Paenibacillus alvei NNUB1, fungicide and application
By using the alveolar Bacillus NNUB1 bacterial agent to antagonize soil-borne pathogens and promote plant growth, the problems of soil salinization and disease in continuous vegetable cropping were solved, and environmentally friendly disease prevention and control and growth promotion effects were achieved.
Patent Information
- Application Number
- CN202510930784.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-07
- Publication Date
- 2025-09-16
AI Technical Summary
Existing technologies cause serious secondary salinization, acidification and soil-borne diseases in continuous vegetable cropping. Chemical control leads to drug resistance and ecosystem damage, making it difficult to effectively control soil-borne diseases and polluting the environment.
The newly isolated alveolar Bacillus NNUB1 bacterial agent is used to antagonize a variety of soil-borne pathogens and promote plant growth. Live bacterial suspension, culture fluid filtrate or freeze-dried powder is prepared, and the application amount is not less than 5×109 CFU/kg soil, and it is used in combination with an exogenous carbon source solution.
It significantly inhibits soil-borne pathogens, promotes plant growth, increases biomass, reduces disease incidence, enhances soil ecosystem functions, and is environmentally friendly with no residue.
Smart Images

Figure CN120648618A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to Paenibacillus alvei, and in particular to Paenibacillus alvei NNUB1, a bacterial agent and applications. Background Art
[0002] While intensive continuous cropping of vegetables is currently being vigorously promoted, excessive application of fertilizers and pesticides often leads to secondary salinization, acidification, and nutrient imbalance in the soil, resulting in serious continuous cropping problems, particularly soil-borne diseases. These diseases, caused by the accumulation of pathogenic fungi, bacteria, and nematodes in the soil, directly attack crop roots and vascular tissues. Due to their hidden nature, rapid spread, and difficulty in control, they have become a core threat to sustainable vegetable production. Current production relies primarily on soil disinfection or root irrigation with chemical agents. However, long-term, monotherapy use can easily induce pathogen resistance, significantly reducing control effectiveness. Furthermore, the indiscriminate killing of broad-spectrum fungicides can severely damage beneficial soil microbial communities and weaken soil ecosystem function. Furthermore, chemical residues pollute soil and water, accumulate through the food chain, and threaten human health, contradicting the principles of green agriculture and ecological conservation.
[0003] Biological control using beneficial microorganisms and their metabolites has shown great potential and unique advantages. The core lies in the introduction of antagonistic strains, which accurately inhibit soil-borne pathogens by competing for nutrients and space, producing antimicrobial substances, inducing systemic resistance, etc. Compared with chemical control, microbial control has the characteristics of being environmentally friendly, free of harmful residues, not easy to induce drug resistance, sustainable effects and relatively low cost, making it an ideal way to achieve green plant protection. The technical core of microbial control lies in the exploration of bacterial resources. Current development focuses on groups such as Bacillus, Trichoderma, Pseudomonas and Actinomycetes. There are still few microbial resources that can be truly applied in actual production. Patents CN103205372A and CN109892340A respectively announced two types of alveolar Bacillus and their applications in preventing and controlling specific soil-borne pathogens, but this species still has more biological resources and characteristics to be explored. Summary of the Invention
[0004] Purpose of the invention: The purpose of the present invention is to provide a newly isolated alveolar Bacillus NNUB1 with the dual characteristics of anti-soil-borne plant pathogen activity and plant growth promotion; the second purpose is to provide a bacterial agent containing the alveolar Bacillus NNUB1 and its application.
[0005] Technical solution: The Paenibacillus alvei NNUB1 described in the present invention has a deposit number of CGMCC NO.28005.
[0006] The Paenibacillus alvei NNUB1 of the present invention is deposited in the General Microbiology Center of the China Culture Collection Administration of Microorganisms (CGMCC) with a deposit number of CGMCC NO. 28005 and a deposit date of July 24, 2023. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, Postal Code 100101.
[0007] The bacterial agent of the present invention contains any one of Paenibacillus alvei NNUB1, its live bacterial suspension, its culture filtrate, and its live bacterial freeze-dried powder.
[0008] Preferably, the live bacterial suspension is prepared by inoculating a single colony of Paenibacillus alvei NNUB1 in LB liquid medium and culturing it, and then centrifuging and resuspending it to obtain a live bacterial count of not less than 1×10 9 CFU / mL of bacterial suspension.
[0009] Preferably, the fermentation supernatant is a sterile culture fluid obtained by inoculating a single colony of Paenibacillus alvei NNUB1 into LB liquid medium, culturing the culture medium, and then centrifuging and filtering the culture medium.
[0010] Preferably, the culture conditions are 28-30° C., 150-190 r / min, and 45-75 h.
[0011] The invention relates to the use of the Paenibacillus alvei NNUB1 or bacterial agent in preventing and controlling soil-borne plant pathogens.
[0012] Preferably, the soil-borne plant pathogens include Fusarium oxysporum, Fusarium solani, Fusarium graminearum, Fusarium asiatica, and Ralstonia solanacearum.
[0013] Application of the Paenibacillus alvei NNUB1 or bacterial agent of the present invention in promoting plant growth.
[0014] Preferably, the amount of Paenibacillus alvei NNUB1 applied in the application of preventing and controlling plant pathogens or promoting plant growth is not less than 5×10 9 CFU.
[0015] Preferably, the aforementioned application for promoting plant growth comprises the additional addition of any one or more exogenous carbon sources selected from sucrose, galactose, fructose, mannitol, inositol, and glucose.
[0016] Beneficial effects: Compared with the existing technology, the present invention has the following significant advantages: 1. The newly isolated alveolar Bacillus NNUB1 has excellent anti-soil-borne plant pathogen activity and can antagonize a variety of Fusarium fungi and Ralstonia solanacearum; 2. The alveolar Bacillus NNUB1 also has the property of promoting plant growth and can significantly increase plant biomass; 3. Experimental data show that the bacterium can effectively inhibit soil-borne pathogens in continuously cultivated soils and significantly promote crop growth, and has excellent application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 This is a morphological identification diagram of Paenibacillus alvei NNUB1;
[0018] Figure 2 This is the phylogenetic tree of Paenibacillus alvei NNUB1;
[0019] Figure 3 This is a diagram showing the antagonistic effect of Paenibacillus alvei NNUB1 on pathogenic fungi;
[0020] Figure 4 This is a diagram showing the effect of Paenibacillus alvei NNUB1 bacterial agent on promoting cucumber growth;
[0021] Figure 5 This is a statistical chart showing the results of promoting tomato growth by combining the alveolar Bacillus NNUB1 agent with carbon source solution, where a and b indicate significant differences (p<0.05) after two-tailed T test. DETAILED DESCRIPTION
[0022] The technical solution of the present invention is further described below.
[0023] Example 1: Isolation and identification of Paenibacillus alvei NNUB1 strain
[0024] 1. Isolation of Paenibacillus alvei NNUB1
[0025] Paenibacillus alvei NNUB1 was isolated from the rhizosphere soil of cucumber in a greenhouse. The collected soil was diluted to obtain 10 -6 100 μL of the soil suspension was applied to an LB medium plate and placed in a 28°C incubator for 48 h. The growth of the colonies on the plate was observed and a single colony was selected for streak purification.
[0026] On a PDA culture medium plate, an activated 6-mm diameter cake of Fusarium oxysporum, Fusarium solani, Fusarium graminearum, or Fusarium asiaticum was inoculated on the left side, and a purified single colony was inoculated on the right side using an inoculation needle. After inoculation, the plates were cultured at 28°C for 96 hours, and the antagonism was observed to obtain a NNUB1 strain with Fusarium antagonism.
[0027] 2. Identification of Paenibacillus alvei NNUB1
[0028] (1) Morphological identification:
[0029] The NNUB1 strain obtained above was inoculated into LB medium and cultured at 30°C for 48 h. Figure 1 As shown, the colonies are round, grayish white and translucent, with a smooth and moist surface, regular edges without halos, and slightly convex.
[0030] (2) Molecular biological identification:
[0031] The genomic DNA of the NNUB1 strain obtained above was extracted using a bacterial genome extraction kit, and 16S rDNA was amplified by PCR using it as a template.
[0032] The upstream primer is the universal primer 27F at a concentration of 10mM, and its sequence is AGAGTTTGATCCTGGCTCAG; the downstream primer is the universal primer 1492R at a concentration of 10mM, and its sequence is GGTTACCTTGTTACGACTT; the 25μL PCR amplification system includes: 2×Pro Tag Master Mix Ver.2 12.5μL, 1μL each of the aforementioned upstream and downstream primers, 1μL of the aforementioned NNUB1 strain genomic DNA, and ddH2O to 25μL; the PCR reaction conditions are: 95℃5min; 94℃40s, 52℃60s, 72℃90s, 30 cycles; 72℃10min. The amplified product was sequenced by Sangon Biotech (Shanghai) Co., Ltd., and the obtained gene sequence was subjected to homology comparison analysis at NCBI, and a phylogenetic tree was constructed. The phylogenetic tree is as follows Figure 2 As shown, strain NNUB1 was clustered with Paenibacillus alvei. Therefore, strain NNUB1 was determined to belong to the species Paenibacillus alvei.
[0033] Example 2: Anti-plant pathogenic activity of Paenibacillus alvei NNUB1 strain
[0034] 1. Antagonistic effect of NNUB1 on pathogenic fungi
[0035] On a PDA culture medium plate, activated 6-mm diameter Fusarium oxysporum, Fusarium solani, Fusarium graminearum, or Fusarium asiaticum fungus cakes were inoculated on the left side, and activated Paenibacillus alvei NNUB1 was inoculated on the right side with an inoculation needle. After inoculation, the plates were cultured at 28°C for 96 hours, and the antagonism was observed.
[0036] The results are as follows Figure 3 As shown, Paenibacillus alvei NNUB1 grows rapidly, quickly seizing growth space and nutrients, surrounding pathogens and forming a zone of inhibition at the edge of the colony, inhibiting the growth of pathogens. This indicates that Paenibacillus alvei NNUB1 can effectively antagonize multiple Fusarium plant pathogens.
[0037] 2. Inhibitory effect of Paenibacillus alvei NNUB1 on pathogenic bacteria
[0038] The activated NNUB1 was inoculated into LB liquid medium and cultured at 30°C and 170 rpm for 48 h. After the culture was complete, the culture was centrifuged at 10,000 rpm for 10 minutes, and the supernatant was collected and filtered through a 0.22 μm filter to obtain the fermentation supernatant.
[0039] Take 50 mL of NNUB1 fermentation supernatant to 150 mL of NA medium, inoculate 1 mL of activated Ralstonia solanacearum into it, and culture at 37 ° C and 170 rpm for 48 h. The OD 600 At the same time, 150 mL of NA medium was added with 50 mL of sterile LB liquid medium and inoculated with the same amount of Ralstonia solanacearum as a control (CK).
[0040] The results are shown in Table 1. After 48 h of culture, the inhibition rate of NNUB1 fermentation supernatant against Ralstonia solanacearum was 49.80%, indicating that Paenibacillus alvei NNUB1 can effectively inhibit the growth of pathogenic bacteria.
[0041] Table 1 Inhibitory effect of Paenibacillus alvei on Ralstonia solanacearum
[0042] deal with Cultivation time <![CDATA[OD 600 ]]> Inhibition rate (%) CK 48h 1.956 —— NNUB1 48h 0.982 49.80
[0043] Inhibition rate (%) = [(CK OD value - NNUB1 treatment OD value) / CK OD value] × 100
[0044] Example 3: Growth-promoting effect of Paenibacillus alvei NNUB1 on crops
[0045] 1. Preparation of Paenibacillus alvei NNUB1 inoculum
[0046] Paenibacillus alvei NNUB1 was inoculated into LB liquid medium and cultured at 29 ± 1°C, shaking at 170 rpm for 48 h. After the culture was complete, the cells were centrifuged at 10,000 rpm for 15 min, the supernatant was discarded, the cells were washed twice with sterile water, and diluted with sterile water to a bacterial count of 1 × 10 9 CFU / mL, obtain NNUB1 bacterial agent and apply it within 6h.
[0047] 2. Growth-promoting effect of Paenibacillus alvei NNUB1 on cucumber seedlings
[0048] The test cucumber variety was Tianjin Kerun Jindong No. 58. The cucumber seeds were soaked in 50℃ warm water for 6h and then placed on moist gauze for germination at 28℃. After most seeds germinated, the white seeds were selected and sown in a sterilized seedling medium made by mixing equal volumes of peat, perlite, and vermiculite with NNUB1 added at a concentration of 5mL / kg. At the same time, an ordinary sterilized seedling medium without NNUB1 was set as the control group (CK).
[0049] After sowing, take a photo after three true leaves grow out. The growth promotion effect is as follows: Figure 4 At the same time, plant height, aboveground fresh weight, aboveground dry weight, and chlorophyll content of the penultimate true leaf were measured, and the statistical results are shown in Table 2.
[0050] Table 2 Statistical results of Paenibacillus alvei NNUF1 promoting cucumber growth
[0051] deal with Plant height (cm) Fresh weight of aboveground parts (g) Aboveground dry weight (g) Chlorophyll content (mg / L) CK <![CDATA[15.97±0.63 a ]]> <![CDATA[3.99±0.08 a ]]> <![CDATA[0.74±0.02 a ]]> <![CDATA[9.13±0.28 a ]]> NNUB1 <![CDATA[22.92±0.77 b ]]> <![CDATA[6.37±0.17 b ]]> <![CDATA[1.13±0.05 b ]]> <![CDATA[15.05±0.45 b ]]>
[0052] Among them, a and b indicate significant differences after two-tailed T test (p<0.05).
[0053] according to Figure 4 As shown in Table 2, under the same growth environment and time, the height, aboveground fresh weight, aboveground dry weight and chlorophyll content of cucumber seedlings were significantly increased by 43.52%, 59.65%, 52.70% and 64.84% compared with the control after the addition of NNUB1 inoculant, respectively. This indicates that Paenibacillus alvei can effectively promote the growth of cucumber, increase the chlorophyll content of cucumber leaves, and promote photosynthesis.
[0054] 3. Growth-promoting effect of Paenibacillus alvei NNUB1 on tomato seedlings
[0055] The tomato variety used in the test was Mini Tom. The tomato seeds were soaked in sterile water, shaken at 28°C and 100 r / min for 12 h, and then placed on moist gauze at 28°C for germination. After most seeds germinated, the white seeds were selected and sown in a sterilized seedling medium to which NNUB1 fungicide was added at a concentration of 5 mL / kg after sterilization; at the same time, an ordinary sterilized seedling medium without NNUB1 fungicide was set as the control group (CK).
[0056] 35 days after sowing, the aboveground fresh weight and total biomass of the plants were measured. Figure 5 As shown in the results, compared with the control, the aboveground fresh weight and total biomass of tomatoes treated with NNUB1 inoculant increased significantly by 27.08% and 22.63%, respectively.
[0057] 4. Growth-promoting and disease-resistant effects of Paenibacillus alvei NNUB1 on cucumber
[0058] Soil was collected from a certain area where cucumbers had been continuously cropped for many years. The cucumbers in this area had serious problems with continuous cropping and were prone to wilt disease.
[0059] The collected soil was passed through a 4 mm sieve to remove plant and animal debris and other impurities before use in the potted plant experiment. Before the experiment, the soil pH was measured to be 7.49 and the electrical conductivity was 1669 μS / cm.
[0060] The potted plant experiment was grouped as follows: the NNUB1 treatment group (NNUB1) was prepared by adding 10 mL of the NNUB1 agent prepared above to a pot containing 2 kg of soil before planting; the control treatment group (CK) was prepared by adding 10 mL of sterile water to a pot containing 2 kg of soil before planting; each treatment had 3 pots, and 6 cucumber seedlings were planted in each pot. The test cucumber variety was Tianjin Kerun Jindong No. 58.
[0061] Cucumber seeds were soaked in 50℃ warm water for 6 hours, and then placed on moist gauze at 28℃ for germination. After most seeds germinated, white seeds were selected and sown into sterilized seedling medium. After two true leaves grew, seedlings with uniform growth were selected and transplanted into the pots of NNUB1 treatment group or control treatment group for potted planting.
[0062] During the pot planting period, the plants were irrigated with Hoagland's nutrient solution every 7 days. Eight weeks after planting, the incidence rate and the height, aboveground fresh weight and aboveground dry weight of healthy cucumber plants in the two treatment groups were calculated.
[0063] Table 3 Effects of Paenibacillus alvei NNUB1 on promoting cucumber growth and preventing wilt
[0064]
[0065] Among them, the incidence rate = (number of diseased plants / total number of plants) × 100%; the control effect = [(CK incidence rate - NNUB1 treatment incidence rate) / CK incidence rate] × 100%; among them, a and b indicate significant differences after two-tailed T test (p < 0.05).
[0066] As shown in Table 3, application of NNUB1 significantly reduced the incidence of cucumber Fusarium wilt, achieving a 75% control efficacy. Furthermore, plant height, aboveground fresh weight, and aboveground dry weight of healthy cucumbers after treatment also showed significant differences compared to the control, increasing by 51.46%, 76.59%, and 95.56%, respectively. This suggests that NNUB1 can effectively promote cucumber plant growth and control Fusarium wilt.
[0067] In summary, the application of Paenibacillus alvei NNUB1 can effectively promote the growth of cucumber and tomato crops and inhibit the occurrence of crop diseases.
[0068] 5. Growth-promoting effect of Paenibacillus alvei NNUB1 combined with carbon source solution on tomato
[0069] Tomato cultivation soil was collected from a local area and passed through a 4mm sieve to remove plant and animal debris and other impurities for use in potted plant experiments. Before the experiment, the soil pH was measured to be 7.25 and the electrical conductivity was 542 μS / cm.
[0070] The potted plant experiments were conducted as follows: The NNUB1 treatment group (NNUB1) added 10 mL of the previously prepared NNUB1 inoculum to 2 kg of soil in a pot before planting, along with a carbon source solution of sucrose, galactose, fructose, mannitol, inositol, and glucose at a concentration of 500 mg / kg. The control group (CK) received only the aforementioned carbon source solution in a pot containing 2 kg of soil. Each treatment consisted of six pots, each planted with one tomato seedling.
[0071] The tomato variety used in the test was Mini Tom. The tomato seeds were soaked in sterile water, shaken at 28°C and 100 r / min for 12 h, and then placed on moist gauze for germination at 28°C. After most seeds germinated, white seeds were selected and sown in a sterilized seedling medium. After two true leaves grew, seedlings with uniform growth were selected and transplanted into pots for planting.
[0072] During the potting period, the carbon source mixture was supplemented every 7 days at a concentration of 500 mg / kg soil. Plant biomass was counted 35 days after planting.
[0073] Table 4 Effect of Paenibacillus alvei NNUB1 combined with carbon source solution on promoting tomato growth
[0074]
[0075]
[0076] Among them, a and b indicate significant differences after two-tailed T test (p<0.05).
[0077] Table 4 shows that the combined application of NNUB1 and a carbon source solution significantly promoted tomato plant growth. Aboveground fresh weight, belowground fresh weight, and total biomass showed significant increases of 114.39%, 62.16%, and 102.96%, respectively, compared to the control. Compared to Example 3, when NNUB1 alone was applied, the combined application of NNUB1 and a carbon source solution increased tomato growth by 87.31% and 80.33%, respectively. This suggests that the combined application of NNUB1 and a carbon source solution further promoted tomato plant growth compared to the application of either agent alone.
Claims
1. A Paenibacillus alvei NNUB1, whose deposit number is CGMCC NO. 28005.
2. A bacterial agent, characterized in that Contains any one of Paenibacillus alvei NNUB1, its live bacterial suspension, its fermentation supernatant, and its live bacterial lyophilized powder.
3. The microbial agent according to claim 2, characterized in that The live bacterial suspension is prepared by inoculating a single colony of Paenibacillus alvei NNUB1 in LB liquid medium and culturing it, centrifuging it, and resuspending it to obtain a live bacterial count of no less than 1×10 9 CFU / mL of bacterial suspension.
4. The microbial agent according to claim 2, characterized in that The fermentation supernatant is a sterile culture fluid obtained by inoculating a single colony of Paenibacillus alvei NNUB1 into LB liquid culture medium and culturing the culture medium, followed by centrifugation and filtration.
5. The bacterial agent according to claim 3 or 4, characterized in that The culture conditions are 28-30° C., 150-190 r / min, and 45-75 h.
6. Use of the Paenibacillus alvei NNUB1 according to claim 1 or the bacterial agent according to claim 2 in controlling soil-borne plant pathogens.
7. The use according to claim 6, characterized in that The soil-borne plant pathogens include Fusarium oxysporum, Fusarium solani, Fusarium graminearum, Fusarium asiatica, and Ralstonia solanacearum.
8. Use of the Paenibacillus alvei NNUB1 according to claim 1 or the bacterial agent according to claim 2 in promoting plant growth.
9. The use according to claim 6 or 8, characterized in that The amount of Paenibacillus alvei NNUB1 applied in the application is not less than 5×10 9 CFU.
10. The use according to claim 8, characterized in that The application adds any one or more exogenous carbon sources selected from sucrose, galactose, fructose, mannitol, inositol and glucose.
Citation Information
Patent Citations
Paenibacillus alvei and its applications
CN103205372A
Application of Paenibacillus alvei in prevention and control of potato scab
CN109892340A
Cited By
Paenibacillus strongly ZKSW001 as well as fungicide and application of paenibacillus strongly ZKSW001
CN121294287A