Application of TRIM7 gene and / or TRIM7 protein overexpression agent in preparation of anti-rabies medicine

By preparing overexpression agents of TRIM7 gene and/or TRIM7 protein, the problems of limited plasma sources and high costs of existing rabies immune biological preparations are solved, the growth of rabies virus is effectively inhibited and the viral titer is reduced, providing a new method for preventing and treating rabies.

CN120643694APending Publication Date: 2025-09-16SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510523377.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-24
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

Existing rabies immune biological preparations in clinical use have limited plasma sources, high production costs, significant differences in biological activity between batches, and the risk of blood-borne diseases. In addition, there is a lack of effective therapeutic drugs, resulting in a high rabies mortality rate.

Method used

After determining the overexpression of TRIM7 gene and/or TRIM7 protein, it is determined that it is an inhibitor of rabies virus, and a composition for preventing and/or treating rabies is prepared, which comprises a plasmid overexpressing TRIM7 gene and/or TRIM7 protein and pharmaceutically acceptable excipients.

Benefits of technology

It effectively inhibits the growth of rabies virus and reduces the virus titer, reduces the proliferation of rabies virus, and provides an effective means of preventing and treating rabies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120643694A_ABST
    Figure CN120643694A_ABST
Patent Text Reader

Abstract

The invention discloses an application of an overexpression agent of a TRIM7 gene and / or a TRIM protein in preparation of an anti-rabies drug. According to the invention, by measuring the expression level of rabies virus structural genes / proteins in cells infected with rabies virus after overexpression of TRIM7 and healthy cells, it is determined that the overexpression agent of TRIM7 gene and / or TRIM protein can be used for resisting rabies, inhibiting the growth of rabies and / or reducing the titer of rabies virus, thereby reducing the proliferation of rabies virus. Therefore, the composition using the product containing the over-expressed TRIM7 gene and / or TRIM7 protein can effectively prevent and / or treat rabies.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the use of an overexpression agent of a TRIM7 gene and / or a TRIM7 protein in the preparation of an anti-rabies drug. Background Art

[0002] The tripartite-motif-containing protein (TRIM) family is a class of proteins with E3 ubiquitin ligase activity, characterized by a variable C-terminal domain and three conserved domains. Most TRIM proteins contain a PRY / SPRY domain at their C-termini, while the conserved domains include a RING domain, a B-box domain, and a coiled-coil domain (CC domain). The RING domain possesses E3 ligase activity, enabling TRIM proteins to ubiquitinate target proteins, leading to their degradation by the proteasome or lysosome, or altering their subcellular localization or function. Their oligomerization requires the participation of the B-box and CC domains, while the PRY / SPRY domain mediates the interaction between TRIM proteins and their target proteins or RNAs.

[0003] TRIM proteins have many functions, such as regulating cell growth and development, cell cycle, cell differentiation, cell proliferation, apoptosis, ubiquitination, autophagy, cell signal transduction, innate immunity and tumor cell proliferation.

[0004] Rabies is a zoonotic disease caused by the rabies virus (RABV). It can cause fatal meningitis in mammals, severe neurological symptoms such as convulsions and paralysis, and ultimately death.

[0005] The primary passive immunization biological agent currently in clinical use is human rabies immunoglobulin (HRIG). Its preparation requires plasma collected from healthy donors after vaccination, followed by multiple stages of purification and viral inactivation, among other bioengineering techniques. However, this product has significant drawbacks. Limited plasma sources lead to insufficient production capacity, high production costs, and significant batch-to-batch variability in biological activity. Furthermore, there are risks of blood-borne disease transmission and IgE-mediated allergic reactions. There is currently no specific treatment for rabies in clinical practice, both domestically and internationally. Once the disease develops, the viral growth and activity are difficult to suppress, resulting in a near-instantaneous mortality rate in infected individuals, making it the infectious disease with the highest mortality rate in humans.

[0006] Therefore, studying the preventive or therapeutic drugs for rabies has important scientific and practical significance. Summary of the Invention

[0007] The purpose of the present invention is to overcome the above-mentioned deficiencies of the prior art and to provide an overexpression agent of TRIM7 gene and / or TRIM7 protein for use in the preparation of anti-rabies drugs.

[0008] The first object of the present invention is to provide a use of an overexpression agent of TRIM7 gene and / or TRIM7 protein in the preparation of an anti-rabies drug.

[0009] A second object of the present invention is to provide a composition for preventing and / or treating rabies.

[0010] In order to achieve the above object, the present invention is implemented through the following scheme:

[0011] The present invention determines that the overexpression agent of TRIM7 gene and / or TRIM7 protein is an inhibitor of rabies virus by measuring the expression level of rabies virus structural genes / proteins in cells infected with rabies virus after overexpressing TRIM7 and healthy cells.

[0012] Therefore, the present invention seeks to protect the use of an overexpression agent of the TRIM7 gene and / or TRIM7 protein in the preparation of an anti-rabies drug.

[0013] Preferably, the anti-rabies effect is to inhibit the growth of rabies virus and / or reduce the titer of rabies virus.

[0014] More preferably, the inhibition of rabies virus growth is the inhibition of rabies virus nucleic acid replication and / or the inhibition of rabies virus protein expression.

[0015] Further preferably, the rabies virus protein is rabies virus M protein and / or rabies virus G protein.

[0016] The rabies virus G protein is a glycoprotein that constitutes the spikes on the surface of the virus. It has the property of agglutinating red blood cells and is the main protein structure for the rabies virus to bind to cell receptors. The core function of the rabies virus M protein is to promote the budding of the rabies virus, and at the same time regulate the transcription and replication rate of the viral genome by promoting the polymerization of viral RNP.

[0017] More preferably, the rabies is rabies caused by the HEP-Flury strain of rabies virus.

[0018] The present invention also claims protection for a composition for preventing and / or treating rabies, wherein the composition contains a product overexpressing the TRIM7 gene and / or TRIM7 protein.

[0019] Preferably, the product is a plasmid for overexpressing the TRIM7 gene and / or for overexpressing the TRIM7 protein.

[0020] Preferably, the composition further contains pharmaceutically acceptable excipients.

[0021] Preferably, the dosage form of the composition is a pharmaceutically acceptable dosage form.

[0022] Preferably, the prevention and / or treatment of rabies is to inhibit the replication of rabies virus nucleic acid and / or inhibit the expression of rabies virus protein.

[0023] More preferably, the rabies is rabies caused by the HEP-Flury strain of rabies virus.

[0024] More preferably, the inhibition of rabies virus growth is the inhibition of rabies virus nucleic acid replication and / or the inhibition of rabies virus protein expression.

[0025] Further preferably, the rabies virus protein is rabies virus M protein and / or rabies virus G protein.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention provides the use of agents that overexpress the TRIM7 gene and / or TRIM protein in the preparation of anti-rabies drugs. By measuring the expression levels of rabies virus structural genes / proteins in cells infected with rabies virus after overexpressing TRIM7 and in healthy cells, the present invention confirms that agents that overexpress the TRIM7 gene and / or TRIM protein can be used to treat rabies, inhibiting the growth of rabies viruses and / or reducing the titer of rabies virus, thereby reducing the proliferation of rabies virus. Therefore, compositions containing products that overexpress the TRIM7 gene and / or TRIM7 protein can effectively prevent and / or treat rabies. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the PCR identification result diagram in Example 1;

[0029] Figure 2 : is the Western blotting detection result diagram in Example 2; a is the WB detection result diagram for RABV-G protein and TRIM7 protein; b is the WB detection result diagram for RABV-M protein and TRIM7 protein;

[0030] Figure 3 : is the fluorescence quantitative PCR detection result diagram in Example 2; a is the qPCR quantitative detection result diagram of TRIM7 protein and RABV-G protein; b is the qPCR quantitative detection result diagram of RABV-M protein;

[0031] Figure 4 This is a graph showing the virus titer test results in Example 3. DETAILED DESCRIPTION

[0032] The present invention is further described in detail below with reference to the accompanying drawings and specific examples. The examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available unless otherwise specified.

[0033] Example 1 Construction of TRIM7 overexpression plasmid

[0034] 1. Experimental Methods

[0035] 1. Preparation of target gene cloning template

[0036] RABV (HEP-Flury strain) was inoculated into NA cells at an MOI of 1.0 and cultured at 37°C in a 5% (w / w) CO2 environment for 48 h. After the culture, the cells were lysed using 1 mL of Magzol lysis buffer at 25°C for 2 min. The lysed cells were collected in a nuclease-free EP tube and RABV virus RNA was extracted using the HiPure Universal RNA Mini Kit (Magen, R4130-02) according to the kit instructions.

[0037] Using RABV virus RNA as a template, the reverse transcription system shown in Table 1 was mixed evenly using the EasyScript Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) reverse transcription kit (Quanshijin Company, AU341-02). The mixture was incubated at 42°C for 15 minutes, followed by heating at 85°C for 5 seconds, and the product was collected as cDNA.

[0038] Table 1 Reverse transcription system

[0039] Components Addition amount Template (RABV virus RNA) 1 μg 5×EasyScript All-in-One SuperMix for qPCR 4 μL gDNA Remover 1 μL RNase-free Water Make up to 20 μL

[0040] 2. Primer design

[0041] The Sma I and Nhe I restriction sites on the pCAGGS-HA plasmid were used as the restriction sites for inserting the target gene TRIM7. The PCR-specific amplification primers shown in Table 2 were designed for the target gene TRIM7 (GenBank: NM_001347446.1), and the Sma I and Nhe I restriction sites were added upstream and downstream of the primers, respectively (the underlined parts in the TRIM7-F and TRIM7-R primers).

[0042] Table 2 PCR specific amplification primers

[0043] name Nucleotide information (5'-3') TRIM7-F (SEQ ID NO: 1) ctcatcgatggtacccgggcaATGGCGACTGTGGGGCCG TRIM7-R (SEQ ID NO: 2) attaagatctgctagctcgagTCAAGGCCAGATTCTCAAGTATGTGCC pCAGGS-F (SEQ ID NO: 3) CTGGTTGTTGTGCTGTCTC pCAGGS-R (SEQ ID NO: 4) GTCCTTCCGAGTGAGAGAC

[0044] 3. Amplification of target fragments

[0045] The cDNA obtained in step 1 was used as a cloning template, and PCR amplification was performed using the high-fidelity enzyme Phusion High-Fidelity DNA Polymerase and the PCR specific amplification products shown in Table 2 to obtain PCR amplification products of the cDNA; wherein the PCR-F primer in the PCR amplification process was TRIM7-F as shown in the nucleotide sequence of SEQ ID NO: 1, and the PCR-R primer was TRIM7-R as shown in the nucleotide sequence of SEQ ID NO: 2; the PCR amplification system was shown in Table 3.

[0046] Table 3 PCR amplification system

[0047] Components volume 5×Phusion GC buffer 10 μL dNTPs (10 μM) 2μL PCR-F primer (10 μM) 1.5 μL PCR-R primer (10 μM) 1.5 μL Clone Template 30ng Ultrapure water Make up to 50 μL

[0048] PCR amplification program: pre-denaturation at 98°C for 2 min, denaturation at 98°C for 10 s, annealing at 68°C for 15 s, extension at 72°C for 1 min, 35 cycles; intermediate extension at 72°C for 5 min.

[0049] After PCR amplification, the cDNA was recovered by gel recovery using a Magen gel recovery kit according to the kit instructions to obtain the PCR amplification product.

[0050] 4. Enzyme digestion of plasmid

[0051] According to the enzyme digestion system shown in Table 4, the pCAGGS-HA plasmid was double-digested with Sma I restriction endonuclease and Nhe I restriction endonuclease to obtain the digested pCAGGS-HA plasmid.

[0052] Table 4 Enzyme digestion system

[0053] Components volume SmaⅠ 2μL NheⅠ 2μL 10X FastDigest 2μL pCAGGS-HA Plasmid 1 μL Ultrapure water Make up to 20 μL

[0054] The enzyme digestion reaction conditions were as follows: incubation at 37°C in a water bath for 6 h, followed by quenching at 85°C for 10 s, and gel recovery to obtain the enzyme-digested pCAGGS-HA plasmid.

[0055] 5. Seamless cloning connection

[0056] The cDNA PCR amplification product obtained in step 3 and the pCAGGS-HA plasmid obtained after enzyme digestion in step 4 were seamlessly cloned and connected according to the instructions of the Fast Mutagenesis Kit to obtain a connection product (i.e., TRIM7 overexpression plasmid); the seamless cloning system is shown in Table 5.

[0057] Table 5 Seamless cloning system

[0058] Components volume cDNA PCR amplification products 50~200ng pCAGGS-HA plasmid after enzyme digestion 50~200ng 2×ClonExpress Mix 4μL ExnaseⅡ 2μL Ultrapure water Make up to 20 μL

[0059] 6. Transformation of Ligation Products and Identification of Positive Clones

[0060] 10 μL of the ligation product obtained in step 5 was added to 100 μL of TOP10 competent cells. After an ice bath for 30 minutes, the cells were transferred to a 42°C water bath for heat shock for 90 seconds, followed by an ice bath for 3 minutes. 200 μL of LB medium was then added and shaken at 37°C and 200 rpm for 1 hour. The cells were then spread on LB agar plates containing ampicillin. After the agar plates completely absorbed the liquid, they were placed in a 37°C incubator and incubated upside down for 12 hours. After the incubation period, a single colony was picked with an inoculation needle and inoculated into 1.5 mL of ampicillin-resistant liquid LB medium. The cells were incubated at 37°C and 200 rpm for 6 hours. After the incubation period, PCR identification was performed using pCAGGS-F shown in SEQ ID NO: 3 and pCAGGS-R shown in SEQ ID NO: 4, as shown in Table 2 (parallel identification 5 times), and a negative control was set up using ultrapure water as a template. The electrophoresis results were observed and recorded using a UV gel imaging system.

[0061] 2. Experimental Results

[0062] PCR identification results are shown in the figure Figure 1 As shown, the results showed that lanes 1 to 5 were the electrophoresis results of 5 parallel identifications, and lane 6 was the electrophoresis result of the negative control. An electrophoresis band of 1795 bp appeared in the identification results of lanes 1 to 5 (the expected size of the target gene is 1795 bp), and no band appeared in the negative control of lane 6, indicating that the TRIM7 overexpression plasmid was successfully constructed.

[0063] Example 2 Effect of TRIM7 on viral proteins in RABV-infected neurons

[0064] 1. Experimental Methods

[0065] 1. Experimental group settings

[0066] NA cells were inoculated into a cell culture dish and cultured using RPMI-1640 medium until the NA cells covered the culture dish. The culture medium was discarded, and the culture dish was washed three times with PBS and then the PBS was discarded. 2 mL of 0.25% (w / w) trypsin was added to digest the cells for 30 s. The trypsin was discarded, and complete culture medium was added to suspend the cells to obtain a NA cell suspension with a cell concentration of 200,000 cells / mL. The NA cell suspension was inoculated into a 6-well cell culture plate at 1 mL / well and cultured at 37°C and 5% (w / w) CO2 until the cell density reached 70% to 80%, thereby obtaining a NA cell plate to be transfected.

[0067] TRIM7-HA-0.5μg group: Two 1.5mL EP tubes were labeled as tube A and tube B, and 250μL of RPMI-1640 medium was added to tube A and tube B respectively. Then, 5μL of Lipofectamine was added to tube A. TM 3000 transfection reagent and mix thoroughly. Add 4 μL of P3000, 0.5 μg of the TRIM7 overexpression plasmid prepared in Example 1, and 1.5 μg of the pCAGGS-HA plasmid to tube B and mix thoroughly. Then add the liquid in tube B to tube A and mix evenly with the liquid in tube A. Let it stand at 25°C for 15 min to obtain a liposome complex.

[0068] The liposome complex was added to the NA cell plate to be transfected at 200 μL / well. After 6 h of transfection, the culture medium was discarded and 2 mL of fresh RPMI-1640 culture medium was added to each well. After continuing the transfection for 24 h, the NA cells were infected with RABV (HEP-Flury strain) at an MOI of 1.0.

[0069] The only difference between the TRIM7-HA-1.0 μg group and the TRIM7-HA-0.5 μg group was that tube B contained 4 μL of P3000, 1.0 μg of the TRIM7 overexpression plasmid prepared in Example 1, and 1.0 μg of the pCAGGS-HA plasmid. The other treatments were exactly the same.

[0070] The only difference between the TRIM7-HA-2.0 μg group and the TRIM7-HA-0.5 μg group was that tube B contained 4 μL of P3000 and 2.0 μg of the TRIM7 overexpression plasmid prepared in Example 1, and the other treatments were exactly the same.

[0071] The only difference between the TRIM7-HA-0μg group and the TRIM7-HA-0.5μg group is that tube B contains 4μL of P3000 and 2.0μg of pCAGGS-HA plasmid, and the other treatments are exactly the same.

[0072] 2. Western blotting

[0073] For the NA cells infected with RABV (HEP-Flury strain) in the TRIM7-HA-0.5 μg group obtained in step 1, the supernatant was discarded and the cells were washed once with PBS. Then, cell lysis buffer was added at 100 μL / well and placed on ice for lysis. Then, the cells were scraped off with a cell scraper and collected in a 1.5 mL EP tube. Ultrasonication was performed at 300w for 5s, and the protein concentration was measured using a micro-nucleic acid protein concentration meter. The SDS-PAGE sample volume was adjusted to 30 μg / well for electrophoresis.

[0074] The electrophoresis conditions were a constant voltage of 80 V for the stacking gel portion and a constant voltage of 120 V for the separating gel portion; the electrophoresis endpoint was when the bromophenol blue indicator reached 1 cm below the gel end (electrophoresis lasted approximately 2 h).

[0075] After electrophoresis, wet transfer is performed as follows: immerse the electrotransfer clip and sponge in the electrotransfer solution, cover with three layers of qualitative filter paper, and place them in the electrotransfer instrument in the order of negative electrode - sponge - filter paper - electrophoresis gel - PVDF membrane (PVDF membrane is activated with methanol for 30 seconds in advance) - filter paper - sponge - positive electrode. After the membrane is fully immersed in the electrotransfer solution, transfer at a constant current of 200 mA.

[0076] After the transfer, the PVDF membrane was removed, washed once with TBST, and then blocked with PBST containing 5% (w / v) skim milk on a shaker at 37°C for 1 hour. After blocking, the PVDF membrane was removed and washed five times with PBST for 5 minutes each time. Then, it was placed in RABV-G antibody, RABV-M antibody, HA antibody and ACTIN antibody diluted in antibody diluent at a volume ratio of 1:1000 and incubated at 4°C for 12 hours. After incubation, it was washed five times with PBST for 5 minutes each time. Then, it was incubated with horseradish peroxidase-labeled secondary antibody at 37°C for 1 hour. After incubation, it was washed five times with PBST for 5 minutes each time. After removing the surface liquid, equal volumes of solution A and solution B in the ultrasensitive ELC chemiluminescence kit were mixed, incubated on a PVDF membrane in the dark, and exposed in a chemiluminescence imaging instrument. The Western blotting detection results of RABV-G, RABV-M and TRIM7-HA in the TRIM7-HA-0.5 μg group were recorded respectively (ACTIN protein was used as an internal reference).

[0077] The TRIM7-HA-0.5μg group was replaced with the TRIM7-HA-1.0μg group, the TRIM7-HA-2.0μg group, and the TRIM7-HA-0μg group, respectively, and treated according to the above method to obtain the Western blotting detection results of RABV-G, RABV-M, and TRIM7-HA in the TRIM7-HA-1.0μg group, the TRIM7-HA-2.0μg group, and the TRIM7-HA-0μg group (using ACTIN protein as the internal reference).

[0078] 3. Fluorescence quantitative PCR detection

[0079] For the NA cells infected with RABV (HEP-Flury strain) in the TRIM7-HA-0.5 μg group obtained in step 1, the supernatant was discarded and washed once with PBS. Trizol solution was added at a rate of 1 mL / well, and the cells were pipetted. The supernatant in the cell plate was collected and RNA was extracted from the supernatant using the HiPure Universal RNA Mini Kit (Magen, R4130-02) according to the kit instructions and reverse transcribed into supernatant cDNA.

[0080] The supernatant cDNA was used as a template, and qPCR fluorescence amplification was performed using the PerfectStart Green qPCR SuperMix Fluorescence Quantification Kit (Quanshijin Company, AQ601-01-V2) according to the kit instructions. The fluorescent amplification products of TRIM7, RABV-G protein, and RABV-M protein were obtained, respectively. The Ct value of each fluorescent amplification product was observed using an inverted fluorescence microscope, and the transcription level of each fluorescent product was calculated according to the 2-ΔΔCt method (GADPH was used as the internal reference protein).

[0081] The fluorescent amplification primers corresponding to the fluorescent amplification product of TRIM7 are Q-TRIM7-F (SEQ ID NO: 5) and Q-TRIM7-R (SEQ ID NO: 6); the fluorescent amplification primers corresponding to the fluorescent amplification product of RABV-M protein are Flury-MF (SEQ ID NO: 7) and Flury-MR (SEQ ID NO: 8); the fluorescent amplification primers corresponding to the fluorescent amplification product of RABV-G protein are Flury-GF (SEQ ID NO: 9) and Flury-GR (SEQ ID NO: 10); the fluorescent amplification primers corresponding to the internal reference protein are GADPH-F (SEQ ID NO: 11) and GADPH-R (SEQ ID NO: 12); the fluorescent amplification primers are specifically shown in Table 6.

[0082] Table 6 Fluorescence amplification primers

[0083] name Nucleotide information (5'-3') Q-TRIM7-F (SEQ ID NO: 5) ATGGCGGCGGTGGGGCCG Q-TRIM7-R (SEQ ID NO: 6) TCAAGGCCAGATTCGCAA Flury-MF (SEQ ID NO: 7) AGAGGACAAAGACTCTTCTCTGCT Flury-MR (SEQ ID NO: 8) TGGAGTTAAGCCCGTATGTTCTCT Flury-GF (SEQ ID NO: 9) AGAGGACAAAGACTCTTCTCTGCT Flury-GR (SEQ ID NO: 10) TGGAGTTAAGCCCGTATGTTCTCT GADPH-F (SEQ ID NO: 11) CGTCCCGTAGACAAAATGGT GADPH-R (SEQ ID NO: 12) TTGATGGCAACAATCTCCAC

[0084] The TRIM7-HA-0.5μg group was replaced with TRIM7-HA-1.0μg group, TRIM7-HA-2.0μg group and TRIM7-HA-0μg group, respectively, and treated according to the above method to obtain the transcription levels of each fluorescent product in the TRIM7-HA-1.0μg group, TRIM7-HA-2.0μg group and TRIM7-HA-0μg group.

[0085] 2. Experimental Results

[0086] Western blotting test results are shown in the figure Figure 2 As shown, Figure 2 Figure a is the WB test result for RABV-G protein and TRIM7 protein. Figure 2 Figure b shows the WB detection results for RABV-M protein and TRIM7 protein.

[0087] The results showed that the levels of rabies virus G protein and M protein in NA cells were significantly decreased after transfection of TRIM7 overexpression plasmid, indicating that overexpression of TRIM7 can significantly inhibit the expression of rabies virus (HEP-Flury strain) G protein and M protein.

[0088] Fluorescence quantitative PCR test results are shown in the figure Figure 3 As shown, Figure 3 Figure a is the qPCR quantitative detection result of TRIM7 protein and RABV-G protein. Figure 3 Figure b shows the qPCR quantitative detection results of RABV-M protein.

[0089] The results showed that transfection of the TRIM7 overexpression plasmid prepared in Example 1 into NA cells significantly increased the expression of TRIM7 protein in the cells, and the mRNA levels of the rabies virus G and M genes in NA cells transfected with the TRIM7 overexpression plasmid were significantly decreased. This indicates that overexpression of TRIM7 can significantly inhibit the transcriptional expression of the rabies virus (HEP-Flury strain) G and M genes.

[0090] Example 3 Effect of TRIM7 on Viral Titer in Neuronal Cells Infected with RABV

[0091] 1. Experimental Methods

[0092] NA cells were inoculated into a cell culture dish and cultured using RPMI-1640 medium until the NA cells covered the culture dish. The culture medium was discarded, and the culture dish was washed three times with PBS and then the PBS was discarded. 2 mL of 0.25% (w / w) trypsin was added to digest the cells for 30 s. The trypsin was discarded, and complete culture medium was added to suspend the cells to obtain a NA cell suspension with a cell concentration of 200,000 cells / mL. The NA cell suspension was inoculated into a 6-well cell culture plate at 1 mL / well and cultured at 37°C and 5% (w / w) CO2 until the cell density reached 70% to 80%, thereby obtaining a NA cell plate to be transfected.

[0093] p-TRIM7+RABV group: Two 1.5 mL EP tubes were labeled as tube A and tube B, and 250 μL of RPMI-1640 medium was added to tube A and tube B respectively. Then, 5 μL of Lipofectamine was added to tube A. TM 3000 transfection reagent and mix thoroughly. Add 4 μL of P3000, 0.5 μg of the TRIM7 overexpression plasmid prepared in Example 1, and 1.5 μg of the pCAGGS-HA plasmid to tube B and mix thoroughly. Then add the liquid in tube B to tube A and mix evenly with the liquid in tube A. Let it stand at 25°C for 15 min to obtain a liposome complex.

[0094] The liposome complex was added to the NA cell plate to be transfected at 200 μL / well. The culture medium was discarded 6 hours after transfection, and 2 mL of fresh RPMI-1640 culture medium was added to each well. After continuing transfection for 24 hours, the NA cells were infected with RABV (HEP-Flury strain) at MOI = 1.0 and cultured at 37°C. The supernatant in the culture medium was collected at 12 hours, 24 hours and 36 hours of culture, respectively, and recorded as 12-hour supernatant, 24-hour supernatant and 36-hour supernatant.

[0095] NA cells with good growth conditions were passaged into 96-well plates and cultured in a constant temperature incubator at 37° C. and 5% (w / w) CO 2 to obtain 96-well plates of NA cells with a cell density of 10,000 cells per well.

[0096] The supernatant was diluted 10-fold using RPMI-1640 medium (dilution was 10 -1 ~10 -8), then the 12h supernatant of each dilution was inoculated into NA cell 96-well plates at 100 μL / well (4 replicates for each dilution), and then placed in a 37°C, 5% (w / w) constant temperature incubator and cultured in RPMI-1640 medium containing 5% (v / v) fetal bovine serum for 48 h, the medium was discarded, PBS was added at 100 μL / well for washing, PBS was discarded, and 80% (v / v) acetone was added at 100 μL / well. After fixing at -20°C for 30 min, the acetone was discarded, and after washing 3 times with PBS, anti-rabies virus N protein fluorescent antibody (Fujirebio) was added at 50 μL / well in the dark. Diagnostic Company, catalog number 800-092) diluent (anti-rabies virus N protein fluorescent antibody and PBS are mixed at a volume ratio of 1:400), incubate at 4°C for 16 h, discard the supernatant, wash with PBS three times, add PBS at a rate of 100 μL / well, observe the fluorescence under a fluorescence microscope, record the wells where fluorescence is detected as positive wells, and calculate the virus titer (TCID) in NA cells infected with TRIM7 overexpressing virus solution according to the Karber method. 50 ).

[0097] The 12h supernatant was replaced with the 24h supernatant and the 36h supernatant in sequence, and the virus titer (TCID 50 ).

[0098] The only difference between the EV+RABV group and the p-TRIM7+RABV group was that 4 μL of P3000 and 2 μg of pCAGGS-HA plasmid were added to tube B and mixed thoroughly. The rest of the treatments were exactly the same. The virus titer of the EV+RABV group was calculated.

[0099] 2. Experimental Results

[0100] Virus titer test results are shown in the figure Figure 4 As shown in the figure, the results showed that 24 hours after inoculation with the HEP-Flury strain, the virus titer of the NA cells in the TRIM7 overexpression infection group (p-TRIM7+RABV group) was significantly lower than that in the control group (EV+RABV group), indicating that overexpression of TRIM7 in cells can effectively inhibit the replication of rabies virus (HEP-Flury strain) and thereby reduce the virus titer.

[0101] Finally, it should be noted that the above embodiments are intended only to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art will readily appreciate that other variations or modifications may be made based on the above descriptions and concepts. It is not necessary and impossible to provide an exhaustive list of all possible implementations. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the claims of the present invention.

Claims

1. Use of an overexpression agent of TRIM7 gene and / or TRIM7 protein in the preparation of an anti-rabies drug.

2. The use according to claim 1, characterized in that The anti-rabies treatment is to inhibit the growth of rabies virus and / or reduce the titer of rabies virus.

3. The use according to claim 2, characterized in that The inhibition of rabies virus growth is to inhibit the replication of rabies virus nucleic acid and / or inhibit the expression of rabies virus protein.

4. The use according to claim 3, characterized in that The rabies virus protein is rabies virus M protein and / or rabies virus G protein.

5. The use according to claim 4, characterized in that The rabies is caused by the HEP-Flury strain of the rabies virus.

6. A composition for preventing and / or treating rabies, characterized in that: The composition contains a product that overexpresses the TRIM7 gene and / or the TRIM7 protein.

7. The composition according to claim 6, characterized in that The product is a plasmid that overexpresses the TRIM7 gene and / or TRIM7 protein.

8. The composition according to claim 6, characterized in that The composition further contains pharmaceutically acceptable excipients.

9. The composition according to claim 6, characterized in that The prevention and / or treatment of rabies is to inhibit the replication of rabies virus nucleic acid and / or inhibit the expression of rabies virus protein.

10. The composition according to claim 9, characterized in that The rabies is caused by the HEP-Flury strain of the rabies virus.