Penicillium decumbens C01 and application thereof

Abstract

The invention relates to Penicillium decumbens C01 and application of the Penicillium decumbens C01, and belongs to the technical field of microorganisms. The penicillium decumbens C01 disclosed by the invention is preserved in the Guangdong Microbial Culture Collection Center, and the preservation number of the penicillium decumbens C01 is GDMCC NO.66456. The strain is obtained by separating, purifying and screening soil samples collected from botanical gardens in South China of Guangzhou; tests show that the bacteriostatic active substance generated by fermentation of the strain has a good bacteriostatic effect on staphylococcus epidermidis, staphylococcus aureus, escherichia coli, propionibacterium acnes, candida albicans and pseudomonas aeruginosa, and the bacteriostatic active substance has the characteristic of high temperature resistance and excellent preservative effect; the antibacterial preservative can be used as an antibacterial preservative raw material, is applied to the fields of food, health care products or daily chemical products and the like, and has wide application prospects and important conversion research values.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to a Penicillium procumbentum C01 strain and application thereof. Background Art

[0002] With the progress and development of society, the pace of daily life has generally accelerated, and people are facing increasingly serious skin problems such as dryness, aging, acne, and dull skin. Cosmetics targeting different skin issues are also increasing. Antibacterial agents are often added to cosmetics to ensure stable product quality and safety. These agents must not only ensure their antibacterial efficacy, but also be environmentally friendly and safe, and not interfere with other ingredients in the product.

[0003] Traditional antibacterial agents in existing technologies are highly irritating. For example, some antibacterial agents in cosmetics may cause skin irritation. In severe cases, they may clog pores or cause chronic mucosal toxicity, leading to allergic dermatitis, photosensitivity reactions, and even cancer risks. Currently, natural antibacterial active ingredients are gaining popularity due to their low irritation, good permeability, high safety, and significant efficacy, making them highly promising cosmetic additives.

[0004] However, natural antibacterial agents have limited effectiveness. For example, the active ingredients of plant-based antibacterial agents are less stable, and plant essential oil antibacterial agents are insoluble in water, where bacteria can easily grow. These issues limit the application of natural preservatives. Therefore, to meet the broad market application prospects of natural antibacterial agents, it is urgent to isolate and obtain microorganisms that produce highly active antibacterial substances. Some microbial fermentation products have excellent antibacterial effects and are mild and non-irritating, which is of great significance to the development of food, health products, and daily chemical products. Summary of the Invention

[0005] The present invention aims to overcome the shortcomings of the prior art and provide a strain of Penicillium decumbentum C01 that produces a highly active antibacterial substance. The strain was isolated and purified from a soil sample collected from the South China Botanical Garden in Guangzhou and has been deposited in the Guangdong Provincial Microbial Culture Collection with the deposit number GDMCC NO. 66456.

[0006] In the first aspect, the present invention provides a strain of Penicillium procumbentum ( Penicillium decumbens ), the bacteria was deposited in the Guangdong Provincial Microbiological Culture Collection Center on June 4, 2025, with the deposit number GDMCC NO.66456, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0007] In a second aspect, the present invention provides a use of the Penicillium procumbentum C01 described in the first aspect in the preparation of an antibacterial active substance.

[0008] In a third aspect, the present invention provides a method for preparing an antibacterial active substance produced by fermentation of Penicillium procumbentum C01 according to the first aspect, comprising the following steps: S1. Seed liquid culture: Activate the frozen strain C01, pick out the culture block containing the colony after activation, add it to PDB liquid culture medium and culture it to obtain seed liquid; S2, solid fermentation: the seed liquid is evenly coated on the solid fermentation medium for fermentation; S3. After the fermentation is completed, the solid fermentation medium covered with mycelium is crushed, and an equal volume of ethyl acetate is added for ultrasonic-assisted extraction. The mixture is allowed to stand at room temperature for extraction and then filtered to obtain an extract and a solid portion; S4. Collecting the extract and concentrating it to obtain the antibacterial active substance.

[0009] Preferably, in step S1, the culture temperature is 25-30° C., the culture speed is 180-220 rpm, and the culture time is 12-18 h.

[0010] Preferably, in step S2, the fermentation temperature is 25-30° C., and the fermentation time is 5-7 days.

[0011] Preferably, in step S3, the ultrasonic power is 200-600w, the ultrasonic time is 15-50min, and the extraction time at room temperature is 1-3h.

[0012] Preferably, the solid portion in step S3 is added with an equal volume of ethyl acetate and extracted at room temperature for 1-3 hours before filtration, and the extraction is repeated 2-3 times before combining the extracts.

[0013] In a fourth aspect, the present invention provides a product comprising the Penicillium decumbentum C01 described in the first aspect.

[0014] In a fifth aspect, the present invention provides a use of the Penicillium procumbentum C01 described in the first aspect in the preparation of food, health products or daily chemical products, wherein the Penicillium procumbentum C01 described in the first aspect is fermented to prepare an antibacterial active substance, and the antibacterial active substance is then used to prepare food, health products or daily chemical products.

[0015] In a sixth aspect, the present invention provides use of the antibacterial active substance prepared by the method described in the third aspect in the preparation of food, health products or daily chemical products.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The inventors of the present application isolated and purified Penicillium decumbentum C01 from a soil sample collected from the South China Botanical Garden in Guangzhou.

[0017] 1. The results of the antibacterial test show that the antibacterial active substance produced by fermentation of Penicillium decumbentum isolated from the soil sample of the present invention has a good antibacterial effect on Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans and Pseudomonas aeruginosa. The diameters of the inhibition zones of the above six indicator bacteria are all greater than 13 mm.

[0018] 2. The results of the minimum inhibitory concentration test showed that the fermentation product of strain C01 had excellent antibacterial properties. Its minimum inhibitory concentration (MIC) against Staphylococcus epidermidis, Staphylococcus aureus and Propionibacterium acnes was below 25 μg / mL, the minimum inhibitory concentration (MIC) against Escherichia coli was below 100 μg / mL, the minimum inhibitory concentration (MIC) against Candida albicans was below 50 μg / mL, and the minimum inhibitory concentration (MIC) against Pseudomonas aeruginosa could reach below 12.5 μg / mL.

[0019] 3. The heat resistance test results show that the antibacterial active substance produced by Penicillium decumbentum C01 in the present invention still has excellent antibacterial properties against Propionibacterium acnes and Pseudomonas aeruginosa after being treated at 80°C and 60°C for 40 minutes, respectively, indicating that the antibacterial active substance prepared in the present invention has high temperature resistance.

[0020] 4. Antiseptic test results showed that the viable bacterial counts in both the bacterial and fungal groups showed a downward trend after 6 hours of exposure; after 7 days, the viable bacterial counts in each group were no higher than 80 CFU / mL; and after 14 to 28 days, the viable bacterial counts in both the bacterial and fungal groups were zero, indicating that the test substances passed the test and exhibited excellent antiseptic properties. These findings suggest that the antibacterial active substances produced by Penicillium decumbentum C01 fermentation can be used as antibacterial and antiseptic raw materials, exhibiting excellent antiseptic properties when used in the preparation of foods, health products, or daily chemical products, and possess broad application prospects and significant translational research value.

[0021] Biomaterial Deposit A strain of Penicillium procumbentum C01, classified and named Penicillium decumbens , was deposited in the Guangdong Provincial Microbiological Culture Collection Center on June 4, 2025, with the deposit number GDMCC NO.66456, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the colony morphology of Penicillium decumbentum C01; Figure 2 This is the phylogenetic tree of Penicillium procumbentum C01; Figure 3This is a partial antibacterial effect diagram of the antibacterial active substance of Penicillium decumbentum C01 in Example 4; wherein SE represents Staphylococcus epidermidis, SA represents Staphylococcus aureus, EC represents Escherichia coli, and PA represents Propionibacterium acnes. DETAILED DESCRIPTION

[0023] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0024] Unless otherwise specified, other materials and reagents used in the examples can be obtained from commercial sources.

[0025] The culture medium involved in the present invention is: PDA medium: 20 g / L glucose, 12 g / L potato extract powder, 10 g / L yeast extract powder, 20 g / L agar, distilled water, natural pH.

[0026] PDB liquid medium: 20 g / L glucose, 12 g / L potato extract powder, 10 g / L yeast extract powder, distilled water, natural pH.

[0027] Solid fermentation medium: PDA medium.

[0028] All the above culture media must undergo a sterilization step, with the sterilization conditions being 121°C for 20 min.

[0029] Example 1: Isolation, purification and screening of strains Soil samples were collected from the South China Botanical Garden in Guangzhou, Guangdong Province, China. 10 g of soil sample was weighed, added to 90 mL of sterile water, and cultured at room temperature with shaking at 150 rpm for 30 min. Afterwards, the suspension was aspirated and the strains were isolated using a 10-fold gradient dilution method. 100 μL of the suspension was diluted 10 times. -4 , 10 -5 , 10 -6 The dilutions were spread onto PDA medium and incubated at 28°C. Observed daily, individual mold colonies were transferred to new PDA plates and repeatedly isolated and purified using the plate streak method. Purified strains were obtained and numbered. The strains were transferred to PDB liquid medium for liquid culture. After obtaining the bacterial suspension, sterile glycerol was added to prepare a strain freezing solution containing 30% glycerol, which was stored at -80°C.

[0030] The isolated mold strains were screened for antibacterial activity. The specific steps were as follows: Each mold strain was cultured overnight in PDB liquid medium at 28°C and 200 rpm. A 1% inoculum was then evenly spread onto a PDA plate and incubated at 28°C for 5 days. Upon completion of fermentation, the resulting product was collected, crushed, and extracted twice with equal amounts of ethyl acetate. Each extraction was allowed to stand for 2 hours before filtration. The ethyl acetate extract was concentrated to completely remove the solvent and prepared into a 10 mg / ml sample. Agar diffusion inhibition tests were performed against two common opportunistic pathogens, Escherichia coli and Propionibacterium acnes, to determine antibacterial activity. Initial screening experiments demonstrated that mold C01 exhibited significant antibacterial activity against both Escherichia coli and P. acnes, leading to strain identification and subsequent validation experiments.

[0031] Example 2 Identification of bacterial species Morphological characteristics: After culturing strain C01 in PDA medium at 28°C for 4-6 days, the colonies are round and expanded, with flocculent aerial hyphae, gray-green spore-forming surface and light yellow back, dense without concentric rings, and felt-like texture (e.g. Figure 1 Microscopic examination showed the presence of conidiophores and conidia, and septate hyphae.

[0032] Identification by molecular biology methods: 18S rRNA identification was performed. The genomic DNA of Penicillium decumbentum C01 was extracted as a template according to the operating instructions of the fungal genomic DNA extraction kit, and its 18S rRNA was obtained by PCR amplification using universal primers (NS1: 5'-GTAGTCATATGCTTGTCTC-3' (SEQ.ID.NO.2), FUNG: 5'-ATTCCCCGTTACCCGTTG-3' (SEQ.ID.NO.3)). Subsequently, BGI was commissioned to perform sequencing, and the sequence information obtained by sequencing (SEQ.ID.NO.1) was compared and homology analyzed in the NCBI database, and a phylogenetic tree was constructed using MEGA 12 software; the phylogenetic tree is as follows; Figure 2 As shown, the results showed that strain C01 and Penicillium decumbens The strains were clustered in the same clade with a sequence homology of 98.52%. Combined with its morphological characteristics, strain C01 was identified as Penicillium decumbentum and was classified as Penicillium decumbens .

[0033] The 18S rRNA sequence of the strain is shown in SEQ ID NO.1: TATTCCCCTCGGTTTCCGTGCCACCATGGTAGGCCACTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGAACCATCGCCGGCGCAAGGCCATGCGATTCGTTAAGTTATTATGATTCACCAAGGAGCCCCGAAGGGCGTTGGTTTTTTATCTAATAAATACACCCCTTC CTGAAGTCGGGGTTTTTAGCATGTATTAGCTCTAGAATTACCACAGGTATCCATGTAGTAAGGTACTATCAAATAAACGATAACTGATTTAATGAGCCATTCGCAGTTTCACAGTATAAAGTGCTTATACTTAGACATGCATGGCTTAATCTTTGAGACAATTTTTTGACTACATG.

[0034] Example 3 Preparation of antibacterial active substances The preparation method of the antibacterial active substance ① specifically comprises the following steps: S1. Seed liquid culture: Activate the frozen strain C01. After activation, pick an area of ​​1 cm 2 The culture block containing the colony was added to 200 mL of PDB liquid medium and cultured at 28°C and 200 rpm for 16 h to obtain seed solution; S2, solid fermentation: take 5% (volume / mass ratio) seed liquid and evenly spread it on the solid fermentation medium, and ferment it at 28℃ in the dark for 6 days; S3. After the fermentation is completed, the solid fermentation medium covered with mycelium is crushed, an equal volume of ethyl acetate is added, and ultrasonic-assisted extraction is performed at an ultrasonic power of 400W for 40 minutes. After the ultrasonic-assisted extraction, the mixture is immersed in the mixture at room temperature for 2 hours and then filtered to obtain an extract and a solid portion; the solid portion is then added with an equal volume of ethyl acetate and allowed to stand at room temperature for 2 hours and then filtered, and this step is repeated 3 times; the extracts obtained after all extractions are combined; S4. Concentrating the combined extracts until the solvent is completely removed to obtain the antibacterial active substance.

[0035] Antibacterial active substance ②: Compared with the preparation steps of antibacterial active substance ①, the only difference is that commercially available Penicillium decumbentum (purchased from Beina Bio, product number BNCC185808) is used instead of Penicillium decumbentum C01 in the present invention to prepare the antibacterial active substance through seed liquid culture, solid fermentation and other steps. The other steps and parameters are the same as those of antibacterial active substance ①.

[0036] Example 4 Antibacterial Test Test substances: The antibacterial active substances ① and ② prepared in Example 3 were dissolved in methanol to a concentration of 10 mg / mL, respectively, and then sterilized by filtration using a 0.2 μm filter membrane to obtain test solutions for antibacterial experiments; Indicator bacteria: Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans, and Pseudomonas aeruginosa are selected; Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans, and Pseudomonas aeruginosa are inoculated into appropriate culture media for activation and culture to obtain logarithmic test bacterial suspensions; The specific steps of the antibacterial test are as follows: The test used a double-layer agar diffusion method. 10 mL of sterilized 1% water agar medium was poured into a sterile plate and placed in an Oxford cup after solidification. 200 μL of indicator bacteria solution was added to 20 mL of nutrient agar medium at about 50°C and mixed evenly. The final concentration of the indicator bacteria was 4 × 10 7 CFU / mL, pour the mixed nutrient agar medium containing indicator bacteria into a sterile plate; after the nutrient agar medium is completely solidified, remove the Oxford cup and add 100 μL of the test substance to each well. The blank control group uses an equal amount of methanol instead of the test substance; Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa are cultured at 36°C for 24 hours, Propionibacterium acnes is cultured in an anaerobic incubator at 36°C for 24 hours, and Candida albicans is cultured at 28°C for 72 hours. The diameter of the inhibition zone is measured; three parallel experiments are set for each indicator bacteria, and each inhibition zone is measured in three directions. The data are presented as the average value.

[0037] The test results are as follows Figure 3 (Only part of the experimental results are shown in the figure) and as shown in Table 1: The diameters of the inhibition zones of antibacterial active substance ① against Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans and Pseudomonas aeruginosa are 19.03 mm, 17.50 mm, 13.87 mm, 18.31 mm, 16.25 mm and 23.83 mm, respectively, indicating that the antibacterial active substance prepared by fermentation of Penicillium decumbentum C01 has a good antibacterial effect.

[0038] Combining the antibacterial effects of antibacterial active substances ① and ② in Table 1 on Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans and Pseudomonas aeruginosa, it can be seen that not all Penicillium decumbentum has antibacterial effects on the above six bacteria. The Penicillium decumbentum C01 isolated and obtained in the present invention can be fermented to produce active substances with good antibacterial properties.

[0039] Table 1 Antibacterial test data indicator bacteria Blank control Antibacterial active substances① Antibacterial active substances② Staphylococcus epidermidis - 19.03 - Staphylococcus aureus - 17.50 - Escherichia coli - 13.87 11.24 Propionibacterium acnes - 18.31 - Candida albicans - 16.25 - Pseudomonas aeruginosa - 23.83 - Note: Unit: (mm), “-” means no obvious antibacterial activity.

[0040] Example 5 Minimum Inhibitory Concentration (MIC) Detection Indicator bacteria: logarithmic phase Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Propionibacterium acnes, Candida albicans and Pseudomonas aeruginosa were selected; the indicator bacteria were diluted to 1×10 7 CFU / mL concentration for later use; Test substance: The antibacterial active substance ① prepared in Example 3 was first prepared with DMSO to a concentration of 20 mg / mL, filtered through a 0.2 μm filter for sterilization, and then diluted with nutrient broth to concentrations of 500, 400, 200, 100, 50, 25, and 12.5 μg / mL for testing. Minimum inhibitory concentration (MIC) testing was performed. Experimental group: 100 μL of the test substance at concentrations of 500, 400, 200, 100, 50, 25, and 12.5 μg / mL was added to rows 1 to 7 of a 96-well plate, followed by the addition of 100 μL of indicator bacteria to each well and gentle pipetting to mix. Blank control group: DMSO was added to each well of the 8th row of a 96-well plate according to the DMSO content of the test substance at each concentration, and the volume was made up to 100 μL with nutrient broth medium. 100 μL of indicator bacteria was added and gently pipetting to mix. Three replicate wells were set for each indicator bacteria in each group. Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, and Candida albicans were cultured in a shaker at 30°C and 120 rpm for 30 h. Propionibacterium acnes was placed in anaerobic bags and cultured in a shaker at 30°C and 120 rpm for 30 h. Each well was observed for turbidity and the results were recorded. Data are presented as average values. From the minimum inhibitory concentration (MIC) data in Table 2, it can be seen that the antibacterial active substances prepared by fermentation of Penicillium decumbentum C01 isolated from the soil in the present application have a minimum inhibitory concentration (MIC) of less than 25 μg / mL for Staphylococcus epidermidis, Staphylococcus aureus and Propionibacterium acnes, a minimum inhibitory concentration (MIC) of less than 100 μg / mL for Escherichia coli, a minimum inhibitory concentration (MIC) of less than 50 μg / mL for Candida albicans, and a minimum inhibitory concentration (MIC) of less than 12.5 μg / mL for Pseudomonas aeruginosa, indicating that the fermentation product of strain C01 has excellent antibacterial properties against the above-mentioned indicator bacteria.

[0041] Table 2 Minimum inhibitory concentration (MIC) data

[0042] Note: “+” means turbid, which means it cannot inhibit the growth of indicator bacteria; “-” means clear, which means it can inhibit the growth of indicator bacteria.

[0043] Example 6 Heat resistance test Test substance: The antibacterial active substance ① prepared in Example 3 was dissolved in methanol to a concentration of 10 mg / mL, and then sterilized by filtration using a 0.2 μm filter membrane to obtain a test solution for heat resistance test; The test substances were treated at 80°C and 60°C for 40 min, respectively, and then cooled to room temperature. Antibacterial tests were performed according to the method of Example 4. An equal amount of methanol was used instead of the test substance in the control group. Three parallel experiments were performed in each group, and the data are presented as the average value. Indicator bacteria: Use the logarithmic test bacterial suspension of Propionibacterium acnes and Pseudomonas aeruginosa; The experimental results show that after the antibacterial active substance ① was treated at 80°C and 60°C for 40 minutes respectively, an antibacterial test was carried out according to the antibacterial test steps described in Example 4. The experimental results show that the diameters of the inhibition zones of the antibacterial active substance ① after the above two treatment methods for Propionibacterium acnes and Pseudomonas aeruginosa are almost consistent with the data in Table 1 in Example 4. The diameters of the inhibition zones of Propionibacterium acnes are 17.96 mm and 18.52 mm, respectively, and the diameters of the inhibition zones of Pseudomonas aeruginosa are 24.02 mm and 23.79 mm, respectively. This indicates that the antibacterial active substance produced by the fermentation of Penicillium decumbent C01 still has excellent antibacterial properties after high-temperature treatment, and has high-temperature resistance.

[0044] Example 7 Anticorrosion Test Test substance: The antibacterial active substance ① prepared in Example 3 was dissolved in 1,3-butanediol to a mass fraction of 5%, and then sterilized by filtration using a 0.2 μm filter membrane to obtain a test solution; The test substance is added to the cosmetics as a natural preservative, and the preservative test is conducted with reference to the well-known microbial challenge test methods of the Cosmetic, Toiletries and Fragrance Association (CTFA) and the United States Pharmacopoeia. The specific test steps are as follows: First, a certain amount of preservative-free facial mask liquid was prepared according to the basic formula and randomly divided into two groups, with five facial mask liquids in each group. The test substances were added to make the mass fraction of antibacterial active substance ① in the facial mask liquid reach 0.1%; the test bacteria Staphylococcus epidermidis, Staphylococcus aureus, Escherichia coli, Candida albicans and Pseudomonas aeruginosa in the logarithmic growth phase were diluted to 4×10 9 CFU / mL, the mixed bacterial solution was added to the mask solution, and the bacterial group made the final concentration of bacteria in the mask solution 4×10 7 CFU / mL, the fungus group made the final concentration of fungi in the mask liquid 4×10 6CFU / mL, after being mixed evenly, the bacteria group was cultured in a 36℃ incubator, and the fungus group was cultured in a 28℃ incubator; according to the total colony count test method in Chapter 5 Microbiological Test Methods in the 2015 Edition of Cosmetics Safety Technical Specifications, the number of viable bacteria was determined 6h, 7d, 14d, and 28d after inoculation to judge the preservative efficacy of the cosmetics; the judgment standard is: when each sample is inoculated with bacteria, the number of surviving bacteria is reduced to no more than 0.1% of the initial concentration on the 7th day, and then gradually decreases, and no sterile growth is achieved on the 28th day; the preservative is effective and passes the test; otherwise, the preservative is ineffective and fails the test.

[0045] The antiseptic test results are shown in Table 3 (data presented as average values). After 6 hours of exposure, the viable bacterial counts in both the bacterial and fungal groups showed a downward trend. After 7 days of exposure, the viable bacterial counts in each group were no higher than 80 CFU / mL. From 14 to 28 days, the viable bacterial counts in both the bacterial and fungal groups were zero, indicating that the test substances passed the test and exhibited excellent antiseptic properties. This suggests that the antibacterial active substances produced by the fermentation of Penicillium decumbentum C01 can be used as antibacterial and antiseptic raw materials. Their excellent antiseptic properties when used in the preparation of foods, health supplements, and daily chemical products suggest broad application prospects and significant translational research value.

[0046] Table 3 Anticorrosion test data Group 6h 7d 14d 28d Bacterial viable count (CFU / mL) <![CDATA[5.12×10 5 ]]> 72 0 0 Fungal viable count (CFU / mL) <![CDATA[3.06×10 5 ]]> 40 0 0 Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A strain of Penicillium decumbentum ( Penicillium decumbens ) C01, characterized in that Its deposit number is GDMCCNO.66456.

2. Use of the Penicillium procumbentum C01 as claimed in claim 1 in the preparation of antibacterial active substances.

3. A method for producing an antibacterial active substance by fermenting Penicillium procumbentum C01 according to claim 1, characterized in that: The following steps are involved: S1. Seed liquid culture: Activate the frozen strain C01, pick out the culture block containing the colony after activation, add it to PDB liquid culture medium and culture it to obtain seed liquid; S2, solid fermentation: the seed liquid is evenly coated on the solid fermentation medium for fermentation; S3. After the fermentation is completed, the solid fermentation medium covered with mycelium is crushed, and an equal volume of ethyl acetate is added for ultrasonic-assisted extraction. The mixture is allowed to stand at room temperature for extraction and then filtered to obtain an extract and a solid portion; S4. Collecting the extract and concentrating it to obtain the antibacterial active substance.

4. The method according to claim 3, characterized in that In step S1, the culture temperature is 25-30° C., the culture speed is 180-220 rpm, and the culture time is 12-18 hours.

5. The method according to claim 3, characterized in that In step S2, the fermentation temperature is 25-30° C. and the fermentation time is 5-7 days.

6. The method according to claim 3, characterized in that In step S3, the ultrasonic power is 200-600w, the ultrasonic time is 15-50min, and the extraction time at room temperature is 1-3h.

7. The method according to claim 3, characterized in that An equal volume of ethyl acetate is added to the solid portion in step S3, and the mixture is allowed to stand at room temperature for 1-3 hours before being filtered. The extraction is repeated 2-3 times, and the extracts are combined.

8. A product, characterized in that The method comprises the Penicillium procumbentum C01 as claimed in claim 1.

9. Use of Penicillium procumbentum C01 according to claim 1 in preparing food, health products or daily chemical products, characterized in that: The antibacterial active substance is prepared by fermentation using the Penicillium procumbentum C01 as claimed in claim 1, and the antibacterial active substance is used in the preparation of food, health products or daily chemical products.

10. Use of the antibacterial active substance prepared by the method according to any one of claims 3 to 7 in the preparation of food, health products or daily chemical products.

Images