFU / mL or 5×10 8 CFU / g.

[0019] In one embodiment of the present invention, the drug can be used to improve chronic kidney disease.

[0020] In one embodiment of the present invention, the drug has at least one of the effects of (a) to (c):

[0021] (a) Decrease serum creatinine levels

[0022] (b) Reduce serum urea nitrogen levels

[0023] (c) Delaying the progression of renal fibrosis

[0024] (d) Increase the expression levels of tight junction proteins ZO-2 and / or Claudin1 in colon tissue of individuals with chronic kidney disease;

[0025] (e) Reduce the expression level of pro-inflammatory factors in colon tissue of individuals with chronic kidney disease, said pro-inflammatory factors including at least one of TNF-α and IL-6;

[0026] Beneficial effects

[0027] 1. This invention, for the first time, analyzes the impact of peritoneal dialysis on the gut microbiota of patients with end-stage renal disease, identifying a combination of biomarkers associated with end-stage renal disease on peritoneal dialysis. The abundance of the corresponding species in the biomarker combination showed significant differences between matched healthy controls and peritoneal dialysis patients. ROC curve analysis results showed that this biomarker combination can effectively distinguish between end-stage renal disease patients on peritoneal dialysis and healthy individuals, exhibiting high sensitivity and specificity. Therefore, these species can be considered as potential therapeutic targets. Adjusting the abundance of these core species or introducing beneficial microorganisms may help improve the gut microbiota of patients, thereby positively impacting the disease and demonstrating good practical application value. Furthermore, these biomarkers can also be used to monitor changes in the patient's disease course. Observing changes in the gut microbiota can help assess treatment efficacy and guide the adjustment of treatment plans.

[0028] Specifically, this is reflected in:

[0029] (1) By integrating the results of three analytical methods—Wilcoxon rank-sum test, linear discriminant analysis (LefSe), and random forest model (RF)—16 core species associated with end-stage renal disease on peritoneal dialysis were identified. These core species exhibited excellent performance in the random forest model, with an AUC of 0.95 (95% confidence interval 0.80–0.95), a sensitivity of 0.83, and a specificity of 0.87. In the validation group experiments, the combination of core species still significantly demonstrated excellent diagnostic accuracy and specificity, with an AUC of 0.80 (95% confidence interval 0.71–0.94), a sensitivity of 0.73, and a specificity of 0.69. These results indicate that the biomarkers have high sensitivity and specificity, providing reliable biomarkers for the diagnosis, disease monitoring, and discovery of potential therapeutic targets for end-stage renal disease.

[0030] (2) There were differences in the overall gut microbiota structure between peritoneal dialysis patients and matched healthy controls; the following bacteria were observed: *Bifidobacterium longum*, *Romboutsia timonensis*, *Clostridiales bacterium_KLE1615*, *Faecalibacterium prausnitzii*, *Lachnospira eligens*, *Clostridium butyricum*, *Phocaeicola dorei*, *Candidatus Cibionibacter quicibialis*, *Roseburia faecis*, *Bacteroides cellulosilyticus*, and *Bacteroides enterica*. Intestinalis was significantly enriched in matched healthy controls, and its relative abundance was significantly negatively correlated with renal function indicators such as urea and creatinine levels, which can serve as a microbial biomarker for delaying the progression of renal failure.

[0031] (3) Fecal anaerobic bacteria (Anaerofustissterconhominis), symbiotic bacteria (Clostndium symbiosum), nexilis (Tyzzerella nexilis), symbiotic bacteria (Clostndium symbiosum), and ramosum (Erysipelatoclostndium ramosum) were significantly enriched in peritoneal dialysis patients. Their relative abundance was significantly positively correlated with renal function indicators such as urea and creatinine levels, and can be used as microbial biomarkers for aggravating renal failure.

[0032] 2. Based on the biomarkers discovered above, this invention verified through animal experiments the beneficial effect of *Bifidobacterium longum* subsp. *longum* CCFM1375 in delaying the progression of renal failure. The *Bifidobacterium longum* subsp. *longum* CCFM1375 provided by this invention significantly improved the renal pathological characteristics of mice with adenine-induced chronic kidney disease, specifically, compared with the model group:

[0033] (1) The serum creatinine level of mice with chronic kidney disease was significantly reduced from 58.22±17.39 μmol / L to 38.24±6.22 μmol / L, which was 34.32% lower than that of the model group.

[0034] (2) The serum urea nitrogen level in mice with chronic kidney disease was significantly reduced from 19.36±3.49 mmol / L to 13.99±3.18 mmol / L, which was 27.73% lower than that in the model group.

[0035] (3) The degree of renal fibrosis and renal tubular dilation in mice with chronic kidney disease were significantly improved.

[0036] (4) The collagen volume fraction in the kidney tissue of mice with chronic kidney disease was significantly reduced, and the degree of kidney fibrosis was significantly reduced, from 25.48±5.38% to 11.19±4.79%, which was 56.08% lower than that in the model group.

[0037] (5) The mRNA expression level of tight junction protein ZO-2 in the colon tissue of mice with chronic kidney disease was significantly increased to 1.26±0.18, which was 146.67% higher than that in the model group, and there was no significant difference from the blank group.

[0038] (6) The mRNA expression level of Claudin1, a tight junction protein in the colon tissue of mice with chronic kidney disease, was 0.34±0.14. Under the intervention of CCFM1375, the mRNA expression level of Claudin1 was significantly increased to 1.58±0.20, which was 369.70% higher than that of the model group, and there was no significant difference from the blank group.

[0039] (7) The mRNA expression level of the pro-inflammatory factor TNF-α in the colon tissue of mice with chronic kidney disease was significantly reduced to 1.58±0.56, which was 85.28% lower than that in the model group and there was no significant difference from the blank group.

[0040] (8) The mRNA expression level of the pro-inflammatory factor IL-6 in the colon tissue of mice with chronic kidney disease was significantly reduced to 1.30±0.75, which was 86.54% higher than that of the model group and there was no significant difference from the blank group.

[0041] Therefore, Bifidobacterium longum subsp. longum CCFM1375 has great application potential in the preparation of products that improve chronic kidney disease.

[0042] Preservation of biological materials

[0043] A strain of *Bifidobacterium longum* subsp. *longum*, CCFM1375, taxonomically named *Bifidobacterium longum* subsp. *longum*, was deposited on August 4, 2023, at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC No.: 64269), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, Institute of Microbiology. Attached Figure Description

[0044] Figure 1 α-diversity of gut microbiota in peritoneal dialysis patients and matched healthy controls.

[0045] Figure 2 β-diversity of gut microbiota in peritoneal dialysis patients and matched healthy controls.

[0046] Figure 3 Performance evaluation of seven classifier models based on gut microbiota species composition.

[0047] Figure 4 Venn diagrams of species obtained from three differential species selection methods.

[0048] Figure 5 Performance evaluation of the seven classifier models for core species.

[0049] Figure 6 ROC curve for testing and validating diagnostic capabilities of core species.

[0050] Figure 7 Correlation heatmap between core species and physiological indicators of kidney function.

[0051] Figure 8 Serum creatinine levels in mice from different experimental groups.

[0052] Figure 9 Serum urea nitrogen levels in mice from different experimental groups.

[0053] Figure 10 Results of H&E staining and Masson staining of kidney tissue from mice in different groups.

[0054] Figure 11 Statistical analysis of collagen volume fraction in kidney tissue of mice from different groups after Masson staining.

[0055] Figure 12 The mRNA expression levels of ZO-2 and Claudin1 in the colon tissue of mice in different groups.

[0056] Figure 13: mRNA expression levels of inflammatory factors TNF-α and IL-6 in the colon tissue of mice in different groups. Detailed Implementation

[0057] To uncover core species associated with end-stage renal disease on peritoneal dialysis, this invention collects samples from peritoneal dialysis patients and their corresponding healthy family members, performs metagenomic sequencing, and uses bioinformatics to statistically analyze the sequencing data to discover disease-related gut microbiota. By integrating gut microbiota with disease information, this invention maximizes the discovery of specific gut microbiota associated with end-stage renal disease on peritoneal dialysis. This invention, through metagenomic sequencing, has for the first time discovered the following bacteria: *Bifidobacterium longum*, *Romboutsia timonensis*, *Clostridialesbacterium_KLE1615*, *Faecalibacterium prausnitzii*, *Anaerofustis stercorihominis*, *Lachnospira eligens*, *Clostridium butyricum*, *Phocaeicola dorei*, an unknown candidate bacterial species (*Candidatus Cibionibacter quicibialis*), *C. nexilis*, *Roseburia faecalis*, *Clostridium symbiosum*, and *Erysipelatoclostridium*. The presence of *Bacteroides ramosum*, *Bacteroides cellulosilyticus*, *Bacteroides intestinalis*, and *Gemmigerformicilis* showed significant differences between peritoneal dialysis patients and matched healthy controls. ROC curve analysis showed that this core species combination could effectively distinguish between end-stage renal disease patients on peritoneal dialysis and healthy individuals, with high sensitivity and specificity. Therefore, these species can be used as diagnostic factors for end-stage renal disease on peritoneal dialysis.

[0058] The term "biomarker" should be interpreted broadly to include any detectable biological indicator that can reflect an abnormal state, including genetic markers, species markers (genus markers), and functional markers. The meaning of genetic markers is not limited to existing genes that can express and have biological activity as proteins, but also includes any nucleic acid fragment, which can be DNA or RNA, modified DNA or RNA, or unmodified DNA or RNA. In particular, the biomarkers of this invention are microbial biomarkers.

[0059] This invention can use a variety of nucleic acid and protein technologies known to those skilled in the art to detect the level of microbial biomarkers.

[0060] As used in this invention, the term "diagnosis" refers to the differentiation or identification of a disease, syndrome, or condition, or to the differentiation or identification of a person suffering from a specific disease, syndrome, or condition. In an illustrative embodiment of the invention, the end-stage renal disease status of a subject undergoing peritoneal dialysis is diagnosed based on the analysis of microbial biomarkers in a sample.

[0061] According to an embodiment of the present invention, the steps for identifying core species are as follows: (1) Sample collection and processing: fecal samples from peritoneal dialysis patients and their corresponding healthy family members are collected, and DNA is extracted using a kit to obtain nucleic acid samples; (2) Library construction and sequencing: DNA library construction and sequencing are performed using high-throughput sequencing to obtain nucleic acid sequences that distinguish the intestinal microorganisms contained in the samples; (3) Specific intestinal flora species associated with end-stage renal disease of peritoneal dialysis are identified through bioinformatics analysis methods. First, high-quality sequences are obtained by quality control and host removal of sequencing data. Then, species composition annotation and relative abundance calculation are performed on the high-quality sequences using Metaphlan4 to obtain a species relative abundance information table. Subsequently, the species relative abundance information table is analyzed through statistical tests, machine learning algorithms, correlation analysis, etc., and finally, specific intestinal flora species highly associated with end-stage renal disease of peritoneal dialysis are identified as diagnostic factors for end-stage renal disease of peritoneal dialysis.

[0062] The C57BL / 6 male mice used in the following examples were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., the adenine used for modeling was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., and the drug Haikun Shenxi used for the positive control group by gavage was produced by Jilin Huinan Changlong Biochemical Pharmaceutical Co., Ltd. Creatinine and blood urea nitrogen reagent kits were purchased from Nanjing Jiancheng Bioengineering Research Institute Co., Ltd.

[0063] The culture media involved in the following examples are as follows:

[0064] Peptone 10 g / L, beef extract 10 g / L, yeast powder 5 g / L, anhydrous glucose 20 g / L, anhydrous sodium acetate 5 g / L, magnesium sulfate (MgSO4·7H2O) 0.1 g / L, manganese sulfate (MnSO4·H2O) 0.05 g / L, diammonium hydrogen citrate 2 g / L, dipotassium hydrogen phosphate (K2HPO4·3H2O) 2 g / L, Tween 80 1 mL / L.

[0065] The following examples illustrate the culture of the strains involved:

[0066] Preparation of suspensions of *Bifidobacterium longum* subsp. *longum* CCFM1375 and *Bifidobacterium longum* subsp. *longum* FFREG2M23: *Bifidobacterium longum* subsp. *longum*... Subsp. longum) CCFM1375 and FFREG2M23 were inoculated into MRS liquid medium and cultured in an anaerobic workstation for 24-36 h. The bacterial suspension was then transferred to fresh MRS liquid medium at a 4% inoculation rate and cultured under the same conditions for 24 h. The cells were centrifuged at 8000 r / min for 15 min, washed with 0.9% physiological saline (containing 0.05% L-cysteine), and centrifuged again at 8000 r / min for 10 min. The cells were collected and resuspended in 30% glycerol solution (containing 0.05% L-cysteine) to prepare resuspensions, which were then frozen at -80℃ for later use. For gavage, the prepared resuspensions were removed from -80℃, centrifuged at 8000 r / min for 10 min at 4℃, the supernatant was discarded, and the cells were resuspended in 0.9% physiological saline and diluted to a viable count of 1 × 10⁻⁶. 9 CFU / mL was used to obtain a bacterial suspension for gavage.

[0067] Example 1: Overall Gut Microbiota Structure Analysis of Peritoneal Dialysis Patients and Healthy Family Members

[0068] 1. Sample collection

[0069] (1) Inclusion and exclusion criteria for study subjects

[0070] The subjects in this study were divided into two cohorts: the discovery cohort (for biomarker collection) consisted of 30 peritoneal dialysis patients (PD) and 30 healthy family members of each patient as matched control groups (FCON); the validation cohort (for biomarker validation) consisted of 39 peritoneal dialysis patients (PD) and 26 healthy controls (CON).

[0071] Table 1: Grouping Information of Study Subjects

[0072]

[0073] Inclusion criteria for peritoneal dialysis patients (PD):

[0074] 1) For patients clinically diagnosed with renal failure, GFR <15 mL / min is estimated using the Chronic Kidney Disease Epidemiological Collaborative Formula (CKD-EPI) equation;

[0075] 2) Peritoneal dialysis duration > 3 months;

[0076] 3) Age 18-60;

[0077] 4) Good compliance; able to follow clinical trial requirements and regulations;

[0078] 5) The patient or their family has signed a consent form for the subject.

[0079] The exclusion criteria for peritoneal dialysis patients (PD) are as follows:

[0080] Patients with malignant tumors, cirrhosis, intestinal surgery, irritable bowel syndrome, cardiovascular disease (defined as myocardial infarction, Q-wave recording on electrocardiogram, unstable angina, coronary artery stenosis >75%, congestive heart failure with ejection fraction <50%, and cerebrovascular disease), active infection; pregnant women or kidney transplant recipients; and other patients deemed unsuitable for the trial by a physician.

[0081] Inclusion criteria for the matched control group (FCON): normal renal function, family member of the patient, and age 20-65.

[0082] Exclusion criteria for the matched control group (FCON) included: hypertension, diabetes, obesity, metabolic syndrome, inflammatory bowel disease, cancer, abnormal liver or kidney function, and dyslipidemia. Individuals who had taken antibiotics within the past 30 days or probiotic products within the past 14 days were excluded.

[0083] Inclusion criteria for the general healthy control group (CON): normal renal function and age 20-65.

[0084] Exclusion criteria for the general healthy control group (CON) included: hypertension, diabetes, obesity, metabolic syndrome, inflammatory bowel disease, cancer, abnormal liver or kidney function, and dyslipidemia. Individuals who had taken antibiotics within the past 30 days or probiotic products within the past 14 days were also excluded.

[0085] All participants understood the background, purpose, and significance of the trial and provided handwritten informed consent forms.

[0086] (2) Sample collection

[0087] After an 8-hour fast, basic anthropometric and blood biochemistry results were collected from the patients. Fresh stool samples were collected simultaneously with blood collection and frozen at -80°C for metagenomic analysis.

[0088] 2. Sample processing and analysis

[0089] (1) Sample processing:

[0090] Metagenomic sequencing was performed on the DNBSEQ-T7 platform of Novogene Corporation in Beijing. The sample processing steps were as follows: First, genomic DNA was extracted using the QIAamp Fast DNA Stool Mini extraction kit to extract total genome from mouse feces. DNA purity and integrity were analyzed using 1% agarose gel electrophoresis (AGE). dsDNAAssay Kit in DNA was quantified using a 2.0 Flurometer (Life Technologies, CA, USA). An appropriate amount of sample was then placed in a centrifuge tube and diluted with sterile water to an OD value between 1.8 and 2.0. Library construction and sequencing: 1 μg of genomic DNA from the sample was used... Library construction was performed using the Ultra DNA Library Prep Kit for Illumina (NEB, USA). Fragments of approximately 350 bp in length were randomly broken down using a Covaris ultrasonic disruptor. The entire library preparation process included end repair, A-tailing, sequencing adapter addition, purification, and PCR amplification. After library construction, preliminary quantification was performed using Qubit 2.0, diluting the library to 2 ng / ul. The insert size was then measured using an Agilent 2100 scanner. Once the insert size met expectations, the effective concentration of the library was accurately quantified using Q-PCR (effective concentration > 3 nM) to ensure library quality. After passing the library quality check, different libraries were pooled according to their effective concentration and the target data volume requirements before DNBSEQ-T7 sequencing.

[0091] (2) Metagenomic sequencing and data processing

[0092] Preprocessing of the raw sequences included the following steps: Trimmomatic (version 0.39) was used to filter low-quality sequences. Sequences with an average base quality score below 30 were pruned, and sequences longer than 60 bp after filtering were retained as quality control output. Subsequently, BWA (version 0.7.17), Samtools (version 1.9), and BEDTools (version 2.30.0) were used to align the filtered sequences with the human reference genome (Homo sapiens genome assembly GRCh38, hg38) to effectively remove host genes from the samples.

[0093] Metaphlan (version 4.0.6) was used to annotate the species composition and calculate the relative abundance of the high-quality sequences after quality control, resulting in a species abundance information table containing 1552 species.

[0094] The richness and evenness of gut microbiota among peritoneal dialysis patients and their healthy family members were investigated using three alpha diversity indices: Pielou's Evenness, Simpson's, and Shannon's. Pielou's Evenness is a commonly used index for measuring species diversity. The Simpson's and Shannon's indices reflect species richness and evenness within the community. The Wilcoxon rank-sum test was used to compare alpha diversity between groups. Results are shown below. Figure 1 .

[0095] Compared with the matched control group, the three α-diversity indices of gut microbiota in the peritoneal dialysis population were significantly reduced, indicating a decrease in the evenness of species distribution and the overall diversity of the gut microbiota.

[0096] The differences in species distribution among different metagenomic samples were analyzed using statistical distance analysis. The Bray-Curtis distance was used for PCoA analysis, and the principal coordinates with the largest contribution rate were selected for plotting.

[0097] See results Figure 2 PCoA analysis revealed significant differences in the overall gut microbiota structure between the PD group and the CON group.

[0098] Example 2: Identification of core species in the gut microbiota of peritoneal dialysis patients

[0099] Based on the relative abundance table of species obtained from the Metaphlan species annotation in Example 1, a core species analysis of the gut microbiota of peritoneal dialysis patients was performed. The specific method for determining the core species is as follows:

[0100] (1) The Wilcoxon rank-sum test was used to analyze the species with significant changes in abundance between the two groups. Species with a p-value of <0.05 between the groups were considered as differential species.

[0101] (2) Linear discriminant analysis (LDA) was used to reduce the dimensionality of the data, obtain the most important influencing factors, and assess the influence of differentially expressed species. A p-value of <0.05 was set for inter-group differences, and the LDA threshold was set to 2; an LDA value greater than 2 was considered a differentially expressed species.

[0102] (3) Machine learning models were used to evaluate classification accuracy and identify key bacterial genera. Seven classifier models were employed: k-nearest neighbors (kNN), support vector machine (SVM), decision tree (DT), random forest (RF), gradient boosting regression tree (GB), extreme gradient boosting (XGB), and LightGBM (LGB) to model the relative abundance of gut microbiota in the two population groups to predict classification performance. Among these models, KNN, SVM, DT, RF, and GB were constructed using the scikit-learn package. XGB was constructed using the XGBoost package, and LGB was implemented using the LightGBM package. To reduce model overfitting and provide more accurate performance evaluation, 10-fold cross-validation and 5 repetitions were used. The area under the ROC curve (AUC) was selected as the model performance evaluation metric. Then, based on the evaluated AUC values, the classifier with the best classification performance was selected, feature importance was extracted and sorted in descending order, and the top 20 species were selected as candidate core species.

[0103] (4) Take the intersection of the differential species obtained in (1), (2) and (3) above to obtain the species common to the three methods, which are used as the core species of the intestinal flora of the peritoneal dialysis population. After applying the feature subset composed of the relative abundance of the above core species to each classifier, observe whether the classifier performance is improved, and extract the importance score of each species in the classifier with the best classification effect.

[0104] The results show:

[0105] Depend on Figure 3 It can be seen that among the various classifier models, the Random Forest (RF) model has the best classification performance for the two groups of people (AUC = 0.88). Therefore, the top 20 species with the highest feature importance based on the RF model will be selected as candidate core species. Figure 4 It can be seen that 184 differentially expressed species were obtained through the Wilcoxon rank-sum test and 105 differentially expressed species were obtained through the LefSe analysis. After taking the intersection of these two analyses with the top 20 species of importance in the RF model, 16 common differentially expressed species were finally obtained, which are as follows:

[0106] Bifidobacterium longum, Romboutsia timonensis, Clostridium bacterium KLE1615, Faecalibacterium prausnitzii, Anaerofustis stercorihominis, Lachnospira eligens, Clostridium butyricum, Phocaeicola dorei, Candidatus Cibionibacter quicibialis, Tyzzerella nexilis, Roseburia faecis, Clostridium symbiosum, Erysipelatoclostridium ramosum, Bacteroides *Cellulosilyticus*, *Bacteroides intestinalis*, and *Gemmigerformicilis* are core species in the gut microbiota of end-stage renal disease patients undergoing peritoneal dialysis. Figure 5 It can be seen that the feature subset composed of the relative abundance of the above 16 species can further improve the classification performance of the classifier (AUC≥0.84). Among them, the RF model is still the best performing model among the 7 models (AUC=0.95). The feature importance scores corresponding to each species are shown in Table 2. Bifidobacterium longum is the most important species feature among the 16 species for distinguishing between the two groups of people, with a feature importance score of 0.10166.

[0107] Table 2: Importance of Core Species Characteristics in the Gut Microbiota of Peritoneal Dialysis Patients

[0108]

[0109]

[0110] Example 3: Validation trial of the diagnostic value of the core species for end-stage renal disease on peritoneal dialysis

[0111] The subjects in the validation cohort of Example 1 (26 unmatched healthy controls and 39 PD individuals) were selected for a validation experiment to assess the diagnostic capabilities of the core species (Bifidobacterium longum, Rombutzella rommuno, Clostridium kLE1615, Clostridium plasmidonum, Corynebacterium fecalis, Eubacterium tumefaciens, Clostridium butyricum, C. marinerella vaginalis, unknown candidate bacterial species, Clostridium meliticum, Rosette, Clostridium symbioticum, Clostridium multiflorum, Bacteroides celluloseis, Bacteroides enterica, and Bacillus formic acid budding bacteria). The sample processing and analysis methods were the same as in Examples 1 and 2.

[0112] Metagenomic sequencing was performed on their feces to calculate the relative abundance of the 16 core species. Based on their abundance, ROC curves were used to analyze the results using the RF model. Figure 6 The diagnostic capability of the core species assemblage was calculated. The results are shown in Table 3 and... Figure 6 As shown.

[0113] Table 3. Results of the verification experiment

[0114]

[0115] As shown in Table 2:

[0116] In the discovery cohort, which matched the gut microbiota species of 30 healthy family members and 30 people with PD, the AUC of the core species was 0.95, the 95% confidence interval was 0.80-0.95, the sensitivity was 0.83, and the specificity was 0.87.

[0117] In the validation cohort, namely the gut microbiota species corresponding dataset of 26 unpaired healthy controls and 39 PD individuals, the AUC of the core species was 0.80, the 95% confidence interval was 0.71-0.94, the sensitivity was 0.73, and the specificity was 0.69.

[0118] The above results indicate that the core species disclosed in this invention can be used as biomarkers to determine whether a subject has or is susceptible to end-stage renal disease, with high accuracy and specificity. Furthermore, it can be used to monitor the treatment effects of patients with end-stage renal disease, providing a basis for finding potential drug targets.

[0119] Example 4: Correlation between core species and physiological indicators

[0120] The correlation between core species (Bifidobacterium longum, Rombutzella, Clostridium klebsiella KLE1615, Clostridium plasmidonum, Corynebacterium fecalis, Eubacterium tumefaciens, Clostridium butyricum, C. marinerella vaginalis, unknown candidate bacterial species, Clostridium meliticum, Rosella fecalis, Clostridium symbioticum, Clostridium multiflorum, Bacteroides celluloseis, Bacteroides enterica, and Formic acid budding bacteria) and renal function indicators creatinine, urea, and uric acid was analyzed using MaAsLin2 (Microbiome Multivariable Association with Linear Models). MaAsLin2 is a comprehensive R software package for efficiently determining multivariate associations between phenotypes, environment, exposure, covariates, and microbial tuple characteristics. Specific parameters for the analysis are as follows:

[0121] (1) Species with a popularity of less than 0.4 are filtered out. Popularity refers to the proportion or percentage of samples in the dataset that contain a certain species.

[0122] (2) Adjust for confounding factors: gender, age, and BMI;

[0123] (3) Retain the associations with p < 0.05 and coef (effect size) > 1, and draw the correlation heatmap.

[0124] The results are as follows Figure 7Among the core species, those significantly enriched in the CON group, including *Bifidobacterium longum*, *Romboutsia timonensis*, *Clostridialesbacterium_KLE1615*, *Faecalibacterium prausnitzii*, *Lachnospira eligens*, *Clostridium butyricum*, *Phocaeicola dorei*, unknown candidate bacterial species (*Candidatus Cibionibacter quicibialis*), *Roseburia faecis*, *Bacteroides cellulosilyticus*, and *Bacteroides intestinalis*, showed a significant negative correlation with urea and creatinine levels. Species significantly enriched in the PD group, such as *Anaerofustis*, showed a significant negative correlation with urea and creatinine levels. Clostridium sterconhominis, Clostridium symbiosum, Clostridium nexilis, Clostridium symbiosum, and Clostridium ramosum showed a significant positive correlation with urea nitrogen and creatinine levels.

[0125] The above results indicate that most of the core species that are significantly enriched in the CON population are significantly negatively correlated with renal function urea and creatinine levels, which may play a role in delaying the progression of renal failure.

[0126] In patients with chronic kidney disease (PD), the core species significantly enriched showed a significant positive correlation with renal function, specifically urea and creatinine levels, and an increase in their abundance may lead to worsening of renal failure. Among the core species significantly negatively correlated with urea and creatinine levels, *Bifidobacterium longum* has been shown in multiple studies to regulate intestinal function and alleviate diarrhea, constipation, and enteritis. *Bifidobacterium longum* subsp. *longum* and *Bifidobacterium longum* infantis subsp. *longum* are included in my country's "List of Microbial Strains that Can Be Used in Food." Therefore, this invention will use animal experiments to verify the effects of *Bifidobacterium longum* subsp. *longum* on the pathological characteristics of adenine-induced chronic kidney disease in mice.

[0127] Example 5: Screening and identification of Bifidobacterium longum subsp. longum CCFM1375

[0128] (1) Screening of Bifidobacterium longum subsp. longum CCFM1375:

[0129] Using fecal samples from newborns in Wuxi, Jiangsu Province, one spoonful of the sample was added to 5 mL of PBS (with 0.05% cysteine ​​added), mixed well, and serially diluted. A 10-fold dilution was selected. -5 ~10 -7 The serially diluted solutions were spread onto the above-mentioned MRS solid medium and incubated at 37°C for 48 h. Typical colonies were picked and streaked onto MRS solid medium for purification, and then incubated upside down in an anaerobic incubator at 37°C for 48 h. Several single colonies were picked and inoculated into 5 mL MRS liquid medium, and incubated at 37°C for 20 h. 1.5 mL of bacterial culture was centrifuged at 6000 r / min for 3 min to remove the supernatant, and 1 mL of 30% sterile glycerol was added for preservation. At the same time, 1.5 mL of bacterial culture was centrifuged, the supernatant was removed, and the culture was resuspended in sterile water for bacterial identification.

[0130] (1) Screening of Bifidobacterium longum subsp. longum FBREG2M23:

[0131] Using adult fecal samples from Wuxi, Jiangsu Province as samples, one spoonful of fecal sample was added to 5 mL of PBS (with 0.05% cysteine ​​added), mixed well, and serially diluted. A 10-fold dilution was selected. -5 ~10 -7 The serially diluted solutions were spread onto the above-mentioned MRS solid medium and incubated at 37°C for 48 h. Typical colonies were picked and streaked onto MRS solid medium for purification, and then incubated upside down in an anaerobic incubator at 37°C for 48 h. Several single colonies were picked and inoculated into 5 mL MRS liquid medium, and incubated at 37°C for 20 h. 1.5 mL of bacterial culture was centrifuged at 6000 r / min for 3 min to remove the supernatant, and 1 mL of 30% sterile glycerol was added for preservation. At the same time, 1.5 mL of bacterial culture was centrifuged, the supernatant was removed, and the culture was resuspended in sterile water for bacterial identification.

[0132] (3) Identification of strain species

[0133] The resuspended bacterial cells were subjected to genomic DNA extraction according to the FastDNA SPIN Kit for Feces instructions, which was then used as a PCR template. The genomic DNA was then amplified using the 16S rDNA amplification method described in Table 3 below.

[0134] Table 3.16 SrDNA amplification system

[0135]

[0136] The 16S rDNA sequence obtained from sequencing was compared with the nucleic acid sequence in GenBank. The results showed that the nucleic acid sequence similarity between Bifidobacterium longum subsp. longum CCFM1375 and Bifidobacterium longum subsp. longum was as high as 99.72%, and it was named Bifidobacterium longum subsp. longum CCFM1375.

[0137] The 16S rDNA sequence of *Bifidobacterium longum* subsp. *CCFM1375* is as follows:

[0138] GNNNNNNNCGCNTGCTACACATGCAGTCGAACGGGATCCATCAGGCTTTGCTTGGT

[0139] GGTGAGAGTGGCGAACGGGTGAGTAATGCGTGACCGACCTGCCCCATACACCGGAATA

[0140] GCTCCTGGAAACGGGTGGTAATGCCGGATGCTCCAGTTGATCGCATGGTCTTCTGGGAA

[0141] AGCTTTCGCGGTATGGGATGGGGTCGCGTCCTATCAGCTTGACGGCGGGGTAACGGCCC

[0142] ACCGTGGCTTCGACGGGTAGCCGGCCTGAGAGGGCGACCGGCCACATTGGGACTGAGA

[0143] TACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGC

[0144] CTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCG

[0145] GGGAGCAAGCGAGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGC

[0146] AGCCGCGGTAATACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCG

[0147] TAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGG

[0148] TACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGGTGTAACGGTGGAATG

[0149] TGTAGATATCGGGAAGAACACCAATGGCGAAGGCAGGTCTCTGGGCCGTTACTGACGCT

[0150] GAGGAGCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAA

[0151] ACGGTGGATGCTGGATGTGGGGCCCGTTCCACGGGTTCCGTGTCGGAGCTAACGCGTTA

[0152] AGCATCCCGCCTGGGGAGTACGGCCGCAAGGCTAAAACTCACAGAAATTGACCGGGGC

[0153] CCGCACAAGCGGCGGAGCATGCGGATTAATTCGATGCAACGCGAAGAACCTTACCTGGG

[0154] CTTGACATGTTCCCGACGGTCGTAGAGATACGCTTCCTTCGGGGCGGGTTCACAGGTGG

[0155] TGCATGGTCGTCGTCACCTCGTGTCGTGAGATGTTGAGTTAAGTCCGGCAACGAGCGCA

[0156] ACCGTCGCCCCTCTTGCCGCGGATTATGCCNGGAACTCACNGGGGACCGCCTGGCGTT

[0157] The sequence obtained from sequencing was compared with the nucleic acid sequence in GenBank. The results showed that the nucleic acid sequence similarity between Bifidobacterium longum subsp. longum and Bifidobacterium longum subsp. longum was as high as 98.86%, and it was named Bifidobacterium longum subsp. longum FFREG2M23.

[0158] Example 6: Culture of Bifidobacterium longum subsp. longum CCFM1375

[0159] Bifidobacterium longum subsp. longum CCFM1375 and Bifidobacterium longum subsp. longum FFREG2M23 were inoculated into MRS liquid medium in an anaerobic workstation and cultured for 24-36 h at 37℃ under anaerobic conditions to obtain bacterial suspension. The bacterial suspension was then transferred into fresh MRS liquid medium at an inoculation rate of 4% and cultured for 24 h at 37℃ under anaerobic conditions to obtain fermentation broth.

[0160] Centrifuge the fermentation broth at 8000 r / min for 15 min, wash the cells with 0.9% physiological saline (containing 0.05% L-cysteine), centrifuge again at 8000 r / min for 10 min, collect the cells, resuspend them in 30% glycerol solution (containing 0.05% L-cysteine), prepare resuspensions, and freeze them at -80℃ for later use.

[0161] Preparation of bacterial suspension for gavage: When administering *Bifidobacterium longum* subsp. *longum* (CCFM1375 and FBREG2M23) to mice via gavage, the prepared resuspensions were removed from -80℃, centrifuged at 4℃ and 8000 r / min for 10 min, the supernatant was discarded, and the suspensions were resuspended in 0.9% physiological saline to obtain a gavage concentration of 1×10⁻⁶. 9 CFU / mL bacterial suspension.

[0162] Example 7: Effect of Bifidobacterium longum subsp. longum CCFM1375 on serum creatinine levels in mice with adenine-induced chronic kidney disease.

[0163] The specific steps are as follows:

[0164] Six-week-old male SPF-grade C57BL / 6J mice were divided into four groups: blank control group, model group, experimental group, and positive control group. The mice were housed in the Experimental Animal Center of Jiangnan University under constant temperature of 21-26℃, humidity of 40-70%, noise level of ≤60dB, and animal illumination of 15-20LX (all animal experimental procedures were reviewed and approved by the Animal Welfare and Ethics Management Committee of Jiangnan University).

[0165] The experiment lasted for 10 weeks: Mice were first acclimatized for 7 days. Starting from the 8th day, the control group was given 0.5% sodium carboxymethyl cellulose solution by gavage daily, while the other groups were given 0.5% sodium carboxymethyl cellulose solution containing 0.5% adenine by gavage daily. The daily gavage volume for mice was 200 μL, and the gavage was continued for 4 weeks.

[0166] After the modeling was completed, the mice were kept in a quiet environment for one week, during which no gavage was administered.

[0167] During the intervention phase, the blank control group and the adenine model group were administered 200 μL of normal saline by gavage daily; the positive control group was administered 200 μL of normal saline containing 150 mg / kg of Haikun Shenxi by gavage daily for 4 consecutive weeks; the CCFM1375 group was administered 1×10 mg / kg of the drug by gavage daily. 9 CFU / mL bacterial suspension was administered via gavage in volumes of 200 μL for 4 consecutive weeks; the FFREG2M23 group received 1×10 μL of CFU / mL bacterial suspension daily via gavage. 9 CFU / mL bacterial suspension was administered via gavage in volumes of 200 μL for 4 consecutive weeks.

[0168] The animal experiment groups are shown in Table 4.

[0169] Table 4: Animal Grouping Information

[0170]

[0171]

[0172] After the experiment, blood was collected from the eyes of mice and allowed to stand at room temperature for more than one hour before centrifugation to separate the serum. The concentration of creatinine in the mouse serum was determined according to the instructions of the serum creatinine assay kit.

[0173] Serum creatinine concentrations are shown in Figure 8 .Depend on Figure 8Quantitative results showed that the creatinine concentration in the blank group was 10.51±1.81 μmol / L, while the creatinine concentration in the model group was 58.22±17.39 μmol / L. Under CCFM1375 intervention, the creatinine concentration significantly decreased to 38.24±6.22 μmol / L, a reduction of 34.32% compared to the model group. After FBREG2M23 intervention, the creatinine concentration was 49.33±3.30 μmol / L, a reduction of only 15.26% compared to the model group. After Haikun Shenxi intervention, the creatinine concentration also significantly decreased to 40.26±9.46 μmol / L, but this reduction was only 30.50% compared to the model group.

[0174] The results above indicate that *Bifidobacterium longum subsp. longum* CCFM1375 is more effective in reducing serum creatinine levels in mice with chronic kidney disease.

[0175] Example 8: Effect of Bifidobacterium longum subsp. longum CCFM1375 on serum urea nitrogen levels in adenine-induced chronic kidney disease mice

[0176] The specific steps are as follows:

[0177] Six-week-old male SPF-grade C57BL / 6J mice were divided into four groups: blank control group, model group, experimental group, and positive control group. The mice were housed in the Experimental Animal Center of Jiangnan University under constant temperature of 21-26℃, humidity of 40-70%, noise level of ≤60dB, and animal illumination of 15-20LX (all animal experimental procedures were reviewed and approved by the Animal Welfare and Ethics Management Committee of Jiangnan University).

[0178] The experiment lasted for 10 weeks: Mice were first acclimatized for 7 days. Starting from the 8th day, the control group was given 0.5% sodium carboxymethyl cellulose solution by gavage daily, while the other groups were given 0.5% sodium carboxymethyl cellulose solution containing 0.5% adenine by gavage daily. The daily gavage volume for mice was 200 μL, and the gavage was continued for 4 weeks.

[0179] After the modeling was completed, the mice were kept in a quiet environment for one week, during which no gavage was administered.

[0180] During the intervention phase, the blank control group and the adenine model group were administered 200 μL of normal saline by gavage daily; the positive control group was administered 200 μL of normal saline containing 150 mg / kg of Haikun Shenxi by gavage daily for 4 consecutive weeks; the CCFM1375 group was administered 1×10 mg / kg of the drug by gavage daily. 9 CFU / mL bacterial suspension was administered via gavage in volumes of 200 μL for 4 consecutive weeks; the FFREG2M23 group received 1×10 μL of CFU / mL bacterial suspension daily via gavage. 9CFU / mL bacterial suspension was administered via gavage in volumes of 200 μL for 4 consecutive weeks.

[0181] The animal experiment groups are shown in Table 4.

[0182] Table 4: Animal Grouping Information

[0183]

[0184]

[0185] After the experiment, blood was collected from the eyes of mice and allowed to stand at room temperature for more than one hour before centrifugation to separate the serum. The concentration of blood urea nitrogen in the mouse serum was determined according to the instructions of the serum creatinine assay kit.

[0186] Serum urea nitrogen concentrations are shown in Figure 9 .Depend on Figure 9 Quantitative results showed that the blood urea nitrogen (BUN) concentration in the control group was 9.37±0.76 mmol / L, while that in the model group was 19.36±3.49 mmol / L. Under CCFM1375 intervention, the BUN concentration significantly decreased to 13.99±3.18 mmol / L, a reduction of 27.73% compared to the model group. After FBREG2M23 intervention, the BUN concentration was 16.36±1.89 mmol / L, a reduction of only 15.50% compared to the model group. After Haikun Shenxi intervention, the BUN concentration also significantly decreased to 14.91±2.52 mmol / L, but this reduction was only 22.99% compared to the model group.

[0187] The results above indicate that *Bifidobacterium longum subsp. longum* CCFM1375 is more effective in reducing serum urea nitrogen levels in mice with chronic kidney disease.

[0188] Example 9: Effects of Bifidobacterium longum subsp. longum CCFM1375 on renal damage and the degree of renal interstitial fibrosis in adenine-induced chronic kidney disease mice.

[0189] The specific steps are as follows:

[0190] Six-week-old male SPF-grade C57BL / 6J mice were divided into four groups: blank control group, model group, experimental group, and positive control group. The mice were housed in the Experimental Animal Center of Jiangnan University under constant temperature of 21-26℃, humidity of 40-70%, noise level of ≤60dB, and animal illumination of 15-20LX (all animal experimental procedures were reviewed and approved by the Animal Welfare and Ethics Management Committee of Jiangnan University).

[0191] The experiment lasted for 10 weeks: Mice were first acclimatized for 7 days. Starting from the 8th day, the control group was given 0.5% sodium carboxymethyl cellulose solution by gavage daily, while the other groups were given 0.5% sodium carboxymethyl cellulose solution containing 0.5% adenine by gavage daily. The daily gavage volume for mice was 200 μL, and the gavage was continued for 4 weeks.

[0192] After the modeling was completed, the mice were kept in a quiet environment for one week, during which no gavage was administered.

[0193] During the intervention phase, the blank control group and the adenine model group were administered 200 μL of normal saline by gavage daily; the positive control group was administered 200 μL of normal saline containing 150 mg / kg of Haikun Shenxi by gavage daily for 4 consecutive weeks; the CCFM1375 group was administered 1×10 mg / kg of the drug by gavage daily. 9 CFU / mL bacterial suspension was administered via gavage in volumes of 200 μL for 4 consecutive weeks; the FFREG2M23 group received 1×10 μL of CFU / mL bacterial suspension daily via gavage. 9 CFU / mL bacterial suspension was administered via gavage in volumes of 200 μL for 4 consecutive weeks.

[0194] The animal experiment groups are shown in Table 4.

[0195] Table 4: Animal Grouping Information

[0196]

[0197] After the experiment, the mice were dissected in accordance with ethical requirements. The right kidney of the mouse was fixed in 4% paraformaldehyde solution for 36 hours. After being dehydrated by ethanol gradient, cleared with xylene, embedded in paraffin, sectioned and stained with H&E and Masson, the cross-sectional view of the kidney was observed.

[0198] Kidney slices Figure 10 As shown in the results of HE and Masson staining of the kidneys, the glomeruli in the control group mice were evenly distributed, with uniform cell number and matrix. The tubular epithelial cells were round and plump, with neat and regular brush borders. There was no obvious interstitial proliferation and no obvious inflammatory changes. In the model group mice, the kidney tissue showed extensive mild fibrosis, interstitial connective tissue proliferation, extensive tubular dilation, irregular tubular shape, flattened epithelium, degeneration of many tubular epithelial cells, loose and pale cytoplasm, and extensive collagen fiber deposition. Under the intervention of CCFM1375 and Haikun Kidney-Soothing Agent, the degree of renal fibrosis and tubular dilation were significantly improved compared with the model group.

[0199] like Figure 11As shown, quantitative analysis of fibrosis area based on Masson staining of kidney tissue revealed that the collagen volume fraction in the kidney tissue of the blank group was 5.44±3.42%, while that in the model group was 25.48±5.38%. CCFM1375 intervention significantly reduced the collagen volume fraction in mouse kidney tissue to 11.19±4.79%, a decrease of 56.08% compared to the model group. FBREG2M23 intervention significantly reduced the collagen volume fraction in mouse kidney tissue to 21.60±4.26%, a decrease of only 15.23% compared to the model group. Haikun Shenxi intervention also significantly reduced the collagen volume fraction in mouse kidney tissue to 17.42±6.64%, but this was only a decrease of 31.63% compared to the model group.

[0200] The results above indicate that Bifidobacterium longum subsp. longum CCFM1375 is more effective in reducing kidney damage and alleviating renal interstitial fibrosis and renal cell apoptosis.

[0201] Example 10: Effects of Bifidobacterium longum subsp. longum CCFM1375 on tight junction proteins in colon tissue of adenine-induced chronic kidney disease mice.

[0202] The specific steps are as follows:

[0203] Six-week-old male SPF-grade C57BL / 6J mice were divided into four groups: blank control group, model group, experimental group, and positive control group. The mice were housed in the Experimental Animal Center of Jiangnan University under constant temperature of 21-26℃, humidity of 40-70%, noise level of ≤60dB, and animal illumination of 15-20LX (all animal experimental procedures were reviewed and approved by the Animal Welfare and Ethics Management Committee of Jiangnan University).

[0204] The experiment lasted for 10 weeks: Mice were first acclimatized for 7 days. Starting from the 8th day, the control group was given 0.5% sodium carboxymethyl cellulose solution by gavage daily, while the other groups were given 0.5% sodium carboxymethyl cellulose solution containing 0.5% adenine by gavage daily. The daily gavage volume for mice was 200 μL, and the gavage was continued for 4 weeks.

[0205] After the modeling was completed, the mice were kept in a quiet environment for one week, during which no gavage was administered.

[0206] During the intervention phase, the blank control group and the adenine model group were administered 200 μL of normal saline by gavage daily; the positive control group was administered 200 μL of normal saline containing 150 mg / kg of Haikun Shenxi by gavage daily for 4 consecutive weeks; the CCFM1375 group was administered 1×10 mg / kg of the drug by gavage daily. 9CFU / mL bacterial suspension was administered via gavage in volumes of 200 μL for 4 consecutive weeks; the FFREG2M23 group received 1×10 μL of CFU / mL bacterial suspension daily via gavage. 9 CFU / mL bacterial suspension was administered via gavage in volumes of 200 μL for 4 consecutive weeks.

[0207] The animal experiment groups are shown in Table 4.

[0208] Table 4: Animal Grouping Information

[0209]

[0210]

[0211] After the experiment, mice were dissected according to ethical requirements. Colon tissue was collected and weighed, and total RNA was extracted from the colon tissue using Trizol reagent for reverse transcription. The relative cDNA content was analyzed using a ChamQ SYBR qPCRMasterMix quantitative real-time PCR thermal cycler. (The last sentence appears to be incomplete and possibly refers to a different process.) -ΔΔCT Calculate the ZO-2 and Claudin1 contents normalized to β-actin.

[0212] The accumulation of uremic toxins in patients with renal failure is one of the causes of intestinal barrier damage. Bacterial translocation and uremic toxin translocation resulting from intestinal barrier damage can exacerbate systemic inflammation and uremic symptoms in patients with renal failure. Tight junction proteins are important components of the intestinal barrier; currently, the most studied tight junction proteins are ZO-1, ZO-2, Claudin1, and occludin. The mRNA expression levels of ZO-2 and Claudin1 in colonic tissue are shown in […]. Figure 12 .

[0213] Depend on Figure 12 The quantitative results of B showed that the mRNA expression level of ZO-2 in the model group was 0.51±0.13. Under CCFM1375 intervention, the mRNA expression level of ZO-2 significantly increased to 1.26±0.18, an increase of 146.67% compared to the model group, and there was no significant difference compared to the blank group. After intervention with FFREG2M23 and Haikun Shenxi, the mRNA expression levels of ZO-2 were 0.86±0.04 and 0.29±0.06, respectively, an increase of only 68.63% and -43.14% compared to the model group.

[0214] Depend on Figure 12The quantitative results of A in the study showed that the mRNA expression level of Claudin1 in the model group was 0.34±0.14. Under CCFM1375 intervention, the mRNA expression level of Claudin1 significantly increased to 1.58±0.20, an increase of 369.70% compared to the model group, and there was no significant difference compared to the blank group. After intervention with FFREG2M23 and Haikun Shenxi, the mRNA expression levels of Claudin1 were 0.84±0.17 and 1.11±0.23, respectively, representing increases of only 148.60% and 229.17% compared to the model group.

[0215] Therefore, CCFM1375 can more effectively promote the mRNA expression of tight junction proteins ZO-2 and Claudin1 in colon tissue.

[0216] Example 10: Effects of Bifidobacterium longum subsp. longum CCFM1375 on tight junction proteins in colon tissue of adenine-induced chronic kidney disease mice.

[0217] The specific steps are as follows:

[0218] Six-week-old male SPF-grade C57BL / 6J mice were divided into four groups: blank control group, model group, experimental group, and positive control group. The mice were housed in the Experimental Animal Center of Jiangnan University under constant temperature of 21-26℃, humidity of 40-70%, noise level of ≤60dB, and animal illumination of 15-20LX (all animal experimental procedures were reviewed and approved by the Animal Welfare and Ethics Management Committee of Jiangnan University).

[0219] The experiment lasted for 10 weeks: Mice were first acclimatized for 7 days. Starting from the 8th day, the control group was given 0.5% sodium carboxymethyl cellulose solution by gavage daily, while the other groups were given 0.5% sodium carboxymethyl cellulose solution containing 0.5% adenine by gavage daily. The daily gavage volume for mice was 200 μL, and the gavage was continued for 4 weeks.

[0220] After the modeling was completed, the mice were kept in a quiet environment for one week, during which no gavage was administered.

[0221] During the intervention phase, the blank control group and the adenine model group were administered 200 μL of normal saline by gavage daily; the positive control group was administered 200 μL of normal saline containing 150 mg / kg of Haikun Shenxi by gavage daily for 4 consecutive weeks; the CCFM1375 group was administered 1×10 mg / kg of the drug by gavage daily. 9 CFU / mL bacterial suspension was administered via gavage in volumes of 200 μL for 4 consecutive weeks; the FFREG2M23 group received 1×10 μL of CFU / mL bacterial suspension daily via gavage. 9 CFU / mL bacterial suspension was administered via gavage in volumes of 200 μL for 4 consecutive weeks.

[0222] The animal experiment groups are shown in Table 4.

[0223] Table 4: Animal Grouping Information

[0224]

[0225] After the experiment, mice were dissected according to ethical requirements. Colon tissue was collected and weighed, and total RNA was extracted from the colon tissue using Trizol reagent for reverse transcription. The relative cDNA content was analyzed using a ChamQ SYBR qPCRMasterMix quantitative real-time PCR thermal cycler. (The last sentence appears to be incomplete and possibly refers to a different process.) -ΔΔCT Calculate the levels of TNF-α and IL-6 normalized to β-actin.

[0226] Depend on Figure 13 The quantitative results of A showed that the mRNA expression level of TNF-α in the model group was 10.2±03.85. Under CCFM1375 intervention, the mRNA expression level of TNF-α was significantly reduced to 1.58±0.56, a decrease of 85.28% compared to the model group, and there was no significant difference compared to the blank group. After intervention with FFREG2M23 and Haikun Shenxi, the mRNA expression levels of TNF-α were 4.78±0.90 and 2.12±0.77, respectively, a decrease of only 53.10% and 79.18% compared to the model group.

[0227] Depend on Figure 13 The quantitative results of B showed that the mRNA expression level of IL-6 in the model group was 9.63±2.90. Under CCFM1375 intervention, the mRNA expression level of IL-6 was significantly reduced to 1.30±0.75, an increase of 86.54% compared with the model group, and there was no significant difference compared with the blank group. After intervention with FFREG2M23 and Haikun Shenxi, the mRNA expression levels of IL-6 were 4.75±0.51 and 3.06±0.68, respectively, a decrease of only 50.67% and 68.29% compared with the model group.

[0228] Therefore, CCFM1375 can more effectively reduce the mRNA expression levels of pro-inflammatory factors TNF-α and IL-6 in colon tissue.

[0229] Example 11: Application of Bifidobacterium longum subsp. longum CCFM1375

[0230] (1) Preparation of powder containing Bifidobacterium longum subsp. CCFM1375

[0231] The specific steps are as follows:

[0232] Preparation of seed culture of Bifidobacterium longum subsp. CCFM1375: Bifidobacterium longum subsp. CCFM1375 was inoculated into MRS liquid medium and cultured at 37℃ under anaerobic conditions for 24-36 h to prepare Bifidobacterium longum subsp. CCFM1375.

[0233] The seed culture of Bifidobacterium longum subsp. CCFM1375 was inoculated into MRS medium at an inoculation rate of 3% of the total mass of the medium and cultured at 37℃ for 30 h under anaerobic conditions to obtain the culture medium.

[0234] Centrifuge the culture medium and collect the bacterial cells; wash the bacterial cells three times with phosphate buffer at pH 7.2 and then resuspend them in 100 g / L trehalose lyophilization protectant, controlling the mass ratio of lyophilization protectant to bacterial cells to be 2:1 to obtain the resuspended solution.

[0235] The resuspended solution was pre-cooled at -80℃ for 1.5 hours and then immediately transferred to a freeze dryer to dry for 24 hours to obtain Bifidobacterium longum subsp. CCFM1375 bacterial powder.

[0236] (2) Preparation of yogurt containing Bifidobacterium longum subsp. CCFM1375

[0237] The specific steps are as follows:

[0238] Milk powder, inulin, stevia, and water were mixed in a weight ratio of 20:5:5:75, homogenized, and used as the fermentation raw material. The mixture was then sterilized at 121℃ for 300 seconds, cooled to 42℃, and inoculated with a mixed inoculum of *Lactobacillus bulgaricus* and *Streptococcus thermophilus*. Fermentation was carried out at 42℃ for 12 hours, with the bacterial concentration of *Lactobacillus bulgaricus* and *Streptococcus thermophilus* controlled at 10⁻⁶. 5 CFU / g and 10 7 CFU / g, then adjust; cool the fermentation product to 37°C;

[0239] Add the freeze-dried *Bifidobacterium longum* subsp. *CFM1375* bacterial powder prepared according to method (1) to the cooled fermentation product. The amount of freeze-dried *Bifidobacterium longum* subsp. *CFM1375* bacterial powder added is 10. 9 CFU / mL yogurt is stirred, bottled, and stored at 4℃ for 2 days to naturally mature, thus producing probiotic yogurt.

[0240] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A strain of Bifidobacterium longum subsp. ( Bifidobacterium longum subsp.longum CCFM1375 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on January 11, 2024, with accession number GDMCC No: 64269.

2. A microbial preparation, characterized in that, The microbial preparation contains the long subspecies of Bifidobacterium longum as described in claim 1, CCFM1375.

3. The microbial preparation according to claim 2, characterized in that, The number of *Bifidobacterium longum* subsp. *CCFM1375* cells is not less than 5 × 10⁻⁶. 8 CFU / mL or 5×10 8 CFU / g.

4. A pharmaceutical product containing the long subspecies of Bifidobacterium longum CCFM1375 as described in claim 1.

5. The medicine according to claim 4, characterized in that, The dosage forms of the medicine include granules, capsules, tablets, pills, or oral liquids.

6. The use of the Bifidobacterium longum subsp. CCFM1375 as described in claim 1 or the microbial preparation as described in claim 2 in the preparation of a medicament for treating and / or alleviating chronic kidney disease.

Images