Primer probe combination for detecting methylation double sites of colorectal cancer and kit thereof

By combining primer and probe combinations for SDC2 and LIFR two-site detection and using molecular hybridization capture technology, the problem of low sensitivity in colorectal cancer screening has been solved, achieving high sensitivity and high specificity for early screening, which is suitable for early colorectal cancer screening of fecal samples.

CN116200493BActive Publication Date: 2026-06-02CHONGQING BOHAO DIAGNOSTIC TECH CO LTD +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHONGQING BOHAO DIAGNOSTIC TECH CO LTD
Filing Date
2022-12-13
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing colorectal cancer screening methods have low sensitivity, high false negative rates for single methylation site detection, and lack highly sensitive and specific combined detection methods.

Method used

A primer-probe combination for joint detection of SDC2 and LIFR sites was used, combined with molecular hybridization capture and multiplex fluorescent PCR technology, to detect the methylation sites cg08392199 of the LIFR gene and cg13096260 of the SDC2 gene in fecal samples. The target genes were captured by probe specificity and analyzed by real-time fluorescent PCR.

Benefits of technology

It achieves high sensitivity (92%) and high specificity (100%) in colorectal cancer detection, providing a high-sensitivity and high-specificity early screening method. It is fast, easy to operate, and low-cost, making it suitable for early colorectal cancer screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116200493B_ABST
    Figure CN116200493B_ABST
Patent Text Reader

Abstract

The application discloses a primer probe combination for detecting methylation of two sites of colorectal cancer and a kit thereof. The primer probe combination is a primer probe combination for detecting methylation of a cg08392199 site of a LIFR gene and a primer probe combination for detecting methylation of a cg13096260 site of a SDC2 gene; the methylation of the cg08392199 site of the LIFR gene and the cg13096260 site of the SDC2 gene is correlated with colorectal cancer. The kit comprises the primer probe combination. The application adopts combined detection of the two sites of SDC2 and LIFR for the first time, has innovation, and the sensitivity of combined detection of the two sites in the detection of colorectal cancer reaches 92%, and the specificity is as high as 100%, thereby providing a primer probe combination for early screening of colorectal cancer with high sensitivity and high specificity and a kit.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and DNA detection technology, and relates to a primer-probe combination and kit for the detection of dual methylation sites in colorectal cancer. Background Technology

[0002] Colorectal cancer (CRC) is one of the most common malignant tumors. According to the latest global cancer data released by the International Agency for Research on Cancer (IARC) of the World Health Organization in 2020, colorectal cancer ranked third in new cases and second in cancer deaths worldwide in 2020. In 2020, my country had 19.29 million new cancer cases, of which colorectal cancer accounted for 560,000 cases, second only to lung cancer, representing 12.2% of all new cancer cases.

[0003] Colorectal cancer has relatively clear staging and is one of the few cancers that can potentially be prevented through screening. Colorectal cancer has an insidious onset, a long course, and a clearly defined precancerous stage; it typically takes about 10 years for a polyp to develop into an adenoma. Stages 0 to II are the golden stage for colorectal cancer diagnosis. Asymptomatic patients can be screened for precancerous adenomas, which can be completely cured through surgical resection. The 5-year survival rate for early-stage (0 / I) colorectal cancer patients can reach over 90%. Late-stage cancer requires surgical treatment, which has poor efficacy and a high risk of recurrence. The 5-year survival rate for late-stage (IV) colorectal cancer patients is less than 10%.

[0004] However, the screening results for colorectal cancer in my country are not ideal. According to the "Expert Consensus on Early Diagnosis and Treatment of Colorectal Cancer in China (2020)," the level of diagnosis and treatment varies greatly among different regions and hospitals in China. The overall proportion of patients diagnosed with early-stage colorectal cancer is about 20-30%, and most patients are already in the middle or late stages when diagnosed.

[0005] Besides a general lack of awareness about screening, the lack of effective screening methods is also one of the reasons for the low screening penetration rate. The gold standard of colonoscopy has low availability, low patient compliance, and insufficient screening rates. Methods such as fecal occult blood testing (FOBT) and fecal immunochemical assay (FIT) have low sensitivity, with a sensitivity of only 20-25% for advanced polyps.

[0006] In recent years, numerous new technologies have provided new non-invasive methods for popularizing early colorectal cancer screening. These mainly include blood and fecal DNA testing. However, blood testing has significant limitations; in early-stage intestinal lesions proliferate outwards, making it difficult for diseased cells to enter the bloodstream. Although Septin9 methylation testing was recommended as a screening method in the 2014 edition of the "Guidelines for Early Colorectal Cancer Screening and Endoscopic Diagnosis and Treatment in China (2014)," its sensitivity is not ideal. Fecal testing, on the other hand, has significantly higher sensitivity and specificity than traditional methods and is currently considered the most ideal detection method.

[0007] Methylation sites associated with colorectal cancer pathogenesis are important indicators in fecal testing. Currently available products utilize sites such as KRAS, SDC2, and SRFP2. While their overall specificity and sensitivity are higher than traditional methods, the false negative rate for individual site detection is high, leading to missed detections. Combined site detection can improve sensitivity while maintaining specificity. For example, patent CN 112553302 A describes a sensitivity of 86.9% and a specificity of 95.9% for the SDC2 site in colorectal cancer, and a sensitivity of 90.3% and a specificity of 94.0% for the TFPI2 site; the combined detection effect is unknown. This invention provides a novel combined detection site combination of SDC2 and LIFR, which not only has good individual detection effects but also exhibits high sensitivity and specificity when used together for colorectal cancer detection.

[0008] The multiligand proteoglycan 2 (Syndecan-2, SDC2) gene is located on human chromosome 8 and encodes the Syndecan-2 protein. Studies have found that this protein mediates functions such as adhesion of colorectal cancer cells and is closely related to the proliferation of colorectal cancer cells. Research has confirmed that, compared to normal colorectal tissue, the SDC2 gene exhibits high levels of methylation in colorectal cancer at different stages, suggesting its clinical value in colorectal cancer detection.

[0009] The leukemia inhibitory factor receptor (LIFR) has become a hot topic in recent years in the study of inflammation-related factors. LIFR was first reported in the 1990s, and early research focused primarily on its role as a inflammatory factor in the inflammatory response. With increasing attention paid to the relationship between inflammation-related factors and tumor development, LIFR has re-emerged in the spotlight. LIFR is the receptor for leukemia inhibitory factor (LIF) and is highly homologous to the transmembrane 130kD glycoprotein 130 (gp130). The LIFR gene is located on human chromosome 5p12-p13. Its function is to mediate signals induced by interleukin-6 (IL-6)-related factors, including LIF, cardiotrophin-1 (CT-1), oncostatin M (OSM), and ciliary neurotrophic factor (CNTF), by forming a heterodimer with gp130. The biological functions of these cytokines vary greatly, ranging from maintaining stem cell pluripotency, protecting the liver, and regulating glucose uptake to regulating cell proliferation and differentiation.

[0010] Fecal matrix is ​​very complex, containing a wide variety of bacterial genomic DNA, plant-derived DNA, and animal-derived DNA. The content of exfoliated cells from the intestine or other digestive tract locations is relatively small. Intestinal exfoliated cell DNA accounts for only 0.1% to 0.01% of the total DNA recovered from feces. Human DNA itself is highly heterologous, and intestinal tumor cells account for only 1% of intestinal exfoliated cells. For humans in the early stages of cancer, it is less than 1%.

[0011] Currently, there are two main methods for extracting DNA from intestinal tumor cells: total nucleic acid extraction from fecal samples and molecular hybridization capture. On the one hand, for the total nucleic acid extraction method, feces contain PCR inhibitors such as polysaccharides, bile salts, humic substances, and bile acids. If the entire genome is extracted from feces, the large genetic background and PCR inhibitors will be very unfavorable for the detection of DNA from exfoliated tumor cells. On the other hand, existing molecular hybridization capture techniques are cumbersome to operate, and most of them use the method of first coupling magnetic beads with probes, and then using the complex to hybridize and capture the target gene. This method has low capture efficiency. Summary of the Invention

[0012] To address the key challenges in colorectal cancer screening and diagnosis—high sensitivity and specificity—this invention discloses a primer-probe combination for detecting dual-site methylation in colorectal cancer. This combination includes primers and probes for detecting methylation at the LIFR gene cg08392199 site and for detecting methylation at the SDC2 gene cg13096260 site. Methylation at both the LIFR gene cg08392199 and SDC2 gene cg13096260 sites is correlated with colorectal cancer.

[0013] The primer-probe combination for detecting the methylation site cg08392199 of the LIFR gene includes an upstream primer for LIFR-F, a downstream primer for LIFR-R, and a LIFR-P probe; the upstream primer for LIFR-F, the downstream primer for LIFR-R, and the LIFR-P probe are LIFR-F4, LIFR-R1, and LIFR-P2; wherein the nucleotide sequence of LIFR-F4 is shown in SEQ ID NO.4, the nucleotide sequence of LIFR-R4 is shown in SEQ ID NO.5, and the nucleotide sequence of LIFR-P2 is shown in SEQ ID NO.6;

[0014] The primer-probe combination for detecting the cg13096260 methylation site of the SDC2 gene includes an upstream primer SDC2-F, a downstream primer SDC2-R, and a probe SDC2-P; the upstream primer SDC2-F, the downstream primer SDC2-R, and the probe SDC2-P are SDC2-F1, SDC2-R1, and SDC2-P1; wherein the nucleotide sequence of SDC2-F1 is shown in SEQ ID NO.1, the nucleotide sequence of SDC2-R1 is shown in SEQ ID NO.2, and the nucleotide sequence of SDC2-P1 is shown in SEQ ID NO.3.

[0015] On the other hand, the present invention discloses a kit comprising the primer-probe combination for dual-site methylation detection of colorectal cancer as described above.

[0016] In some embodiments, a positive control is also included; the positive control includes a plasmid containing the nucleotide sequence of the sulfite-modified methylation site of the LIFR gene and the nucleotide sequence of the sulfite-modified methylation site of the SDC2 gene, and / or a colorectal cancer cell line; the nucleotide sequence of the sulfite-modified methylation site of the LIFR gene is shown in SEQ ID NO. 10; the nucleotide sequence of the sulfite-modified methylation site of the SDC2 gene is shown in SEQ ID NO. 11.

[0017] In some embodiments, the vector plasmid containing the nucleotide sequence of the methylation site of the LIFR gene after sulfite modification and the nucleotide sequence of the methylation site of the SDC2 gene after sulfite modification is selected from pUC57, pUC57-Kan, pUC57-Simple, pUC57-mini, pUC18, and pUC19.

[0018] In some embodiments, the colorectal cell lines are selected from positive cell lines SW48, HCT116, LoVo, SW480, and SW620. All positive cell lines are derived from the American Type Culture Collection (ATCC).

[0019] In some implementations, primer pairs and probes for a quality control gene are also included; the quality control gene is actin.

[0020] Further, the quality control gene is β-actin. The primer pair for the quality control gene is a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.7, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.8, and the nucleotide sequence of the probe for the quality control gene is shown in SEQ ID NO.9.

[0021] In some implementations, a negative control is also included; the negative control is normal human genetic DNA.

[0022] In some embodiments, the reporter fluorescent group of the quality control gene probe and the reporter fluorescent group of the probe in the primer-probe combination for detecting colorectal cancer methylation at two sites are each independently selected from one of FAM, VIC, HEX, JOE, Cy3, ROX, and Cy5; the reporter quenching group of the quality control gene probe and the reporter quenching group of the probe in the primer-probe combination for detecting colorectal cancer methylation at two sites are each independently selected from one of BHQ1, BHQ2, BHQ3, TAMRA, and MGB.

[0023] Some implementation schemes also include fecal DNA extraction reagents, sulfite conversion reagents, and real-time fluorescent PCR amplification reaction reagents.

[0024] The fecal DNA extraction reagent includes a flocculant, a washing solution, a hybridization buffer, and an elution solution;

[0025] The sulfite conversion reagent includes a sulfite solution, a binding solution, a desulfurization solution, a washing solution, and an elution solution;

[0026] The real-time fluorescence PCR amplification reaction reagents include polymerase and amplification buffer.

[0027] In some embodiments, the polymerase is 2×Premix Ex Taq (Probe qPCR); the amplification buffer is 50×Rox II. 2×Premix Ex Taq (Probe qPCR) contains dNTPs.

[0028] In some embodiments, the final concentration of each primer in each primer pair of the primer-probe combination for the dual-site methylation detection of colorectal cancer is 100-300 nM, and the final concentration of each probe is 100-200 nM.

[0029] Furthermore, the screening results were determined using qPCR results from the primer-probe combination described above for the dual-site methylation detection of colorectal cancer: a Ct value > 38 for LIFR indicated negative methylation at site cg08392199; a Ct value ≤ 38 for LIFR indicated positive methylation at site cg08392199; a Ct value > 38 for SDC2 indicated negative methylation at site cg13096260; and a Ct value ≤ 38 for SDC2 indicated positive methylation at site cg13096260. Samples with positive methylation at site 6260 are considered to have positive methylation at both sites cg08392199 and / or cg13096260. Samples with negative methylation at both sites are considered to have negative methylation at both sites. The evaluation result corresponding to positive methylation in the combined detection is colorectal cancer positive. The evaluation result corresponding to negative methylation in the combined detection is colorectal cancer negative.

[0030] In some implementations, the result determination criteria further include: a Ct value ≤ 36 for the quality control gene indicates that the amount of DNA template loaded is within the allowable range, and the result is reliable; a Ct value > 36 for the quality control gene indicates that the amount of DNA template loaded is outside the allowable range, and the result is unreliable. The quality control gene is actin. The quality control gene is β-actin.

[0031] In some embodiments, the qPCR is real-time fluorescent qPCR, with the following reaction conditions: 96°C pre-denaturation for 3 minutes; 15 cycles: 95°C denaturation for 15 seconds, 70°C annealing and extension for 20 seconds, 64°C annealing and extension for 20 seconds, and 72°C extension for 10 seconds; 35 cycles: 95°C denaturation for 15 seconds, 70°C annealing and extension for 20 seconds, 60°C annealing and extension for 34 seconds, and 72°C extension for 10 seconds; and fluorescence signal is detected during annealing in all 35 cycles.

[0032] In some implementations, the qPCR amplification system is as follows: 20 μL of 2×Premix Ex Taq (Probe qPCR), 0.8 μL of 50×Rox II, final concentration of each primer 0.2–0.3 μM, final concentration of probe 0.2 μM, DNA template >10 ng, and water to a final volume of 40 μL.

[0033] The kit of this invention uses patient feces as the test sample, which is convenient and non-invasive to patients. It adopts a molecular hybridization capture method, which uses probes to specifically capture target genes, and at the same time achieves the purpose of purifying and enriching DNA, thereby improving the DNA extraction rate and purity.

[0034] Fluorescent PCR detection technology requires only one PCR tube to complete the detection. The combined detection of two sites has the advantages of high sensitivity and specificity. The results directly reflect the changes in the PCR process. The entire detection process has been optimized, and the detection speed is fast and the steps are simple. Compared with existing methods, it has better sensitivity and more significant advantages in specificity, making it more suitable for early screening of colorectal cancer.

[0035] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0036] 1. This invention is the first to use the combined detection of SDC2 and LIFR, which is innovative. In the detection of colorectal cancer, the sensitivity of the combined detection of the two points reaches 92% and the specificity is as high as 100%. It provides a high-sensitivity and high-specificity primer and probe combination and kit for early screening of colorectal cancer.

[0037] 2. The kit of the present invention is used for early colorectal cancer gene methylation detection in fecal samples. The clinical sample is patient feces, which is convenient to collect and non-invasive to patients.

[0038] 3. Using multiplex fluorescent PCR detection technology, only one PCR tube is needed to complete the detection. It has the advantages of high sensitivity and specificity of qPCR. The results directly reflect the changes in the qPCR process. It is easy to operate and reduces costs. Attached Figure Description

[0039] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention.

[0040] Figure 1 The ROC curve is obtained by joint detection of cg12587766 (LIFR) and cg13096260 (SDC2).

[0041] Figure 2 The ROC curve was obtained by combining cg08392199 (LIFR) and cg25664438 (SDC2).

[0042] Figure 3 The ROC curve is obtained by combined detection of cg13096260 (SDC2) and cg08392199 (LIFR).

[0043] Figure 4 The ROC curve is obtained by joint detection of cg04261408 (SDC2) and cg12587766 (LIFR).

[0044] Figure 5 This is a differential analysis of LIFR sites in cancerous and adjacent tissues. Here, T represents cancerous tissue; N represents adjacent tissue.

[0045] Figure 6 This is a differential analysis of the SDC2 site in cancerous and adjacent tissues. Here, T represents cancerous tissue; N represents adjacent tissue. Detailed Implementation

[0046] To make the technical means, inventive features, objectives, and effects of the invention readily understandable, the invention is further illustrated below with reference to specific figures. However, the invention is not limited to the embodiments described below.

[0047] It should be noted that the structures, proportions, sizes, etc., illustrated in the accompanying drawings of this specification are only used to complement the content disclosed in the specification for those skilled in the art to understand and read, and are not intended to limit the conditions under which the present invention can be implemented. Therefore, they have no substantial technical significance. Any modifications to the structure, changes in the proportions, or adjustments to the size, without affecting the effects and objectives that the present invention can produce, should still fall within the scope of the technical content disclosed in the present invention.

[0048] Example 1: Site Screening Process

[0049] The key and challenge of this invention lies in finding two sites that can both ensure screening specificity and improve detection sensitivity. To determine this combination of sites, during the research and development process, the methylation numbers of nearly 13,000 tumors of 33 tumor types were analyzed using a database. The specific steps are as follows:

[0050] 1.1 We selected 453 samples (408 tumor samples and 45 normal samples) from the Colorectal adenocarcinoma (COADREAD) database of The Cancer Genome Atlas (TCGA). We performed a Wilcoxon rank-sum test on 485,578 loci, setting threshold conditions: p-value < 0.01, mean β ≥ 0.2, and Δβ ≥ 0.2. 19,862 loci met these threshold conditions.

[0051] 1.2 Differential analysis was performed on sample data (751 normal samples) from the population blood methylation databases (GSE40279 and GSE41169), and sites with methylation difference values ​​greater than 25%, i.e., 15,404 sites, were retained.

[0052] 1.3 Based on descending order of β difference (Δβ) ≥ 0.5, β difference (Δβ) ≥ 0.3, and β difference (Δβ) ≥ 0.2, CpG sites (cytosine-phosphate-guanine sites, i.e., sites in the DNA sequence where cytosine is immediately followed by guanine) with high methylation levels, associated with genes of interest, were screened from 453 TCGA database samples. DNA methylation in vertebrates generally occurs at CpG sites.

[0053] 1.4 The 16 loci selected in step 1.3 were paired and arranged in descending order according to the β difference (Δβ) ≥ 0.3. Four combinations with a frequency greater than 95% were selected (see Table 1), and ROC curves of these four combinations were plotted using data from the Cancer Genome Atlas database (see Table 1). Figure 1 , Figure 2 , Figure 3 and Figure 4 The results were consistent with those in Table 1. Further analysis of cell, tissue, and fecal samples was conducted to select the most sensitive and specific locus combinations. The screening of the four combinations in Table 1 was described in Example 2 and Comparative Example 1. Finally, the optimal combination—combination 3 in Table 1 (cg08392199 locus of LIFR gene and cg13096260 locus of SDC2 gene)—was selected for further research.

[0054] Table 1. Combinations with a frequency greater than 95% after being sorted in descending order.

[0055]

[0056] Example 2 Primer and probe design and screening

[0057] This invention utilizes plasmids containing nucleotide sequences of methylation sites in the LIFR and SDC2 genes after sulfite modification, and DNA from the positive cell line SW48, as templates to construct a real-time fluorescent qPCR detection system for LIFR and SDC2 gene methylation. VIC and FAM are used as the fluorescent signal detection targets. Through optimized combinations of primers for LIFR and SDC2 gene methylation and optimization of the fluorescent probe detection system, rapid and accurate detection is achieved. The specific steps are as follows:

[0058] The plasmid is a synthetic plasmid obtained by inserting a pre-designed target gene sequence fragment into a molecular cloning vector plasmid via GenScript. The target gene sequence includes the nucleotide sequences of the sulfite-modified methylation sites of the LIFR gene and the SDC2 gene.

[0059] The nucleotide sequence of the methylation site after sulfite modification of the LIFR gene (SEQ ID NO.10, LIFR-SL(cg08392199) contains the cg08392199 site):

[0060] LIFR-SL(cg08392199):

[0061] GCGGAGTAGGGGAGTCGCGGAGTTTCGAGCGGGGTTTTTAGGGGCGGTTCGGGCGGGGTGGGGTAGCGTTTTTAGTTTTGCGGAGCGTTTTAGGGGAGTGATTTCGGAGAGCGTCGTTTCGGGTTTCGTCGTTTTTCGCGCGTTTTTGGGTTATTTTCGTGTT TTGGGGGACGCGGATTTTAGCGTTTAGAATTTTTGTTTTACGTAGGGTAGTGAGTTTTGAGGTTAGAGGTTATTTGGGGGATGGGAGGGAGTTTGAAATGTTTTTTTTTCGGAGAGGTGATTTGTTAGGTGATTTCGTGTTTTTTTGTTTTAATTTTTTTTTA

[0062] The nucleotide sequence of the methylation site after sulfite modification of the SDC2 gene (SEQ ID NO.11, SDC2-SL(cg13096260) contains the cg13096260 site):

[0063] SDC2-SL(cg13096260):

[0064] TAATTTTTATGAATTGGCGATTTATGAATATTTTATATTGTTTGAAAGTATTTTATATTTTTTTTTTTTTTTAATTTAATAAAGTAGTTTTTTTTTATTGGTCGAATTTTTAAGGTAGAAAAGTTATATACGTTTTTCGTTTTTTTATTAA TTGTTTTTTAGAAAAGGGAAAGTGAAGAAGGGAAAGAGAAAAGATAACGGGGAAGAAAAGAGTATAGAGGAGAGGAGAAAAGTGGGGAGAGAAAGGAAGAAAAGGATTGAGAAAACGTAGGAGTTTTGGTTTGTCGGTGAGTAGAGTCGGC GTAGTTATAGCGCGGAGTCGCGGCGTTTATTGGTTTTCGGAGTTGTTAATCGGCGTGTAATTTTGTAGGAATTTTTTTCGGGTTTATTTGGGAGTTATATTGTCGTTTTTTTTTTAGTCGTTTAGGGGAGTTCGGAGAAGTAGGTTTA GGAGGGAGGGAGTTAGAGGAAAAGAAGAGGAGGAGAAGGAGGAGGATTCGGGGAGGGAGGCGCGGCGCGGGAGGAGGAGGGGCGTAGTCGCGGAGTTAGTGGTTTCGTTTGGACGCGTTGTTTTTTAGATATTTTCGGAGTTTTAGTCGCG

[0065] The molecular cloning vector plasmid used was pUC57.

[0066] The positive cell line SW48 was obtained from the American Type Culture Collection (ATCC).

[0067] 1. For the detection of methylation of the LIFR and SDC2 genes, 26 primer-probe combinations were designed using Primer 5 software. For positive cell lines, tissues, or feces (e.g., Examples 2, 3, 4 and Comparative Example 1), actin was used as a quality control gene (or internal reference gene). Primers Actin-F and Actin-R were used as quality control primers, and probe Actin-P was used as a quality control probe for quality control. Commonly used actins include β-actin (ACTB), but are not limited to β-actin; α-actin, γ-actin, etc., can also be used. This example uses ACTB as a quality control gene for illustration.

[0068] Quality control gene forward primer (ACTB-F): 5'-GGTGTTTAAGATAGTGTTGTGGGTG-3' (SEQ ID NO.7)

[0069] Quality control gene reverse primer (ACTB-R): 5'-CACACTCCAAAACCGCTTTACA-3' (SEQ ID NO.8)

[0070] The probe for the quality control gene (ACTB-P) is: 5'-ACCTCATAACCTTATCACAC-3' (SEQ ID NO.9)

[0071] 2. Using 2×10 3 Using the synthesized plasmid as a template, real-time fluorescence qPCR amplification was performed using different primer and probe combinations according to the following amplification system (total volume 40 μL):

[0072] 20 μL of 2×Premix Ex Taq (Probe qPCR), 0.8 μL of Rox II (50×), final concentrations of each primer (0.2–0.3 μM), final concentration of the probe (0.2 μM), and DNA template were added, and water was added to bring the total volume to 40 μL.

[0073] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the real-time fluorescence qPCR amplification were from TAKARA.

[0074] The reaction conditions for real-time fluorescence qPCR are as follows:

[0075] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0076] The primer-probe combinations and detection results are shown in Table 2. A second round of probe and primer screening was conducted in positive cell lines using one set of SDC2 primer-probe combinations (combination 1) and one set of LIFR primer-probe combinations (combination 26).

[0077] Table 2 Primer and probe sets

[0078]

[0079]

[0080] 3. Using 10 ng of DNA from the positive cell line SW48 as a template, qPCR amplification was performed using the primer and probe combination of LIFR and SDC2 selected in the previous step. The qPCR system and reaction conditions were the same as in the previous step.

[0081] The primer-probe combinations and detection results are shown in Table 3. LIFR combination 26 (LIFR-F4, LIFR-R4, and LIFR-P2) showed high methylation in colorectal cancer-positive cell lines, and the amplification curve of this primer-probe combination exhibited an "S" shape with strong fluorescence signal. SDC2 combination 1 (SDC2-F1, SDC2-R1, and SDC2-P1) also showed high methylation in colorectal cancer-positive cell lines, and the amplification curve of this primer-probe combination exhibited an "S" shape with strong fluorescence signal. The probe and primer sequences are as follows:

[0082] Preferred probe primers for LIFR:

[0083] LIFR-F4: 5'-TCGTTTCGGGTTTCGTCG-3' (SEQ ID NO.4)

[0084] LIFR-R4: 5'-CTCTAACCTCAAAACTCACTACCCT-3' (SEQ ID NO.5)

[0085] LIFR-P2:

[0086] Preferred probe primers for SDC2:

[0087] SDC2-F1: 5'-GAGAAAGGAAGAAAAGGATTGAGA-3' (SEQ ID NO.1)

[0088] SDC2-R1: 5'-GATTAACAACTCCGAAAACCAATA-3' (SEQ ID NO.2)

[0089] SDC2-P1: 5'-AGAGTCGGCGTAGTTAT-3' (SEQ ID NO.3)

[0090] The other sequences in Table 2 are as follows:

[0091] LIFR-F1: 5'-GGAGCGTTTTAGGGGAGTGATT-3' (SEQ ID NO.12)

[0092] LIFR-F2: 5'-GGGGAGTGATTTCGGAGAGCGTCG-3' (SEQ ID NO.13)

[0093] LIFR-F3: 5'-CGTGTTTTGGGGGACG-3'(SEQ ID NO.14)

[0094] LIFR-R1:5'-CCCCCAAATAACCTCTAACC-3'(SEQ ID NO.15)

[0095] LIFR-R2:5'-CATCCCCCCAAATAACCTCTAACC-3'(SEQ ID NO.16)

[0096] LIFR-R3:5'-ACTCCCTCCCATCCCCCC-3'(SEQ ID NO.17)

[0097] LIFR-P1:5'-CGGATTTTAGCGTTTAGAA-3'(SEQ ID NO.18)

[0098] SDC2-R2:5'-TCCCTCTCTCCTCTATACTCTTTTCTTCC-3'(SEQ ID NO.19)

[0099] SDC2-R6: 5'-CCCGTTATCTTTTCTTTTTCC-3'(SEQ ID NO.20)

[0100] SDC2-P2:5'-GAATTTTTAAGGTAGAAAAGTTATATACG-3'(SEQ ID NO.21)

[0101] SDC2-R7: 5'-CCGTTATCTTTTCTTTTTCCCT-3'(SEQ ID NO.23)

[0102] SDC2-F2:5'-TAAAGTAGTTTTTTTTTATTGGTCGAA-3'(SEQ ID NO.22)

[0103] SDC2-F3:5'-ATGAATTGGCGATTTATGAA-3'(SEQ ID NO.24)

[0104] SDC2-R3:5'-CCCCGTTATCTTTTCTCTTT-3'(SEQ ID NO.25)

[0105] SDC2-R4:5'-TTCCCCGTTATCTTTTCTCT-3'(SEQ ID NO.26)

[0106] SDC2-R5: 5'-TCTTCCCCGTTATCTTTTCT-3' (SEQ ID NO. 27)

[0107] Table 3. Probe and primer combinations and screening results for positive cell lines.

[0108]

[0109] 4. Sensitivity analysis: The plasmid template was diluted from 10,000 copies to 5 copies, and then detected separately. The results showed that the fluorescent PCR method of the present invention has high sensitivity. The primers can detect the corresponding plasmid sample with 5 copies / 40 μL (as shown in Table 4).

[0110] Table 4 Results of plasmid serial dilution

[0111]

[0112]

[0113] Example 3: Tissue and fecal sample testing

[0114] 1. Using organizations as samples

[0115] Colorectal cancer and adjacent tissue specimens removed surgically or endoscopically were selected, and the methylation levels of the SDC2 and LIFR genes were quantitatively detected. The specimens consisted of 16 pairs of paired colorectal cancer and adjacent tissues. The preferred primer-probe combination and real-time fluorescent qPCR reaction system of this invention were used to detect the cancerous tissue and its paired adjacent tissue samples.

[0116] Step 1, Sample processing, DNA extraction and transformation:

[0117] DNA was extracted from tissue cells using a cell DNA extraction kit (purchased from QIAGEN). For specific procedures, please refer to the kit's instruction manual.

[0118] Step 2, sulfite modification:

[0119] The extracted cellular DNA was modified with sulfite using the EZ DNA methylation kit (purchased from ZYMO RESEARCH). For specific procedures, please refer to the kit instructions.

[0120] Step 3: Perform qPCR amplification according to the following amplification system (total volume 40 μL).

[0121] 20 μL of 2×Premix Ex Taq (Probe qPCR), 0.8 μL of Rox II (50×), final concentrations of each primer (0.2–0.3 μM), final probe concentration (0.2 μM), and DNA template (>10 ng) were added, and water was added to bring the volume to 40 μL. The sulfite-modified cellular DNA obtained in step 2 was used as the template.

[0122] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the qPCR amplification were from TAKARA.

[0123] The reaction conditions for real-time fluorescence qPCR are as follows:

[0124] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0125] Step 4: Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0126] If the number of cycles (Ct) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is ≤36, it indicates that the amount of sample DNA is within the allowable range and the result is reliable. If the number of cycles (CT) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is >36, the sample is considered invalid. Under valid detection conditions, if the CT value of the SDC2 gene is ≤38 or the CT value of the LIFR gene is ≤38, the sample test result is "positive"; if the CT value of the SDC2 gene is >38 and the CT value of the LIFR gene is >38, the sample test result is "negative".

[0127] The results (Table 5) show that the sensitivity of individual site detection in the tissue samples of this invention was 100%, and the sensitivity of combined detection was also 100%. Difference analysis was performed on the Ct values ​​detected in cancerous tissue (T) and adjacent normal tissue (N), such as... Figure 5 and Figure 6 As shown, both the SDC2 site and the LIFR site showed significant differences in cancerous tissue (T) and adjacent normal tissue (N).

[0128] Table 5. Results of tissue sample testing

[0129] Sample number ACTB SDC2 LIFR Result determination 1 32.47 29.47 31.89 Positive 2 30.56 28.24 32.14 Positive 3 30.86 29.56 31.33 Positive 4 29.77 28.74 31.60 Positive 5 39.50 26.32 32.76 Positive 6 31.52 29.01 32.04 Positive 7 30.96 28.67 32.67 Positive 8 27.86 27.24 31.78 Positive 9 29.79 26.99 31.31 Positive 10 31.39 28.78 31.60 Positive 11 32.20 27..65 30.99 Positive 12 29.85 28.74 32.76 Positive 13 32.68 28.33 31.57 Positive 14 29.78 27.46 30.89 Positive 15 30.67 27.57 31.45 Positive 16 30.49 28.64 32.33 Positive

[0130] 2. Using feces as a sample

[0131] 114 stool samples were selected, of which 59 were diagnosed with colorectal cancer, 26 with advanced adenomas, and 29 were normal upon colonoscopy. The methylation levels of the SDC2 and LIFR genes were quantitatively detected. Using the preferred primer-probe combination and qPCR reaction system of this invention, stool samples from 59 clinical colorectal cancer patients, 26 patients with advanced adenomas, and 29 healthy individuals were analyzed. Sample information is shown in Tables 6-8.

[0132] Table 6 Clinical diagnostic information of fecal samples for colorectal cancer

[0133]

[0134]

[0135]

[0136] Table 7 Clinical diagnostic information from stool samples of advanced adenomas

[0137]

[0138]

[0139] Table 8 Clinical diagnostic information of fecal samples for colorectal cancer

[0140]

[0141]

[0142] Experimental procedure:

[0143] Step 1, molecular hybridization capture.

[0144] 1.1 Crude Nucleic Acid Extraction

[0145] 1. Collect 1g of fecal sample into 4mL of fecal preservation solution (ZYMO RESEARCH, R1101), shake to mix, centrifuge at 5000rpm for 10min, take the supernatant, and perform another centrifugation operation.

[0146] 2. Take 1 mL of the supernatant of the treated feces, add lysis buffer to the tube, vortex to mix, and keep warm at 70℃ for 10 min.

[0147] 3. Add flocculant, place on ice for 5 minutes, and vortex to mix.

[0148] 5. Centrifuge at 15,000g for 3 minutes, transfer the supernatant to a centrifuge tube, add 0.6 times the volume of the supernatant in isopropanol, and mix by inverting the tube.

[0149] 6. Centrifuge at 15,000g for 5 minutes to recover the genomic DNA precipitate.

[0150] 7. Add 123 μL of purified water to dissolve the DNA.

[0151] 1.2 Hybrid Capture

[0152] 1. Take the DNA solution dissolved in the previous step into a PCR tube, and add the probe, hybridization buffer and water.

[0153] 2. Set the PCR program according to the following parameters:

[0154] ①98℃ for 5 minutes;

[0155] ②65℃ for 1 hour;

[0156] ③ Hold at 65℃ (heat preservation).

[0157] 1.3 Purification and Recovery

[0158] 1. Remove the streptavidin magnetic beads, place them on a magnetic rack, and discard the supernatant.

[0159] 2. Add cleaning solution, vortex, place on a magnetic rack, and carefully remove the supernatant.

[0160] 3. Add binding solution: Add the solution from step 1.2 to the magnetic beads containing binding solution, and place them on a rotary mixer to rotate at room temperature for 30 minutes.

[0161] 4. After the rotation incubation is complete, add the washing solution WB1, place it on a magnetic rack, and carefully aspirate the supernatant.

[0162] 5. Add rinsing solution WB2, place on a magnetic rack, and carefully aspirate the supernatant.

[0163] 6. Add 80% ethanol, place on a magnetic rack, and carefully aspirate the supernatant.

[0164] 7. Open the tube cap and let it stand at room temperature for 5 minutes to allow the remaining alcohol to evaporate completely. Remove the centrifuge tube from the magnetic rack, add 45 μL of purified water to the centrifuge tube, and vortex to mix thoroughly to completely disperse the magnetic beads. The resulting solution can be used for subsequent sulfite conversion.

[0165] Step 2: Perform sulfite conversion on the extracted DNA sample (EZ DNAmethylation Kit, purchased from ZYMO RESEARCH).

[0166] Step 3: Perform qPCR amplification according to the following amplification system (total volume 40 μL).

[0167] 20 μL of 2×Premix Ex Taq (Probe qPCR), 0.8 μL of Rox II (50×), final concentrations of each primer (0.2–0.3 μM), final probe concentration (0.2 μM), and DNA template >10 ng were added, and water was added to bring the volume to 40 μL. The sulfite-modified DNA obtained in step 2 was used as the template.

[0168] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the qPCR amplification were from TAKARA.

[0169] The qPCR reaction conditions are as follows:

[0170] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0171] Step 4: Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0172] If the number of cycles (Ct) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is ≤36, it indicates that the amount of sample DNA is within the allowable range and the result is reliable. If the number of cycles (CT) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is >36, the sample is considered invalid. Under valid detection conditions, if the CT value of the SDC2 gene is ≤38 or the CT value of the LIFR gene is ≤38, the sample test result is "positive"; if the CT value of the SDC2 gene is >38 and the CT value of the LIFR gene is >38, the sample test result is "negative".

[0173] In 114 stool samples (59 cases of colorectal cancer, 26 cases of advanced adenoma, and 29 normal samples), the methylation levels of SDC2 and LIFR were detected. The results (Table 9) show that the sensitivity of LIFR gene detection alone was 69.2% (advanced adenoma) and 89.8% (colorectal cancer), with a specificity of 100% for both. The sensitivity of SDC2 gene detection alone was 57.7% (advanced adenoma) and 88.1% (colorectal cancer), with a specificity of 100% for both. The sensitivity of combined detection of the two genes was 73.1% (advanced adenoma) and 91.5% (colorectal cancer), with a specificity of 100% for both.

[0174] Table 9. Results of fecal sample testing

[0175]

[0176]

[0177] Comparative Example 1

[0178] Based on the descending order of β difference (Δβ) ≥ 0.3 (Table 1), primers and probes were designed for the corresponding sites of combinations 1, 2, and 4, with the following sequences:

[0179] SDC2-1408-F: 5'-GGGAGCGTTATTTGGGGAATTT-3' (SEQ ID NO.28)

[0180] SDC2-1408-R: 5'-CAATTCTCGATACCCCATTCC-3' (SEQ ID NO.31)

[0181] SDC2-1408-P: 5'-TATCGGAGATTCGTTGGGA-3' (SEQ ID NO.34)

[0182] SDC2-4438-F:5'-GTAATTTTTATGAATTGGCGATTTATGA-3'(SEQ ID NO.29)

[0183] SDC2-4438-R: 5'-TCTTTCCCTTCTTCACTTTCCCT-3' (SEQ ID NO.32)

[0184] SDC2-4438-P:

[0185] LIFR-7766-F: 5'-GGGGATTTCGTTCGGGG-3' (SEQ ID NO.30)

[0186] LIFR-7766-R:5'-AACCCCGAAACGACGACC-3'(SEQ ID NO.33)

[0187] LIFR-7766-P:5'-CGTCGCGTTTATTC-3'(SEQ ID NO.36)

[0188] We used a selected primer-probe combination and a real-time fluorescence qPCR reaction system to detect fecal samples from colorectal cancer patients.

[0189] The steps are as follows:

[0190] Twenty-four stool samples were selected, of which 9 were colon cancer, 9 were advanced adenomas, and 6 were normal, as determined by colonoscopy. The methylation levels of relevant genes were quantitatively detected.

[0191] Step 1, molecular hybridization capture.

[0192] 1.1 Crude Nucleic Acid Extraction

[0193] 3. Collect 1g of fecal sample into 4mL of fecal preservation solution (ZYMO RESEARCH, R1101), shake to mix, centrifuge at 5000rpm for 10min, take the supernatant, and perform another centrifugation operation.

[0194] 4. Take 1 mL of the treated fecal supernatant, add lysis buffer to the tube, vortex to mix, and incubate at 70℃ for 10 min.

[0195] 3. Add flocculant, place on ice for 5 minutes, and vortex to mix.

[0196] 5. Centrifuge at 15,000g for 3 minutes, transfer the supernatant to a centrifuge tube, add 0.6 times the volume of the supernatant in isopropanol, and mix by inverting the tube.

[0197] 6. Centrifuge at 15,000g for 5 minutes to recover the genomic DNA precipitate.

[0198] 7. Add 123 μL of purified water to dissolve the DNA.

[0199] 1.2 Hybrid Capture

[0200] 3. Take the DNA solution dissolved in the previous step into a PCR tube, and add the probe, hybridization buffer and water.

[0201] 4. Set the PCR program according to the following parameters:

[0202] ④ 98℃ for 5 minutes;

[0203] ⑤ 65℃ for 1 hour;

[0204] ⑥ Hold at 65℃ (heat preservation).

[0205] 1.3 Purification and Recovery

[0206] 8. Remove the streptavidin magnetic beads, place them on a magnetic rack, and discard the supernatant.

[0207] 9. Add cleaning solution, vortex, place on a magnetic rack, and carefully remove the supernatant.

[0208] 10. Add binding solution: Add the solution from step 1.2 to the magnetic beads containing the binding solution, and place it on a rotary mixer to rotate at room temperature for 30 minutes.

[0209] 11. After the rotation incubation is complete, add the washing solution WB1, place it on a magnetic rack, and carefully aspirate the supernatant.

[0210] 12. Add rinsing solution WB2, place on a magnetic rack, and carefully aspirate the supernatant.

[0211] 13. Add 80% ethanol, place on a magnetic rack, and carefully aspirate the supernatant.

[0212] 14. Open the tube cap and let it stand at room temperature for 5 minutes to allow the remaining alcohol to evaporate completely. Remove the centrifuge tube from the magnetic rack, add 45 μL of purified water to the centrifuge tube, vortex to mix and completely disperse the magnetic beads. The resulting solution can be used for subsequent sulfite conversion.

[0213] Step 2: Perform sulfite conversion on the extracted DNA sample (EZ DNAmethylation Kit, purchased from ZYMO RESEARCH).

[0214] Step 3: Perform qPCR amplification according to the following amplification system (total volume 40 μL).

[0215] 20 μL of 2×Premix Ex Taq (Probe qPCR), 0.8 μL of Rox II (50×), final concentrations of each primer (0.2–0.3 μM), final probe concentration (0.2 μM), and DNA template >10 ng were added, and water was added to bring the volume to 40 μL. The sulfite-modified DNA obtained in step 2 was used as the template.

[0216] The 2×Premix Ex Taq (Probe qPCR) and Rox II (50×) used in the qPCR amplification were from TAKARA.

[0217] The qPCR reaction conditions are as follows:

[0218] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0219] Step 4: Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0220] If the number of cycles (Ct) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is ≤36, it indicates that the amount of sample DNA is within the allowable range and the result is reliable. If the number of cycles (CT) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is >36, the sample is considered invalid. Under valid detection conditions, if the CT value of the SDC2 gene is ≤38 or the CT value of the LIFR gene is ≤38, the sample test result is "positive"; if the CT value of the SDC2 gene is >38 and the CT value of the LIFR gene is >38, the sample test result is "negative".

[0221] The test results (Table 10) show that among the four combinations, combination 3 (cg08392199(LIFR) and cg13096260(SDC2)), which is the site combination used in this invention, and combinations 2 and 3, had the lowest false positives in healthy individuals. Combination 4 had too high a false positive rate and was therefore not considered a preferred site. In addition, combinations 1, 2, and 3 showed high detection effects in colorectal cancer and advanced adenomas, while combination 4 had too low a positive detection result in advanced adenomas and was therefore not considered a preferred site.

[0222] Table 10 Comparative detection results of four combined detection combinations in fecal samples

[0223]

[0224] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A primer-probe combination for detecting dual-site methylation in colorectal cancer, characterized in that, Primer and probe combinations for detecting methylation at the cg08392199 site of the LIFR gene and for detecting methylation at the cg13096260 site of the SDC2 gene; The primer-probe combination for detecting the methylation site cg08392199 of the LIFR gene includes an upstream primer for LIFR-F, a downstream primer for LIFR-R, and a LIFR-P probe; the upstream primer for LIFR-F, the downstream primer for LIFR-R, and the LIFR-P probe are LIFR-F4, LIFR-R4, and LIFR-P2; wherein the nucleotide sequence of LIFR-F4 is shown in SEQ ID NO.4, the nucleotide sequence of LIFR-R4 is shown in SEQ ID NO.5, and the nucleotide sequence of LIFR-P2 is shown in SEQ ID NO.6; The primer-probe combination for detecting the cg13096260 methylation site of the SDC2 gene includes an upstream primer SDC2-F, a downstream primer SDC2-R, and a probe SDC2-P; the upstream primer SDC2-F, the downstream primer SDC2-R, and the probe SDC2-P are SDC2-F1, SDC2-R1, and SDC2-P1; wherein the nucleotide sequence of SDC2-F1 is shown in SEQ ID NO.1, the nucleotide sequence of SDC2-R1 is shown in SEQ ID NO.2, and the nucleotide sequence of SDC2-P1 is shown in SEQ ID NO.

3.

2. A reagent kit, characterized in that, Includes the primer-probe combination for dual-site methylation detection in colorectal cancer as described in claim 1.

3. The kit according to claim 2, characterized in that, It also includes positive controls; the positive controls include plasmids and / or colorectal cancer cell lines containing nucleotide sequences of methylation sites of the LIFR gene and the SDC2 gene after sulfite modification; the nucleotide sequence of the methylation site of the LIFR gene after sulfite modification is shown in SEQ ID NO.10; the nucleotide sequence of the methylation site of the SDC2 gene after sulfite modification is shown in SEQ ID NO.

11.

4. The kit according to claim 3, characterized in that, The vector plasmids containing the nucleotide sequences of methylation sites modified by sulfite modification of the LIFR gene and the nucleotide sequences of methylation sites modified by sulfite modification of the SDC2 gene are selected from pUC57, pUC57-Kan, pUC57-Simple, pUC57-mini, pUC18, and pUC19.

5. The kit as described in claim 2, characterized in that, It also includes a negative control; the negative control is normal human genetic DNA.

6. The kit according to claim 2, characterized in that, It also includes primer pairs and probes for the quality control gene; the quality control gene is actin.