Promoter cis-acting element for regulating APO1 gene expression and application of promoter cis-acting element

By using gene editing technology to knock out the CRE3 sequence in the promoter region of the APO1 gene and regulate the expression of the APO1 gene, the time-consuming and labor-intensive problem of improving the panicle shape and yield of rice varieties was solved, and a significant increase in the number of grains per panicle and yield of rice was achieved, while the lodging resistance was improved.

CN120648682APending Publication Date: 2025-09-16YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510698542.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-28
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently improve the panicle shape and yield of rice varieties through molecular marker-assisted selection methods, and there are problems of being time-consuming and labor-intensive.

Method used

The CRE3 sequence in the APO1 gene promoter region was knocked out through gene editing technology, and the CRISPER/Cas9 system was used to regulate the expression of the APO1 gene. A specific guide sequence such as SEQ ID NO.22 was designed for editing to achieve upregulation of APO1 gene expression.

Benefits of technology

It significantly increases the number of grains per panicle and yield per plant, increases stem thickness, improves lodging resistance, and achieves rapid improvement in panicle shape and yield of rice varieties. It is superior to natural variation alleles and has high breeding value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648682A_ABST
    Figure CN120648682A_ABST
Patent Text Reader

Abstract

The invention discloses a promoter cis-acting element for regulating and controlling APO1 gene expression and application of the promoter cis-acting element, and belongs to the technical field of plant genetic engineering. From the perspective of APO1 gene expression regulation, a promoter cis-regulation region CRE3 for determining APO1 gene expression is found, and it is proved that a strain with the number of grains per ear and the yield of a single plant remarkably improved can be obtained by conducting editing knockout on a CRE3 sequence through CRISPER / Cas9, two-year plot testing shows that the yield is obviously increased, the stem diameter is increased, and the yield is obviously increased. The method can realize improvement of lodging resistance, can be used for rapid improvement of panicle type and yield of rice varieties, is superior to natural variation alleles in performance, and has extremely high application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a promoter cis-acting element for regulating APO1 gene expression and an application thereof. Background Art

[0002] Rice yield is primarily determined by panicle number, grain number per panicle, and 1000-grain weight. Previous studies have shown that grain number per panicle plays a major role in increasing yield in Chinese rice varieties, suggesting that improving panicle type is an effective approach to enhancing the yield potential of rice varieties. Panicle type is primarily determined by panicle length, primary and secondary branches per panicle, which together influence grain number per panicle. Panicle type differences among rice varieties are primarily determined by natural variation. Several quantitative trait loci (QTLs) for large panicles have been cloned, including dep1 and ipa1. However, these QTLs exhibit adverse linkage effects. For example, dep1 reduces plant height and grain size, while ipa1 reduces tiller number, resulting in trade-offs between yield traits. We previously pinpointed a panicle type QTL, qPL6, from a germplasm collection with thick stems and large panicles. This locus simultaneously increases panicle length, primary and secondary branches per panicle, leading to a significant increase in grain number per panicle without affecting tiller number. This ultimately results in increased yield per plant, making it of great value for breeding. In addition, this locus also moderately increases stem thickness, which has the potential to improve the plant's resistance to lodging (Quantitative trait locus analysis and fine mapping of the qPL6 locus for panicle length in rice, 2015, Theoretical and Applied Genetics, 128(6):1151-1161). The candidate gene for qPL6 is the panicle development regulatory gene APO1, whose expression is moderately upregulated to produce the aforementioned favorable panicle phenotype. Currently, the main method for utilizing this locus is molecular marker-assisted selection, and improving specific varieties requires 3-5 generations of backcrossing, which is very time-consuming and labor-intensive. Summary of the Invention

[0003] Technical problems solved: In response to the above technical problems, the present invention provides a promoter cis-acting element for regulating APO1 gene expression and its application. Starting from the perspective of APO1 gene expression regulation, the promoter cis-regulatory region CRE3 that determines APO1 gene expression was found, and it was proved that editing and knocking out the CRE3 sequence using CRISPER / Cas9 can obtain strains with significantly increased grain number per panicle and single plant yield. Two-year plot tests also showed a significant increase in yield and an increase in stem thickness, which can achieve an improvement in lodging resistance. It is proved that this method can be used to quickly improve the panicle type and yield of rice varieties, and its performance is better than that of natural variation alleles, and it has extremely high application value.

[0004] Technical Solution: In the first aspect, the present invention provides a promoter cis-acting element for regulating APO1 gene expression. The promoter cis-acting element for regulating APO1 gene expression is deleted from a subregion CRE3 sequence corresponding to the APO1 gene promoter region. The deleted sequence is shown in SEQ ID NO. 22. Deletion of the CRE3 sequence achieved through gene editing technology can upregulate APO1 expression. SEQ ID NO. 22 is as follows:

[0005] SEQ ID NO.22:

[0006] TGTGGAGAACTTGAGAGTTGTTTGGTGTATACCCCTATGCCGGTTGCTT CATATTCATCACAGCTGAACTGATTGATTGACCTGCGTGCAGAGCCTTGAAT ATTTCTCTCCTACACTCACCTGACAG.

[0007] Preferably, the primers for the guide sequence that delete the cis-acting element of the promoter that regulates the expression of the APO1 gene are as shown in SEQ ID NO.9 to SEQ ID NO.12, specifically:

[0008] SEQ ID NO.9: GGCACTCAAGTTCTCCACATGCTC;

[0009] SEQ ID NO.10: AAACGAGCATGTGGAGAACTTGAG;

[0010] SEQ ID NO.11: GCCGATCGATCTAGCTAGCTGTC;

[0011] SEQ ID NO. 12: AAACGACAGCTAGCTAGATCGAT.

[0012] In a second aspect, the present invention provides a recombinant vector comprising the promoter cis-acting element for regulating APO1 gene expression as described in the first aspect.

[0013] In a third aspect, the present invention provides a genetically engineered bacterium comprising the recombinant vector described in the second aspect.

[0014] Preferably, the expression strain of the genetically engineered bacteria is Agrobacterium.

[0015] In a fourth aspect, the present invention provides an application of the recombinant vector described in the second aspect or the genetically engineered bacteria described in the third aspect in rice genetic breeding and improvement, wherein the application is to increase the number of grains per panicle and the yield of rice.

[0016] Beneficial effects: Starting from the perspective of APO1 gene expression regulation, the present invention found the promoter cis-regulatory region CRE3 that determines APO1 gene expression, and proved that using CRISPER / Cas9 to edit the CRE3 sequence can obtain strains with significantly improved grain number per panicle and single plant yield. Two-year plot tests also showed a significant increase in yield, and the stem thickness increased, which can achieve an improvement in lodging resistance. This proves that this method can be used to quickly improve the panicle type and yield of rice varieties, and its performance is better than that of natural variation alleles, and it has extremely high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Figure 1 shows the expression changes of the APO1 gene and the comparative observation of its traits in the qPL6 near-isogenic line. Figure A shows the relative expression of APO1 in the qPL6 near-isogenic line and its wild type. Figure B shows the plant height of the qPL6 near-isogenic line and its wild type. Figure C shows the panicle type of the qPL6 near-isogenic line and its wild type.

[0018] Figure 2 This is a diagram showing the sequence variation information of the 5Kb region of the APO1 promoter corresponding to the qPL6 near-isogenic line;

[0019] Figure 3 Schematic diagram of the APO1 promoter region sequencing peaks (A) and two subregion knockout sequences (B) obtained by ATAC-seq; the underlined lines in Figure B correspond to the two guide sequences for knockout of different subregions, the yellow highlighted bases are the deleted sequences, and the blue bases are the PAM sequences next to the guide sequences;

[0020] Figure 4 Figure 2 compares the effects of knockout of CRE2 and CRE3 subregions on gene expression and agronomic traits. Figure A shows the relative expression of APO1 in the CRE2 and CRE3 knockout lines and their respective wild-type controls. Figure B shows the plant height and panicle length of the CRE2 knockout line and its wild-type control. Figure C shows the panicle type of the CRE3 knockout line and its wild-type control. Figure D shows the plot yield of the CRE3 knockout line and its wild-type control in 2021 and 2023.

[0021] Figure 5 This is a diagram of sequence variation information obtained by sequencing across the CRE2 and CRE3 regions in 268 natural rice varieties. DETAILED DESCRIPTION

[0022] The present invention is described in detail below in conjunction with specific embodiments:

[0023] Example 1: Clarifying the panicle type and yield effects of qPL6

[0024] A near-isogenic line of qPL6 (NIL-qPL6) and its wild-type (NIL-WT) from the Nipponbare background were sown in the field in Yangzhou, with 20 plants of each line planted. After jointing, panicle primordium tissue was harvested and RNA was extracted using the Trizol method. RNA was reverse-transcribed into cDNA using the Novozymes reverse transcription kit (HiScript III RT SuperMix for qPCR, R323-01) and then analyzed by qRT-PCR. The target gene was APO1, and the reference gene was OsActin. The primer sequences are shown in Table 1 (SEQ ID NOs. 1 to 4).

[0025] Table 1 Primer information for different purposes

[0026]

[0027] The target gene and internal reference gene were amplified for each sample, and three replicates were set up. Each replicate reaction system was 20 μL, containing 10 μL of 2×Q3 SYBR qPCR Master Mix of Tolo Biotechnology, 0.5 μL of each forward and reverse primer of the gene, and 2 μL of cDNA template, which was filled to 20 μL with ddH2O. The reaction system was amplified in a BIO-RAD real-time fluorescence quantitative PCR instrument. After the reaction was completed, an Excel spreadsheet containing the CT values ​​of the target genes and internal reference genes of different samples was exported, and the double △ method was used to calculate the expression level of the target gene relative to the internal reference gene. The results are shown in the figure. Figure 1 As shown in A: The expression of APO1 gene in the qPL6 near-isogenic line was significantly higher than that in the control line.

[0028] Previous studies have found that the qPL6 coding region contains only two SNPs and a 9bp deletion, which have little effect on the protein coding sequence. Therefore, it is believed that the difference in APO1 gene expression may be the cause of the qPL6 phenotype. At maturity, phenotypic observations and yield-related agronomic traits of qPL6 near-isogenic lines were conducted, including ear length, number of primary branches per ear, number of secondary branches per ear, number of grains per ear, 1000-grain weight, and yield per plant. The results are as follows Figure 1 As shown: Visual observation revealed no difference in plant height and growth period between the qPL6 near-isogenic line and the wild type ( Figure 1 Middle B), the comparison of ear shape showed that the qPL6 near-isogenic line had a longer ear length ( Figure 1 The statistical analysis of the traits is shown in Table 2 below:

[0029] Table 2 Yield-related traits of qPL6 near-isogenic lines

[0030]

[0031] The ear length, number of primary branches per ear, number of secondary branches per ear and number of grains per ear of the qPL6 near-isogenic line were significantly higher than those of the control, while there were no significant differences in number of ears and 1000-grain weight. The yield per plant increased but did not reach a significant level.

[0032] Example 2: Exploring the causes of differential expression of the APO1 gene

[0033] The promoter region of the APO1 gene in the qPL6 near-isogenic line was amplified by PCR within 5 Kb, and the amplified product was sequenced by Sanger sequencing. Figure 2 As shown: Compared with Nipponbare, there are 56 nucleic acid variations in the APO1 promoter region corresponding to qPL6, including 10 small insertion and deletion variations and 46 SNPs. Such a large number of variations makes it difficult to determine the key regions that regulate APO1 expression. ATAC-seq is a high-throughput identification technology used to find the core cis-regulatory elements of gene promoters. In order to explore the key regulatory regions of the APO1 promoter region, we performed ATAC-seq sequencing on rice panicle primordium tissues. The specific operation was carried out by Guangzhou Kidio Biotechnology Co., Ltd. After obtaining the sequencing Bam file, the IGV browsing tool (Integrative Genomics Viewer) was used to read the Bam file and focus on the APO1 promoter region, as shown in the figure. Figure 3 As shown in A: There is a clear sequencing peak at -3.5 to -4 kb upstream of the promoter, indicating that this is a transcriptional regulatory protein binding-enriched region.

[0034] In order to clarify the regulatory function of this interval, the region was further divided into two subregions, CRE2 and CRE3, and a pair of CRISPER / Cas9 guide sequence primers were designed for each subregion for sequence knockout verification. The guide sequence primers are shown in SEQ ID NO.5-SEQ ID NO.12 in Table 1. The guide primer combinations for knockout of the CRE2 region are CRE2-U3-F / R and CRE2-U6-F / R, and the guide primer combinations for knockout of the CRE3 region are CRE3-U3-F / R and CRE3-U6-F / R. The F and R sequences of any set of primers can form reverse complementary primer dimers and sticky ends recognized by the BsaI restriction endonuclease. After obtaining the guide sequence primers, they were dissolved in ddH2O, denatured at 95°C, and then gradually cooled to room temperature to form primer dimers. A pair of guide sequence primers targeting specific subregions were ligated into BsaI-digested pYL-U3 and pYL-U6a vectors, respectively, to fuse the guide sequences with the sgRNAs in the vectors. The sgRNAs and fused guide sequences in both vectors were then amplified by PCR and simultaneously ligated into the pYLCRISPR / Cas9-MTmono vector, ultimately generating two CRISPER / CAS9 editing vectors that knocked out the CRE2 and CRE3 regions, respectively. The pYL-U3, pYL-U6a, and pYLCRISPR / Cas9-MTmono vectors were provided by Professor Liu Yaoguang's laboratory at South China Agricultural University. Subsequently, calli induced from mature rice embryos were transformed using Agrobacterium tumefaciens EHA105 (commercially competent, Shanghai Weidi Biotechnology). Transgenic seedlings were obtained after hygromycin resistance selection, differentiation, and rooting. Transgenic seedlings were grown in the greenhouse. DNA was extracted using the TPS mini-extraction method and PCR amplified using Novagen 2× Taq Master Mix (Dye Plus, P112-01). Primers were HFP3 / 4 (see SEQ ID NOs. 13-14 in Table 1). A 20 μL reaction volume consisted of 10 μL of PCR mix, 2 μL of DNA template, and 0.5 μL of each primer. The volume was then filled to 20 μL with ddH2O. A standard PCR amplification protocol was used: a 1-minute initial denaturation at 95°C, followed by 30 cycles of denaturation at 95°C for 20 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 20 seconds, followed by a final extension at 72°C for 5 minutes. Amplified products were subjected to electrophoresis on a 1% agarose gel. The presence of a band approximately 1 kb indicated that the corresponding seedling was positive.At the same time, the amplification primers CRE2Chk-F / R and CRE3Chk-F / R covering the two subregions were designed and synthesized (see SEQ ID NO.15-SEQ ID NO.18 in Table 1). The PCR conditions were the same as above, except that the annealing temperature was changed to 55°C. The amplified products were subjected to 3% agarose gel electrophoresis. If the target sequence was successfully knocked out, the amplified band would become smaller. For the CRE2 knockout line, 13 strains were identified, and four knockout strains were obtained, three of which were homozygous deletions and named CRE2-Del; for the CRE3 knockout line, 10 strains were identified, and two knockout strains were obtained, both of which were homozygous deletions and named CRE3-Del. Subsequently, Sanger sequencing was performed on the PCR amplification products of the above-mentioned deletion strains to clarify the specific deletion sequences of the two subregions (such as. Figure 3 (Shown in B): The GCTAGGGCGTAGACGCGTAGTAGTAGTAGTAGCTAGGGATCTCTGCCTGCT sequence (numbered as SEQ ID NO.21) between the two guide sequences in the CRE2 region was completely knocked out, with a length of 51 bp, corresponding to the interval range of -3578 bp to -3628 bp upstream of the promoter; the TGTGGAGAACTTGAGAGTTGTTTGGTGTATACCCCTATGCCGGTTGCTTCAT ATTCATCACAGCTGAACTGATTGATTGACCTGCGTGCAGAGCCTTGAATATTTCTCTCCTACACTCACCTGACAG sequence (numbered as SEQ ID NO.22) between the two guide sequences in the CRE3 region was completely knocked out, with a length of 127 bp, corresponding to the interval range of -3852 bp to -3978 bp upstream of the promoter. Therefore, the guide knockout primers designed for the two subregions can effectively achieve large fragment deletion of the target region sequence.

[0035] Example 3: Assessing the precise phenotypic effects of CRE2 and CRE3 sequence deletions

[0036] Since background mutations are easily generated during genetic transformation callus regeneration, resulting in random phenotypic changes, in order to accurately evaluate the precise phenotypic effects caused by the deletion of CRE2 and CRE3 sequences, the deletion lines were backcrossed with the wild-type Nipponbare, and the obtained heterozygous single plants were screened for multiple generations of heterozygous single plant single grains in combination with the above-mentioned deletion identification primers (see SEQ ID NO.15-SEQ ID NO.18 in Table 1). Finally, a pair of genotype homozygous knockout lines (Del) and their wild-type sister lines (WT) were obtained for detailed phenotypic analysis and yield determination. In 2021, the knockout lines (CRE2-Del and CRE3-Del) of the two sub-regions and their wild-type controls (CRE2-WT and CRE3-WT) were sown in the field, and the young panicle primordia were sampled and RNA was extracted during the jointing stage. qRT-PCR analysis of the APO1 gene was carried out to clarify the effects of knockout of different core regulatory elements on the expression of the target gene. The results are shown in Figure 2. Figure 4 As shown in Figure 2, CRE2 knockout had no effect on APO1 expression, while CRE3 knockout led to upregulation of APO1 expression, which was consistent with the effect trend of natural variation of qPL6 (e.g. Figure 4 Furthermore, the plant and ear phenotypes of the two knockout lines and their wild-type controls were observed at maturity, and statistical analysis of yield-related traits was performed. The results showed that CRE2 knockout appeared to slightly reduce plant height and ear length (as shown in Figure 2A). Figure 4 Statistical analysis showed that the CRE2 knockout line had a statistically significant difference in ear length compared to the wild type, with ear length being slightly reduced compared to the wild type. However, there were no significant changes in the number of primary and secondary branches per ear, the number of grains per ear, or the yield per plant. In addition, the stem diameter trait of the knockout line was slightly reduced, as shown in Table 3 below for 2021CRE2-WT and 2021CRE2-Del:

[0037] Table 3 Trait performance of CRE2 knockout lines in different years

[0038]

[0039] Knockout of CRE3 had no effect on growth period and plant height, but the panicle shape was significantly enlarged (e.g. Figure 4 Statistical analysis showed that it could significantly increase ear length, number of primary branches per ear, number of secondary branches per ear, number of grains per ear, and yield per plant, and could increase stem diameter (as shown in 2021CRE3-WT and 2021CRE3-Del in Table 4), and had a certain lodging resistance, which was similar to the trait regulation effect of natural variation of qPL6.

[0040] Table 4 Trait performance of CRE3 knockout lines in different years

[0041]

[0042] To further clarify the reliability of the knockout line phenotypes, the phenotypes of the relevant strains were planted in 2023. It was found that the CRE2 knockout line only showed differences in the number of ears, which increased compared with the wild type, but had no effect on the ear type and yield traits (as shown in 2023CRE2-WT and 2023CRE2-Del in Table 3); while the CRE3 knockout still steadily increased the ear length, the number of secondary branches per ear, the number of grains per ear and the yield per plant, but no promoting effect on the primary branches per ear was detected, indicating that its regulation of this trait is easily affected by the environment (as shown in 2023CRE3-WT and 2023CRE3-Del in Table 4).

[0043] In order to clarify the yield-increasing value of CRE3 knockout, we also conducted plot yield analysis in two years and found that the knockout line can significantly increase the plot yield (such as Figure 4 (shown in D), with yield increases of approximately 23% in 2021 and as high as 41.5% in 2023. Yield analysis over two seasons demonstrates that CRE3 knockout can steadily increase rice population yield. In summary, the present invention demonstrates that sequential knockout of CRE3 can simultaneously increase yield and lodging resistance in rice plants without trade-offs with other yield traits. This performance surpasses that of the existing qPL6. Because homozygous deletion plants can be obtained in the transgenic T0 generation, knockout lines constructed by eliminating the transgene can be obtained through marker screening within a year, demonstrating their significant value in the field of rice gene editing breeding.

[0044] Example 4: Exploring whether CRE3 also has similar deletions in natural species

[0045] To determine whether similar deletions exist in natural varieties of CRE3, 268 different types of rice materials were collected worldwide, including temperate japonica rice (TEJ), tropical japonica rice (TRJ), indica rice (IND), autumn rice (AUS), aromatic rice (ARO), mixed type (ADM), and undetermined type (ND). DNA was extracted from these rice materials, and PCR amplification and Sanger sequencing across the CRE2 and CRE3 regions were performed using CRE23Seq-3F / R primers (see SEQ ID NO.19-SEQ ID NO.20 in Table 1). Comparison with the Nipponbare reference sequence revealed that only five SNPs were present among all varieties, two of which were located in the CRE2 and CRE3 subregions, respectively, but no sequence deletions were present (such as Figure 5 This demonstrates that the superior deletion type of CRE3 does not exist in nature, and that the present invention, for the first time, has obtained a new mutation through gene editing methods that can simulate the beneficial mutation effects of natural populations.

[0046] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A regulation APO1 A promoter cis-acting element for gene expression, characterized in that: The regulation APO1 The deletion of cis-acting elements in the promoter of gene expression corresponds to APO1 The subregion CRE3 sequence of the gene promoter region is deleted as shown in SEQ ID NO.

22. Deleting the CRE3 sequence can upregulate APO1 Gene expression level.

2. A control according to claim 1 APO1 A promoter cis-acting element for gene expression, characterized in that: Make the regulation APO1 The primers for the guide sequence in which the cis-acting element of the promoter of gene expression is deleted are shown in SEQ ID NO. 9 to SEQ ID NO.

12.

3. A recombinant vector, characterized in that: Containing the regulation of claim 1 APO1 Promoter cis-acting elements of gene expression.

4. A genetically engineered bacterium, characterized in that: Contains the recombinant vector according to claim 3.

5. The genetically engineered bacterium according to claim 4, characterized in that: The expression strain of the genetically engineered bacteria is Agrobacterium.

6. Use of the recombinant vector according to claim 3 or the genetically engineered bacteria according to claim 4 in rice genetic breeding and improvement, characterized in that: The application is to increase the number of grains per panicle and the yield of rice.