Strain for controlling tomato bacterial wilt and promoting growth of tomato, and method for controlling tomato bacterial wilt and method for promoting growth of tomato using same

Abstract

The present invention relates to a strain for controlling tomato bacterial wilt and promoting tomato growth, and to a method for controlling tomato bacterial wilt and a method for promoting tomato growth using same. A microbial agent containing the motile mutant strain or a metabolite of production change due to deletion of a flagellin protein gene, according to the present invention, can control tomato bacterial wilt at a level comparable to registered levels of synthetic pesticides by an eco-friendly and low-input method. In addition, a microbial formulation comprising a non-pathogenic Ralstonia solanacearum Gj707 strain or RSp1180 protein, which is the adhesin protein represented by SEQ ID NO: 2, according to the present invention, can control tomato bacterial wilt at a level comparable to registered levels of synthetic pesticides. Furthermore, the tomato root adhesion protein of the bacterial wilt pathogen can be utilized for developing agents with site-specific action against bacterial wilt, thereby enabling efficient and health-friendly management of bacterial wilt, for which no dedicated agents are currently registered. Unlike general synthetic pesticides, such formulations also promote tomato growth, and thus are expected to increase the production and income of tomatoes in farmhouses.

Description

Strains for controlling tomato wilt and promoting growth, and methods for controlling tomato wilt and promoting tomato growth using the same

[0001] The present invention relates to a strain for controlling tomato wilt disease and promoting growth, and a method for controlling tomato wilt disease and promoting growth of tomatoes using the strain.

[0002] The excessive use of chemical and organic fertilizers is a growing problem in modern agriculture. This leads to increased salt concentrations and nutrient imbalances in the soil, which are major causes of reduced crop growth and pest infestations. This situation creates a vicious cycle of repeated cropping, soil contamination, and reduced farm income, hindering the achievement of sustainable agriculture. Excessive fertilizer use negatively impacts the soil ecosystem, reducing crop growth. Continuous cultivation of the same crop increases pathogen density and deteriorates the physical and chemical properties of the soil, leading to a sustained decline in crop productivity. This disrupts the balance of the soil ecosystem and is a major factor in the long-term devastation of the agricultural environment.

[0003] To address these issues, environmentally friendly and sustainable agricultural technologies are needed. In particular, biological control technologies are attracting attention as an alternative that can minimize environmental impact while maintaining crop productivity. Microbial technologies can contribute to enhancing agricultural sustainability by not only controlling diseases but also promoting growth.

[0004] Meanwhile, bacterial wilt is a devastating disease affecting major crops like tomatoes. The pathogen Ralstonia solanacearum invades through the roots, blocking vascular systems and killing the plant. This pathogen's high environmental adaptability and wide host range make it difficult to control.

[0005] Blight disease is a serious problem that reduces tomato production by up to 91% worldwide, resulting in enormous economic losses for farmers. Currently, there are no registered synthetic pesticides, and existing chemical and biological control methods have limited effectiveness, necessitating the development of new control technologies. Existing microbial agents have limited pathogen control capabilities and often fail to simultaneously control the disease and promote growth. Therefore, the development of multifunctional microbial agents is necessary to overcome these limitations.

[0006] Microbial preparations are an environmentally friendly method that prevents soil contamination, maintains a safe ecosystem, and improves crop productivity. In particular, they offer the advantage of providing highly effective, low-cost pest control.

[0007] Multifunctional microbial preparations capable of simultaneously controlling pathogens and promoting growth are key technologies for sustainable agriculture. This requires strain selection and development of utilization technologies, as well as research into preparations that can demonstrate practical effectiveness in agricultural settings.

[0008] In order to solve these agricultural environmental problems, the present invention aims to achieve the effect of controlling tomato wilt disease and promoting growth by utilizing strains.

[0009] The present inventors have revealed that a variant of the flagellar protein fliC (hereinafter referred to as fliC) of the WR-1 strain, a highly pathogenic tomato wilt fungus, suppresses the occurrence and progression of wilt disease and promotes tomato seedling growth. In a follow-up study, the genomes of three highly pathogenic strains, Wj644, Bs715, and WR-1, which contain the genome of GMI1000, a standard strain of the Ralstonia solanacearum species complex (RSSC), and the genomes of non-pathogenic strains Sw698, Gj707, and Cw717, and the genomes of human pathogens such as yellow fever bacteria, Escherichia coli, and food poisoning bacteria, were compared and analyzed to select six host surface attachment proteins, RSp1065, RSp1180, RSc0115, RSc2796, RSc2797, and RSp1620, and the ability of the non-pathogenic strains to control wilt disease was determined to be the tomato root attachment protein of the strain. It was discovered that the disease was highly dependent on Adhesin. Subsequently, through genome-gene comparison, a non-pathogenic tomato wilt strain, Ralstonia pseudosolanacearum Gj707, with normal Adhesin was selected, and the present invention was completed by discovering that treatment with Gj707 before inoculation with a pathogenic strain prevented tomato wilt and further promoted seedling growth.

[0010] Although extensive research has been conducted on the pathogenic contribution of adhesion-related proteins, including adhesins, to date, there have been no attempts to control diseases using strains with specific adhesins or adhesins themselves.

[0011] Therefore, the technical problem to be solved in the present invention is to provide a mutant strain having a control effect against tomato wilt disease.

[0012] The technical problem to be solved in the present invention is to provide a composition for controlling tomato wilt disease.

[0013] Another technical problem to be solved by the present invention is to provide a method for controlling tomato wilt disease.

[0014] Another technical problem to be solved in the present invention is to provide a composition for promoting tomato growth.

[0015] Another technical problem to be solved by the present invention is to provide a method for promoting tomato growth.

[0016] In order to solve the above-mentioned technical problem, the present invention provides a mutant strain in which fliC, a flagellar protein (flagellin) production gene, is deleted in the genome of Ralstonia solanacearum WR-1 strain.

[0017] The above mutant strain is characterized as Ralstonia solanacearum fliC, and this strain was deposited with the Korean Agricultural Culture Collection (KACC) of the National Institute of Agricultural Sciences, Rural Development Administration under the accession number KACC 81300BP on May 22, 2024.

[0018] In order to solve the other technical problems mentioned above, the present invention provides a composition for controlling tomato wilt disease, characterized in that it comprises as an effective ingredient at least one selected from the group consisting of a mutant strain of Ralstonia solanacearum WR-1 strain lacking fliC, a flagellar protein production gene, a culture medium thereof, a non-pathogenic Ralstonia pseudosolanacearum Gj707 strain, a culture medium thereof, and an Adhesin protein, which is a RSp1180 protein represented by SEQ ID NO: 2.

[0019] The above Ralstonia pseudosolanacearum Gj707 was isolated from a tomato exhibiting wilt disease and may have been deposited at the Korean Agricultural Culture Collection (KACC) under accession number KACC 10707.

[0020] Preferably, the culture solution of the Ralstonia pseudosolanacearum Gj707 strain is characterized by being cultured in a CPG (Casamino acid-Peptone-Glucose) medium at 25 to 30°C under dark conditions for 1 to 5 days.

[0021] In order to solve the above-mentioned technical problem, the present invention provides a microbial preparation for controlling tomato wilt disease comprising the above composition.

[0022] In order to solve the above technical problem, the present invention provides a method for controlling tomato wilt using a mutant strain lacking fliC, a flagellar protein production gene, in the genome of Ralstonia solanacearum WR-1 strain, a culture medium thereof, a non-pathogenic Ralstonia pseudosolanacearum Gj707 strain, a culture medium thereof, and one or more selected from the group consisting of an Adhesin protein, RSp1180 protein represented by SEQ ID NO: 2, or a composition or microbial preparation including the same.

[0023] In order to solve the above technical problem, the present invention provides a composition for promoting tomato growth, characterized in that it comprises as an effective ingredient at least one selected from the group consisting of a mutant strain in which fliC, a flagellar protein production gene, is deleted in the genome of Ralstonia solanacearum WR-1 strain, a culture medium thereof, a non-pathogenic Ralstonia pseudosolanacearum Gj707 strain, a culture medium thereof, and an Adhesin protein, which is a RSp1180 protein represented by SEQ ID NO: 2.

[0024] In order to solve the above technical problem, the present invention provides a microbial preparation for promoting tomato growth comprising the above composition.

[0025] In order to solve the above technical problem, the present invention provides a method for promoting tomato growth using a mutant strain lacking fliC, a flagellar protein production gene, in the genome of Ralstonia solanacearum WR-1 strain, a culture medium thereof, a non-pathogenic Ralstonia pseudosolanacearum Gj707 strain, a culture medium thereof, and one or more selected from the group consisting of an Adhesin protein, RSp1180 protein represented by SEQ ID NO: 2, or a composition or microbial preparation including the same.

[0026]

[0027] In this way, the microbial preparation containing the motile mutant strain according to the present invention or the metabolite causing a change in yield due to a flagellar protein gene defect can control tomato wilt disease at a level comparable to that of synthetic pesticides registered in an environmentally friendly and low-input manner. In addition, the microbial preparation containing the non-pathogenic Ralstonia pseudosolanacearum Gj707 strain according to the present invention or the Adhesin protein RSp1180 protein represented by SEQ ID NO: 2 can control tomato wilt disease at a level comparable to that of synthetic pesticides registered in the present invention. In addition, the tomato root attachment protein of the wilt pathogen can be used to develop a site-specific agent for wilt disease, and can perform highly efficient and public health-friendly management of wilt disease, for which there is currently no registered dedicated agent. Unlike general synthetic pesticides, such preparations are expected to increase tomato production and income of farmers because they promote tomato growth.

[0028] The following drawings attached to this specification illustrate preferred embodiments of the present invention and, together with the contents of the invention described above, serve to further understand the technical idea of ​​the present invention, and therefore, the present invention should not be interpreted as being limited to matters described in such drawings.

[0029] Figure 1 illustrates the structure of pEX18Tc::fliC_KO, a carrier for fliC deletion.

[0030] Figure 2 illustrates the structure of the WR-1 strain genome.

[0031] Figure 3 compares the structures of the WR-1 strain (wild type) and the fliC deletion mutant.

[0032] Figure 4 shows the PCR amplification results of the WR-1 strain (wild type) and the fliC deletion mutant.

[0033] Figure 5 shows the control effect of tomato wilt disease by fliC treatment.

[0034] Figure 6 shows the growth promotion effect of tomato seedlings by fliC treatment.

[0035] Figure 7 shows a comparison of the amino acid sequences of Adhesin RSp1180 by strain.

[0036] Figure 8 shows the effect of Gj707 treatment on the control of tomato wilt disease.

[0037] Figure 9 shows the effect of Gj707 treatment on the growth promotion of tomato seedlings.

[0038] The present invention will be described in more detail below.

[0039] The present invention provides a mutant strain in which fliC, a flagellar protein (flagellin) production gene, is deleted from the genome of Ralstonia solanacearum WR-1 strain.

[0040] The above mutant strain is Ralstonia solanacearum fliC and was deposited with the Korean Agricultural Culture Collection (KACC) of the National Institute of Agricultural Sciences, Rural Development Administration under the accession number KACC 81300BP on May 22, 2024.

[0041] A mutant strain lacking fliC, a flagellar protein (flagellin) production gene, in the genome of the above R. solanacearum WR-1 strain can be represented by sequence number 1.

[0042] According to the present invention, the present invention is characterized by selecting an Adhesin (host attachment protein) whose expression is enhanced in fliC for analysis of the control mechanism of wilt disease in a motile mutant.

[0043] At this time, the quorum sensing level (5×10) in the root apoplast after biofilm formation 6 In order to proliferate to 10 CFU ml-1, the pathogen must first express adhesin and bind to the plant receptor.

[0044] Staphylococcus aureus and Vibrio cholerae produce adhesins to attach to small intestinal villi after entering the human body. Genomic analysis revealed that the genome of the wilt pathogen contains six types of adhesins.

[0045] According to one embodiment of the present invention, fliC complement using attTn7site is prepared as a plant growth promoting substance investigation in reanalysis of volatile metabolites of wilt pathogen.

[0046] According to the present invention, the suppression of the progression of wilt disease by treatment with the motile mutant fliC was shown to be 93% or more when the wild type (WT) WR-1 was inoculated after or simultaneously with the fliC treatment. In this case, the fliC treatment after the WT inoculation had no disease control effect (no significant difference from the inoculated group).

[0047] Additionally, in the fliC-only treatment group, the live weight increased by 26% compared to the control group, and in the WT inoculation group after fliC treatment, the live weight increased by 17%.

[0048] According to one embodiment of the present invention, the analysis of the disease control mechanism by fliC revealed that fliC inhibits the attachment of pathogens to tomato roots. Treatment with fliC was shown to inhibit the occurrence of wilt disease caused by four species of wilt pathogens by more than 90%, and to inhibit the progression of disease of pathogens with a biofilm formation ability superior to that of fliC by less than 50%.

[0049] Furthermore, the control effect disappeared when the roots were wounded one day after fliC treatment and pathogen inoculation, and when WT was inoculated into the area where the first leaf peduncle was cut after fliC treatment, the control effect disappeared. Therefore, it was confirmed that fliC does not cause induced systemic resistance (ISR).

[0050] The present invention provides a composition for controlling tomato wilt disease comprising the mutant strain or a culture solution thereof.

[0051] In addition, the present invention provides a microbial preparation for controlling tomato wilt disease comprising the mutant strain or a culture solution thereof.

[0052] In order to solve another technical problem mentioned above, a method for controlling tomato wilt disease using the mutant strain or a culture solution thereof is provided.

[0053] In addition, the present invention provides a method for promoting tomato growth using a composition or microbial preparation containing the mutant strain.

[0054] Meanwhile, in the present invention, it was discovered that the Ralstonia pseudosolanacearum Gj707R strain has a tomato wilt control effect and a tomato growth promotion effect.

[0055] In the present invention, the genome of GMI1000, a standard strain of Ralstonia solanacearum species complex (RSSC), the genomes of three highly pathogenic strains, Wj644, Bs715, and WR-1, and the genomes of non-pathogenic strains Sw698, Gj707, and Cw717, and the genomes of human pathogens such as yellow fever bacteria, Escherichia coli, and food poisoning bacteria were compared and analyzed to select six host surface attachment proteins, RSp1065, RSp1180, RSc0115, RSc2796, RSc2797, and RSp1620, and the RSp1180 proteins of highly pathogenic strains GMI1000, Wj644, Bs715, and WR-1 and non-pathogenic strain Gj707 all have normal N, C-terminals and a size of 300 kDa or more, whereas those of non-pathogenic strains Sw698 and Cw717 The RSp1180 proteins were found to be small in size and each lacked either the N-terminus or the C-terminus.

[0056] According to one embodiment of the present invention, in tomato seedlings treated with Gj707 48 hours before inoculation with WR-1, a tomato pathogenic strain, the control rate of wilt disease was 87%, but pretreatment with Sw698 and Cw717 did not affect the progression of wilt disease caused by the same pathogen at all, confirming that the control ability of Gj707 against wilt disease is dependent on Adhesin.

[0057] According to one embodiment of the present invention, a single treatment with the Ralstonia pseudosolanacearum Gj707 strain promoted the growth of tomato seedlings by 32%, but when the pathogenic strain was subsequently inoculated, the disease was controlled but the growth promotion effect disappeared.

[0058] The present invention provides a tomato growth promotion composition characterized in that it comprises as an effective ingredient at least one selected from the group consisting of a non-pathogenic Ralstonia pseudosolanacearum Gj707 strain, a culture medium thereof, and an Adhesin protein, which is a RSp1180 protein represented by SEQ ID NO: 2.

[0059] In the present invention, the Ralstonia pseudosolanacearum Gj707 may be isolated from a tomato showing symptoms of wilt disease, and may be deposited with the National Institute of Agricultural Microbiology under the deposit number KACC 10707.

[0060] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0061] According to one embodiment of the present invention, the medium must meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art.

[0062] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0063] According to one embodiment of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20°C to 45°C, for example, 25°C to 40°C. The cultivation period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0064] According to one embodiment of the present invention, the culture may be Ralstonia pseudosolanacearum Gj707 cultured in CPG medium at 25 to 30°C under dark conditions for 1 to 5 days, preferably at 27 to 29°C under dark conditions for 1 to 3 days. If the culture conditions are not met, the degree of crop growth improvement is lowered, so the above range is preferred.

[0065] In addition, the present invention provides a microbial preparation for controlling tomato wilt disease or promoting tomato growth, comprising the composition.

[0066] In the present invention, the microbial preparation may be prepared in the form of, for example, a directly sprayable solution, powder, and suspension, or a highly concentrated aqueous, oily, or other suspension, dispersion, emulsion, oily dispersion, paste, dust, dustable material, or granule, but is not limited thereto.

[0067] The microbial preparation of the present invention can be formulated in various forms. These preparations can be prepared, for example, by adding a solvent and / or carrier. Inert additives and surface-active substances, such as emulsifiers or dispersants, can be mixed into the preparation. Suitable surface-active substances are aromatic sulfonic acids (e.g. lignosulfonic acid, phenol-sulfonic acid, naphthalene- and dibutylnaphthalenesulfonic acid), fatty acids, alkyl- and alkylarylsulfonates, alkyl lauryl ethers, alkali metal, alkaline earth metal and ammonium salts of fatty alcohol sulfates, sulfated hexa-, hepta- and octa-decanols, salts of fatty alcohol glycol ethers, sulfonated naphthalene and derivatives thereof, condensates with formaldehyde, condensates of naphthalene or naphthalenesulfonic acid, phenol and formaldehyde, polyoxyethyleneoctyl phenol ethers, ethoxylated isooctyl-, octyl- or nonylphenols, alkylphenyl or tributylphenyl polyglycol ethers, alkylarylpolyether alcohols, isotridecyl alcohols, fatty alcohol / ethylene oxide condensates, ethoxylated It may be, but is not limited to, castor oil, polyoxyethylene alkyl ether or polyoxypropylene, lauryl alcohol polyglycol ether acetate, sorbitol ester, lignin-sulfite waste liquor or methylcellulose.

[0068] Suitable solid carrier materials may, in principle, be any porous, agriculturally acceptable carrier, such as, but not limited to, mineral earths (e.g., silica, silica gel, silicates, talc, kaolin, limestone, lime, chalk, boll, loess, clays, dolomite, diatomaceous earth, calcium sulfate, magnesium sulfate, magnesium oxide, ground synthetic materials), fertilizers (e.g., ammonium sulfate, ammonium phosphate, ammonium nitrate, urea), plant products (e.g., cereal flour, bark flour, wood meal and nut shell flour) or cellulose powder. Furthermore, the solid carriers may be used alone or in combination of two or more.

[0069] The microbial preparation of the present invention can also be mixed with a dispersing agent, a penetrating agent, or a surfactant to increase absorption and effectiveness in the crop.

[0070] In addition, the present invention provides a method for controlling tomato wilt using a composition or microbial preparation containing the non-pathogenic Ralstonia pseudosolanacearum Gj707 strain.

[0071] In addition, the present invention provides a method for promoting tomato growth using a composition or microbial preparation containing the non-pathogenic Ralstonia pseudosolanacearum Gj707 strain.

[0072] In the present invention, the method may include a step of directly or indirectly treating the microbial preparation to the crop, and the direct treatment or indirect treatment may be used without limitation as long as it is a method widely known in the art, for example, a method of mixing the microbial preparation in water and irrigating the soil, a method of spraying the microbial preparation on the crop, etc. may be used, and a method of placing the microbial preparation near the crop may be used, but is not limited thereto.

[0073] In addition, in the present invention, when irrigating the soil with a microbial preparation, the concentration of bacteria can be adjusted by mixing distilled water with the microbial preparation, and the final concentration is 1 to 10×10 per ml. 8 It can be observed by the concentration of colony forming units (CFUs).

[0074] Another aspect of the present invention is a method comprising a step of directly or indirectly treating a crop with Ralstonia pseudosolanacearum Gj707 or a culture thereof, or an Adhesin protein, which is an RSp1180 protein represented by SEQ ID NO: 2, wherein the direct treatment or indirect treatment can be performed without limitation in any method widely known in the art, for example, by mixing Ralstonia pseudosolanacearum Gj707, a culture thereof, or an Adhesin protein, which is an RSp1180 protein represented by SEQ ID NO: 2, in water and drenching the soil, or by spraying Ralstonia pseudosolanacearum Gj707, a culture thereof, or an Adhesin protein, which is an RSp1180 protein represented by SEQ ID NO: 2, onto the crop.

[0075] In general, both pathogens and symbionts interact with plants and have their own habitats around, on, or inside the plant. Host recognition and surface attachment of pathogens are essential steps that must be taken for the expression of pathogenicity and the subsequent development of the plant-host relationship, as well as the development of the relationship between symbionts and plants. The coevolution of resistance genes and virulence genes promotes the differentiation of virulence genes, so resistance genes often have a limited application spectrum and resistance often collapses, whereas the host attachment of the bacteria studied in the present invention is a step that almost all bacteria, including RSSC, must go through, and thus can serve as a starting point for the development of site-specific, environmentally friendly, and sustainable synthetic agents applicable to a wide range of bacterial diseases.

[0076] Hereinafter, the present invention will be described in more detail through examples. These examples are intended merely to illustrate the present invention, and therefore, the scope of the present invention is not to be construed as being limited by these examples.

[0077]

[0078] <Example 1> Production and verification of flic

[0079] (1) After obtaining 500 bp of base sequences each upstream and downstream of fliC in WR-1 by PCR, the two base sequences are connected by PCR using a linker primer to confirm a 1 kbp amplicon. The amplicon is cloned into the pGEM-T vector and then digested with BamHI / XbaI to obtain a carrier part for gene deletion. Insert it into the BamHI, XbaI sites of the pEX18Tc carrier to produce pEX18Tc::fliC_KO, a carrier for fliC deletion. The accuracy is confirmed by restriction enzyme digestion and base sequence analysis.

[0080] Figure 1 illustrates the structure of pEX18Tc::fliC_KO, a carrier for fliC deletion.

[0081] The sequence below (SEQ ID NO: 1) shows the fliC gene (green) of the WR-1 strain and the base sequences of 500 bp each upstream and downstream.

[0082]

[0083]

[0084] (2) 5×10 2 μg of the above-mentioned pEX18Tc::fliC_KO cultured for 1 day 10 Mix with WR-1 cells. The mixture is plated on a cellulose acetate membrane placed on antibiotic-free casamino acid-peptone-glucose (CPG) medium and cultured for 1 day. The culture is plated and cultured on CPG medium supplemented with 100 μg ml-1 tetracycline, and transformants are selected. The transformants are cultured on TYS10 medium and recombinant cells are selected.

[0085] Figure 2 illustrates the structure of the WR-1 strain genome.

[0086] Figure 3 compares the structures of the WR-1 strain (wild type) and the fliC deletion mutant.

[0087] Figure 4 shows the PCR amplification results of the WR-1 strain (wild type) and the fliC deletion mutant.

[0088]

[0089] (3) After preparing a primer fliC_-96F (agacctggtccccttcaagt) (SEQ ID NO: 3) that runs from 96 bp above the fliC start site toward fliC and a primer fliC_+414R (ctgaaaggtggagagcgaac) (SEQ ID NO: 4) that runs from 414 bp below the fliC end site toward fliC, whether fliC is deleted in the genome of the recombinant is confirmed by PCR.

[0090]

[0091] (4) In the wild type WR-1, PCR using the fliC_-96F / fliC_+414R primer combination shows a 1,332 bp amplicon. On the other hand, in the selected reassortant clones fliC #1 and fliC #2, PCR using the same primer pair shows a 510 bp amplicon.

[0092]

[0093] <Example 2> Analysis of tomato wilt control and growth promotion by fliC treatment

[0094] Experimental method

[0095] Public strains WR-1 (wild type, WT), fliC (motile mutant), Wj644 (highly pathogenic wilt fungus)

[0096]

[0097] Strain cultivation

[0098] After culturing for 48 hours at 28℃ in dark conditions on CPG solid medium, sterilized water was poured to collect the cells, and the absorbance was measured at 600 nm. The concentration of the cells was 5×10 per ml. 8 It was titrated in colony forming units (CFUs).

[0099]

[0100] Tomato growth

[0101] Seedlings of the Choi-Ah-Han M82 variety were grown for 4 days under 16 / 8 photoperiod, 25℃, and absolute humidity conditions, and then grown in a hydroponic culture for 21 days under the same light conditions and temperature. Fifteen plants were placed per treatment group.

[0102]

[0103] treatment

[0104] Tomato seedlings were immersed in a fungal suspension for 4 hours and maintained at room temperature in a stationary state. When inoculated with WT (WR-1) or Wj644 after fliC treatment, the seedlings were cultured in a nutrient solution for 24 hours after fliC treatment, then immersed in a WT or Wj644 suspension for 4 hours and maintained at room temperature in a stationary state. Afterwards, the seedlings were continuously cultured under nutrient solution conditions, and the disease progression and seedling growth were examined. Tomato seedlings treated with sterile distilled water under the same conditions were placed as a control (Mock).

[0105]

[0106] Growth results test

[0107] Seven days after inoculation with WT or Wj644, disease severity and disease incidence were examined. After collecting all plants, the soil was removed, and fresh weight and aboveground length were measured.

[0108] Figure 5 shows the control effect of tomato wilt disease by fliC treatment. The control effect was measured by inoculating wild type WR-1 24 hours after fliC treatment, and measuring disease severity and disease incidence 6 days after inoculation.

[0109] Figure 6 shows the growth-enhancing effect of fliC treatment on tomato seedlings. The growth-enhancing effect was measured by inoculating wild type WR-1 24 hours after fliC treatment, and measuring fresh weight and above-ground length 6 days after inoculation.

[0110] As seen here, the strain with fliC deleted from the WR-1 strain genome (hereinafter referred to as fliC) completely lost its pathogenicity, and tomato seedlings treated with fliC showed a 26% increase in fresh weight compared to the untreated control.

[0111] When the WR-1 or Wj644 strain, a strong pathogen of wilt disease, was inoculated one day after fliC treatment, the control value was over 93% compared to the WR-1 or Wj644 strain inoculated alone.

[0112] Additionally, tomato seedlings inoculated with WR-1 or Wj644 after fliC treatment showed a 17% increase in fresh weight compared to the untreated control.

[0113]

[0114] <Example 3> Microbial culture

[0115] The strains used were WR-1 (wild type, WT), Gj707 (non-pathogenic wilt fungus), Sw698 (non-pathogenic wilt fungus), and Cw717 (non-pathogenic wilt fungus).

[0116] Figure 7 shows a comparison of the amino acid sequences of Adhesin RSp1180 by strain.

[0117] Specifically, Ralstonia pseudosolanacearum Gj707 was used as a microorganism deposited with the National Institute of Agricultural Microbiology under the accession number KACC 10707.

[0118] Table 1 below shows the protein sequence (SEQ ID NO: 2) of the Adhesin RSp1180 gene of Gj707.

[0119]

[0120]

[0121] <Example 4> Tomato growth

[0122] M82 cultivar seedlings were grown for 4 days under 16 / 8 photoperiod, 25℃, and absolute humidity conditions, and then grown for 21 days under hydroponic conditions under the same light conditions and temperature. Fifteen plants were placed per treatment group.

[0123]

[0124] <Test Example 1> Analysis of tomato wilt disease control and growth promotion by Gj707 treatment

[0125] Tomato seedlings were immersed in suspensions of Gj707, Sw698, and Cw717 for 4 hours and maintained at room temperature in a stationary state.

[0126] When WT (WR-1) was inoculated after each strain treatment, it was cultured in a nutrient solution for 24 hours after Gj707, Sw698, or Cw717 treatment, then immersed in a WT suspension for 4 hours and maintained at room temperature in a stationary state.

[0127] Afterwards, the plants were continuously cultured under nutrient solution conditions, and the disease progression and seedling growth were examined. Tomato seedlings treated with sterilized distilled water under the same conditions were placed as a control group (mock).

[0128] One day after Gj707 treatment, pathogenic WR-1 (WT) was inoculated, and 6 days later, the disease severity and disease incidence were examined, and all plants were collected and their fresh weights were measured.

[0129] Figure 8 shows the control effect of tomato wilt disease by Gj707 treatment. As shown here, tomato seedlings treated with Gj707 before inoculation with the tomato pathogenic strain WR-1 showed 87% wilt disease control, whereas pretreatment with Sw698 and Cw717 had no effect at all on the progression of wilt disease caused by the same pathogen. This suggests that the wilt disease control ability of Gj707 is dependent on adhesin.

[0130] Additionally, 1 day after Gj707 treatment, pathogenic WR-1 (WT) was inoculated, and 6 days later, the fresh weight of 3 representative seedlings and 15 total seedlings was measured.

[0131] Figure 9 shows the growth promotion effect of tomato seedlings by Gj707 treatment. As seen here, Gj707 treatment alone increased the fresh weight of tomato seedlings by 32% compared to the control group, but when pathogens were inoculated, no growth promotion effect was observed.

[0132]

[0133] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0134]

[0135] In this way, the microbial preparation containing the motile mutant strain according to the present invention or the metabolite causing a change in yield due to a flagellar protein gene defect can control tomato wilt disease at a level comparable to that of synthetic pesticides registered in an environmentally friendly and low-input manner. In addition, the microbial preparation containing the non-pathogenic Ralstonia pseudosolanacearum Gj707 strain according to the present invention or the Adhesin protein RSp1180 protein represented by SEQ ID NO: 2 can control tomato wilt disease at a level comparable to that of synthetic pesticides registered in the present invention. In addition, the tomato root attachment protein of the wilt pathogen can be used to develop a site-specific agent for wilt disease, and can perform highly efficient and public health-friendly management of wilt disease, for which there is currently no registered dedicated agent. Unlike general synthetic pesticides, such preparations are expected to increase tomato production and income of farmers because they promote tomato growth.

[0136]

[0137] [Accession number]

[0138] Name of depositor: National Institute of Agricultural Sciences, Rural Development Administration, Microbial Bank (KACC)

[0139] Accession number: KACC 81300BP

[0140] Date of acceptance: 20240522

[0141]

[0142] [Correction pursuant to Rule 91, January 13, 2025]

Claims

1. A mutant strain lacking fliC, a flagellar protein (flagellin) production gene, in the genome of Ralstonia solanacearum WR-1 strain.

2. In paragraph 1, The above mutant is a mutant strain lacking fliC, which is Ralstonia solanacearum fliC (Accession No.: KACC 81300BP).

3. A composition for controlling tomato wilt disease, characterized in that it comprises as an effective ingredient at least one selected from the group consisting of a mutant strain lacking fliC, a flagellar protein production gene, in the genome of Ralstonia solanacearum WR-1 strain, a culture medium thereof, a non-pathogenic Ralstonia pseudosolanacearum Gj707 strain, a culture medium thereof, and an Adhesin protein, which is a RSp1180 protein represented by sequence number 2.

4. In paragraph 3, A composition for controlling tomato wilt disease, characterized in that the above Ralstonia pseudosolanacearum Gj707 is isolated from a tomato exhibiting wilt disease.

5. In paragraph 3, A composition for controlling tomato wilt disease, characterized in that the above Ralstonia pseudosolanacearum Gj707 has been deposited with the Korean Agricultural Culture Collection (KACC) under the deposit number KACC 10707.

6. In paragraph 3, A composition for controlling tomato wilt disease, characterized in that the culture solution of the above Ralstonia pseudosolanacearum Gj707 strain is obtained by culturing Ralstonia pseudosolanacearum Gj707 in CPG (Casamino acid-Peptone-Glucose) medium at 25-30℃ under dark conditions for 1-5 days.

7. A microbial preparation for controlling tomato wilt, comprising a composition according to any one of claims 3 to 6.

8. A method for controlling tomato wilt disease using a mutant strain lacking fliC, a flagellar protein production gene, in the genome of Ralstonia solanacearum WR-1 strain, a culture medium thereof, a non-pathogenic Ralstonia pseudosolanacearum Gj707 strain, a culture medium thereof, and one or more selected from the group consisting of an Adhesin protein, RSp1180 protein represented by SEQ ID NO: 2, or a composition or microbial agent containing the same.

9. A composition for promoting tomato growth, characterized in that it comprises as an effective ingredient at least one selected from the group consisting of a mutant strain lacking fliC, a flagellar protein production gene, in the genome of Ralstonia solanacearum WR-1 strain, a culture medium thereof, a non-pathogenic Ralstonia pseudosolanacearum Gj707 strain, a culture medium thereof, and an Adhesin protein, which is a protein RSp1180 represented by sequence number 2.

10. In paragraph 9, A composition for promoting tomato growth, characterized in that the above Ralstonia pseudosolanacearum Gj707 is isolated from a tomato exhibiting wilt disease.

11. In paragraph 9, A composition for promoting tomato growth, characterized in that the above Ralstonia pseudosolanacearum Gj707 has been deposited with the Korean Agricultural Culture Collection (KACC) under the deposit number KACC 10707.

12. In paragraph 9, A composition for promoting tomato growth, characterized in that the culture solution of the above Ralstonia pseudosolanacearum Gj707 strain is obtained by culturing Ralstonia pseudosolanacearum Gj707 in CPG (Casamino acid-Peptone-Glucose) medium at 25-30°C under dark conditions for 1-5 days.

13. A microbial preparation for promoting tomato growth, comprising a composition according to any one of claims 9 to 12.

14. A method for promoting tomato growth using a mutant strain lacking fliC, a flagellar protein production gene, in the genome of Ralstonia solanacearum WR-1 strain, a culture medium thereof, a non-pathogenic Ralstonia pseudosolanacearum Gj707 strain, a culture medium thereof, and one or more selected from the group consisting of an Adhesin protein, RSp1180 protein represented by SEQ ID NO: 2, or a composition or microbial preparation containing the same.

Images