Method for improving protein expression quantity of protein expression system
By replacing the third base after the start codon in the target protein gene with G, the protein expression level in Escherichia coli was increased, the problem of insufficient protein expression was solved, and efficient and low-cost protein production was achieved.
Patent Information
- Application Number
- CN202510806601.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-17
- Publication Date
- 2025-09-16
AI Technical Summary
In existing genetic engineering technologies, insufficient protein expression leads to high production costs, affecting the research and development of protein raw materials and production efficiency.
By replacing the third base after the start codon in the target protein gene with G, the protein expression amount is increased. The Escherichia coli protein expression system is preferred, and recombinant expression is carried out using PET-28a and Pcdna3.1 plasmids. High-purity protein is obtained by nickel column purification.
Significantly increase protein expression, reduce production costs, maintain protein performance unchanged, and improve the cost-effectiveness of protein production.
Smart Images

Figure CN120648715A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a method for increasing the protein expression amount in a protein expression system. Background Art
[0002] Building on the development of genetics, molecular biology, biochemistry, microbiology, and other disciplines, genetic engineering (also known as recombinant DNA technology) emerged in the early 1970s. This technology involves inserting nucleic acid molecules into plasmids, viruses, or other vector molecules in vitro to create new combinations of genetic material, which are then introduced into host cells for stable amplification and expression in the new genetic context.
[0003] Genetic engineering technology is a powerful tool for studying protein function and structure and screening targeted drugs, playing a vital role in basic science and medicine. Due to its advantages of short development cycles and high efficiency, genetic engineering has been increasingly used by IVD manufacturers in recent years to develop and produce diagnostic reagent antigens and antibodies, including Hytest, Medix Bio, Meridian Bio, and Feipeng Bio. Currently, genetic engineering expression systems include prokaryotic and eukaryotic expression systems, with specific sub-areas divided into five major expression host cells / bacteria: Escherichia coli (E. coli), Chinese hamster ovary (CHO cells), human kidney epithelial cell line (293 cells), insect cells (Sf9), and yeast cells.
[0004] The level of protein expression yield determines the cost of protein raw material research and development and production. Protein yield is primarily determined by three factors: the expression plasmid (plasmid sequence: promoter sequence, promoter, tail poly A, transcription initiation element, etc.), the expression host (E. coli, yeast, mammalian cells, insect cells), and the expression conditions (carbon dioxide concentration, culture medium composition, shaker speed, etc.). Summary of the Invention
[0005] The present invention is achieved through the following technical solutions:
[0006] This patent proposes a theory: when the third base after the start codon of a protein gene is G, the protein expression level can be greatly increased without affecting the original performance of the protein.
[0007] The present invention provides a method for increasing the protein expression amount of a protein expression system, comprising replacing the first codon after the start codon in the gene of a target protein with a codon in which the third position of the same amino acid is G to obtain a target gene; and introducing the target gene into an expression system for protein expression.
[0008] Preferably, the protein expression system is an Escherichia coli protein expression system.
[0009] Preferably, the target protein is CRP protein.
[0010] Preferably, the gene sequence of the CRP protein is shown as SEQ ID No. 23.
[0011] Preferably, the first amino acid after the start codon of the target protein is at least one of serine, leucine, proline, arginine, alanine, glycine, and glutamic acid.
[0012] The present invention has but is not limited to the following beneficial effects:
[0013] This patent demonstrates that when the third base after the start codon of a protein gene is G, protein expression levels can be effectively increased without affecting protein performance. Compared to other methods, this invention significantly increases protein recombinant expression yields and reduces protein production costs, offering a high cost-effectiveness.
[0014] The present invention provides a method for increasing protein expression yield. The third base after the start codon is G, i.e., GCCA / GCCAUGXXG, which can improve protein expression efficiency.
[0015] The present invention provides a gene sequence for preparing CRP protein. This gene sequence is the technical key of the present invention. Any method of preparing CRP recombinant protein using this sequence is within the scope of protection of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to clearly illustrate the specific implementation methods of the present invention and certain detection technologies used in the experiments, the implementation methods and the technologies used will be described below, mainly in the form of drawings.
[0017] Figure 1 This is a codon table for the 20 common amino acids.
[0018] Figure 2 Electrophoresis was used to check the purity of proteins.
[0019] Figure 3 To detect the purity of recombinant CRP protein by electrophoresis.
[0020] Figure 4 Luminescent platform detection of recombinant CRP protein. DETAILED DESCRIPTION
[0021] The specific implementation methods of the present invention are explained with the aid of examples. Except that the technology used for detection does not impose any form of limitation on the present invention, some schemes in the described embodiments are part of the embodiments of the invention. The embodiments obtained by ordinary technical operators in this field without creative results are all within the scope of protection of the present invention.
[0022] Example 1 Gene Synthesis
[0023] Figure 1 As shown, according to the "20 amino acid codon table", this patent selects the following 7 amino acids for expression experiments: serine, leucine, proline, arginine, alanine, glycine, and glutamic acid. These amino acids all have multi-codon characteristics, and the first two bases of their amino acid codons are consistent, and the third base is inconsistent (there are cases where G, A, and C are detected).
[0024] This patent recombinantly expresses a protein whose amino acid and gene sequences are shown in Table 1.
[0025] Table 1 Amino acid and gene sequences of recombinant expressed proteins
[0026]
[0027] One of the above seven amino acids (serine, leucine, proline, arginine, alanine, glycine, and glutamate) was added to the first amino acid of the protein sequence except the start codon, and different codons were verified. A total of 20 gene sequences were synthesized. The specific gene sequences are shown in Table 2.
[0028] Table 2 Synthetic gene sequences
[0029]
[0030]
[0031]
[0032] The above genes all have his tags at the ends, are constructed into PET-28a and Pcdna3.1 plasmids, and are expressed using Escherichia coli and 293 cells.
[0033] Example 2 Expression and purification in Escherichia coli and 293 cells
[0034] 1. E. coli expression system
[0035] 1.1 Conversion
[0036] 1) Get the plasmid and centrifuge (3000 rpm; 2 min);
[0037] 2) Add TE to the plasmid, usually 1 μg of plasmid plus 20 μl of TE;
[0038] 3) Mix the plasmid and TE, pipette 2 μL of the mixture and mix it with the competent cells;
[0039] 4) Place the competent cells in a refrigerator (4°C) for 30 minutes;
[0040] 5) After taking out, immediately put it into a water bath (42℃) and heat shock for 90s.
[0041] 6) Place in refrigerator (4°C) again for 3 minutes
[0042] 7) Take out 200 μL of LB liquid medium and add it to the competent cells that have been transformed with the plasmid
[0043] 8) Place in a shaker (37°C; 195°C) for 30 minutes to 60 minutes (optimal 45 minutes).
[0044] 9) Take out and centrifuge (3000r / min; 2min)
[0045] 10) Remove 200 μL of supernatant and keep about 100 μL of supernatant to suspend the precipitate. Pipette 50 μL of the suspension onto a plate and place the plate in an incubator (37°C) overnight (12 to 16 hours).
[0046] 1.2 Expression identification
[0047] Pick a single colony from each plate and transfer it to four 4ml LB tubes corresponding to the resistance, numbering them "0," "1," "2," and "3." Place the tubes in a shaker (37°C; 195°C). Incubate overnight. Transfer 700μL of the suspension from each tube to 100μL of seed-preserving glycerol (C = 80%), shake well, and freeze at -20°C.
[0048] Add 2 μL of IPTG (optimal final concentration is 0.5 mM) to test tubes “0”, “1”, “2” and “3” of each group of bacteria, respectively, and express at 37°C for 4 h.
[0049] From each of the four test tubes in each group, 500 μL of bacterial suspension was added to a 1.5 mL centrifuge tube. Centrifuge at 6000 rpm for 5 minutes, remove the supernatant, and analyze by electrophoresis. If the protein expression level is good, sample from tube "1" was used for protein purification; if the protein expression level is low or absent, no purification was performed.
[0050] 2. 293 cell expression
[0051] The cell density should be 3×106 cells / mL the day before transfection, and the cell density should be 6-7.0×106 cells / mL on the second day of culture.
[0052] After cell counting on the second day of culture, if the cell viability is >95% and the viable cell density is ≥6.0×10 6 cells / mL, fresh culture medium can be used directly.
[0053] The culture medium was diluted to 3.0×10 6 cells / mL; if the cell density was lower than 4.0×10 6 cells / mL, the cells could be centrifuged (800 rpm,
[0054] 5 min) and the cells were collected and resuspended in basal culture medium at a density of 3.0×10 6 cells / mL.
[0055] Prepare the DNA and transfection reagent mixture according to the optimized transient transfection process; take the monoclonal antibody transfection of 20ml system as an example:
[0056] A: Plasmid (40ug) + 600ul (plasmid dilution solution)
[0057] B: Transfection reagent PEI (10uL) + 600ul (diluent)
[0058] Add Solution B to Solution A by rapidly pipetting 10-15 times or shaking for 5-10 seconds to mix thoroughly. Let stand at room temperature for 5 minutes (the mixture can be used after standing at room temperature for 2-5 minutes and can be stable at room temperature for 2 hours). Add the mixture all at once to the mixed cell culture medium and culture. After 18-22 hours of culture, add feed. Terminate the culture until viability is less than 60%.
[0059] 3. Protein Purification
[0060] Protein purification was performed using a nickel column as follows:
[0061] 3.1 Preparation of buffer
[0062] The water and chemical reagents required to prepare the buffer solution must be of high purity and must be filtered through a 0.45 μm microporous membrane before use.
[0063] Equilibration buffer: 20 mM PB, 0.5 M NaCl, pH 7.4
[0064] Wash buffer: 20 mM PB, 0.5 M NaCl, 0-30 mM imidazole, pH 7.4
[0065] Elution buffer: 20 mM PB, 0.5 M NaCl, 50-500 mM imidazole, pH 7.4
[0066] Note: It is not recommended to add imidazole to the sample and equilibration buffers. The optimal concentration of imidazole in the wash buffer depends on
[0067] Depending on the protein sample, for most cases, an imidazole concentration of 0-20 mM can usually be selected; 3.2 Sample Preparation
[0068] Before loading, remove host cell debris by centrifugation or other methods, and then filter through a 0.45 μm microporous membrane. To maximize loading capacity, do not add imidazole to the equilibration buffer and sample protein solution.
[0069] Purification steps
[0070] 1) Cleaning: First, rinse with pure water for 5 column volumes to remove the ethanol in the medium;
[0071] 2) Equilibrate with equilibration buffer for at least 5 column volumes
[0072] 3) Loading the sample;
[0073] 4) Wash with wash buffer for 20 column volumes;
[0074] 5) Elution: Generally, 5 column volumes are enough to wash out the protein.
[0075] Example 3: Protein yield and purity
[0076] The 20 gene sequences synthesized in Example 1 were expressed in E. coli and purified by nickel column affinity to obtain protein samples, and their protein yields were counted. The specific results are shown in Table 3.
[0077] Table 3. Protein yield
[0078]
[0079] The test results are shown in the figure above. In the E. coli expression system, when the third base after the start codon is G, protein expression is significantly higher than when the other bases are present. The results were consistent across all seven amino acids.
[0080] In the 293 cell expression system, a G as the third base after the start codon does not significantly increase protein expression.
[0081] The samples with the highest yield of each of the 7 amino acids expressed by E. coli were taken for electrophoresis to detect the purity of the purified protein. The test results were as follows: Figure 2 As shown, the protein purity is high. Figure 2 Specifically, lane 1: serine; lane 2: leucine; lane 3: proline; lane 4: arginine; lane 5: alanine; lane 6: glycine; and lane 7: glutamate.
[0082] Example 4: Verification of recombinant protein performance
[0083] The viewpoint of this patent: When the third base after the start codon is G, the protein yield can be effectively and significantly increased without affecting the performance of the expressed protein.
[0084] To prove the above point, the patent recombinantly expresses CRP protein, and its recombinant expression 1 (the third base after the start codon is G) gene is as follows (as shown in SEQ ID No. 23): ATGGA G AAGCTGTTGTGTTTCTTGGTCTTGACCAGCCTCTCTCATGCTTTTGGCCAGACAGACATGTCGAGGAAAGCTTTTGTGTTTCCCAAAGAGTCGGATACTTCCTATGTATCCCTCAAAGCACCGTTAACGAAGCCTCTCAAAGCCTTCACTGTGTGCCTCCACTTCTACACGGAACTGTCCTCGAC CCGTGGGTACAGTATTTTCTCGTATGCCACCAAGAGACAAGACAATGAGATTCTCATATTTTGGTCTAAGGATATAGGATACAGTTTTACAGTGGGTGGGTCTGAAATATTATTCGAGGTTCCTGAAGTCACAGTAGCTCCAGTACACATTTGTACAAGCTGGGAGTCCGCCTCAGGGATCGTGG AGTTCTGGGTAGATGGGAAGCCCAGGGTGAGGAAGAGTCTGAAGAAGGGATACACTGTGGGGGCAGAAGCAAGCATCATCTTGGGGCAGGAGCAGGATTCCTTCGGTGGGAACTTTGAAGGAAGCCAGTCCCTGGTGGGAGACATTGGAAATGTGAACATGTGGGACTTTGTGCTGTCACCAGAT GAGATTAACACCATCTATCTTGGCGGGCCCTTCAGTCCTAATGTCCTGAACTGGCGGGCACTGAAGTATGAAGTGCAAGGCGAAGTGTTCACCAAACCCCAGCTGTGGCCCTAAAAGCTTGGGAGGGTTCGATCCCTACCGGTTAGTAACACCACCACCACCACCACTAAAAAAAAAAAAAAAAAA
[0085] The recombinant expression of CRP protein, the recombinant expression 2 (the third base after the start codon is A) gene is as follows (as shown in SEQ ID No. 24)
[0086] ATGGA A AAGCTGTTGTGTTTCTTGGTCTTGACCAGCCTCTCTCATGCTTTTG
[0087] GCCAGACAGACATGTCGAGGAAAGCTTTTGTGTTTCCCAAAGAGTCGGAT
[0088] ACTTCCTATGTATCCCTCAAAGCACCGTTAACGAAGCCTCTCAAAGCCTTC
[0089] ACTGTGTGCCTCCACTTCTACACGGAACTGTCCTCGACCCGTGGGTACAGT
[0090] ATTTTCTCGTATGCCACCAAGAGACAAGACAATGAGATTCTCATATTTTGGT
[0091] CTAAGGATATAGGATACAGTTTTACAGTGGGTGGGTCTGAAATATTATTCGA
[0092] GGTTCCTGAAGTCACAGTAGCTCCAGTACACATTTGTACAAGCTGGGAGTC
[0093] CGCCTCAGGGATCGTGGAGTTCTGGGTAGATGGGAAGCCCAGGGTGAGGA
[0094] AGAGTCTGAAGAAGGGATACACTGTGGGGGCAGAAGCAAGCATCATCTTG
[0095] GGGCAGGAGCAGGATTCCTTCGGTGGGAACTTTGAAGGAAGCCAGTCCCT
[0096] GGTGGGAGACATTGGAAATGTGAACATGTGGGACTTTGTGCTGTCACCAGA
[0097] TGAGATTAACACCATCTATCTTGGCGGGCCCTTCAGTCCTAATGTCCTGAAC
[0098] TGGCGGGCACTGAAGTATGAAGTGCAAGGCGAAGTGTTCACCAAACCCCA
[0099] GCTGTGGCCCTAAAAGCTTGGGAGGGTTCGATCCCTACCGGTTAGTAACAC
[0100] CACCACCACCACCACTAAAAAAAAAAAAAAAAAA
[0101] E. coli was used for induction expression and nickel column was used for protein purification. The specific process was as described in Example 2. The protein yield obtained by purification is shown in Table 4 below:
[0102] Table 4. CRP recombinant protein yield
[0103]
[0104] As shown above, when the third base after the start codon is G, the protein expression level of E. coli is higher.
[0105] 4.1 Protein purity
[0106] The protein purity was detected by SDS-PAGE. Figure 3 As shown in the figure, the purity of both recombinant proteins was high. Subsequent protein activity assays were performed using only the recombinantly expressed protein 1 (the third base after the start codon is G) for verification.
[0107] 4.2 Protein titer detection The protein titer was detected by indirect ELISA method, and the specific process and experimental operation are shown below.
[0108] 1) Carbonate coating buffer
[0109] Carbonate coating buffer (0.05 mol / L, pH 9.6): 1.69 g Na7CO3, 2.86 g NaHCO3, dilute to 1 L with ultrapure water, filter with a 0.45 μm filter membrane, and store at room temperature.
[0110] 2) Blocking solution (1% BSA-PBS-0.05% NaN3)
[0111] BSA 1g
[0112] PBS 100ml
[0113] 1 ml of 5% NaN3 stock solution
[0114] Filter through a 0.45 μm filter membrane and store at 4°C for 12 h.
[0115] 3) Protective solution (4% sucrose-PBS)
[0116] 4g sucrose
[0117] PBS 100ml
[0118] Filter through a 0.45 μm filter membrane and store at 4°C for 12 h.
[0119] 4) Color development solution
[0120] Substrate color development solution A: 13.6g sodium acetate, 1.6g citric acid, 0.3ml 30% hydrogen peroxide, add distilled water to 500ml.
[0121] Substrate color development solution B: 0.2g disodium EDTA, 0.95g citric acid, 50ml glycerol, 0.15g UMB, add distilled water to 500ml.
[0122] 5) Stop solution
[0123] Use concentrated sulfuric acid and dilute to a concentration of 2 mM.
[0124] 6) Elisa plate preparation operation
[0125] ① Dilute the capture protein (antibody for double-antibody sandwich method, protein for indirect ELISA method) to 1 μg / ml with carbonate coating buffer, coat a 96-well ELISA plate with 100 μl per well, and incubate at 2-8°C overnight (16-24 hours).
[0126] ② Discard the liquid in the wells, add 200-300 μl of PBS (0.01 mol / L, pH 7.4) to each well, let it stand for 3 minutes, discard the washing solution, and spin dry.
[0127] ③ Add 1% BSA-PBS-0.05% NaN3 blocking solution, 200 μL per well, and incubate at 37°C for 1.5-2 hours. ④ Discard the liquid in the wells and spin dry. Add 250 μL 4% sucrose-PBS to each well, incubate at 37°C for 25 minutes, discard the liquid, spin dry, and store at 4°C for one month.
[0128] 3.2 Indirect ELISA experimental operation
[0129] A. Antigen-coated ELISA plate (similar to the above-mentioned ELISA plate preparation operation);
[0130] B. Antibody dilution: Use 1% BSA PBS for serial dilution, for example, dilution concentrations are 1ug / mL, 0.33ug / mL, 0.11ug / mL, 0.036ug / mL, 0.012ug / mL, and 0.004ug / mL; add 100ul to each well of the ELISA plate and incubate at 37°C for 1 hour;
[0131] C. Wash the plate twice with PBS;
[0132] D. Add secondary antibody (goat anti-mouse IgG conjugated to HRP enzyme: purchased from Sangon). Dilute the secondary antibody 20,000 times with 1% BSA PBS. Add 100 μl to each well of the ELISA plate and incubate at 37°C for 0.5 h. Wash the plate three times with PBS.
[0133] E. Add chromogenic solution (as described above) to each well of the ELISA plate and incubate at 37°C for 15 minutes.
[0134] F. Stop, add 50ul of stop solution to each well of the ELISA plate and read the results using a ELISA reader.
[0135] The recombinantly expressed CRP antigen and the purchased control antigen were tested in parallel by indirect ELISA. The test results are shown in Table 5.
[0136] Table 5 Indirect ELISA test results
[0137]
[0138] The results of indirect ELISA showed that the activity of the recombinant protein was basically consistent with that of the purchased control protein.
[0139] 4.3 Chemiluminescence platform detection
[0140] like Figure 4 As shown, the recombinantly expressed CRP protein and the purchased CRP control protein were prepared into calibrators and diluted to different concentrations. The detection was performed on the luminescence platform to verify the detection linearity. The detection results are shown in Figure 3 The signal and linearity of the recombinantly expressed CRP protein were basically consistent with those of the purchased control protein.
Claims
1. A method for increasing protein expression in a protein expression system, characterized by: The target gene is obtained by replacing the first codon after the start codon in the gene of the target protein with a codon in which the third position of the same amino acid is G; The target gene is introduced into the expression system to express the target protein.
2. The method according to claim 1, wherein: The protein expression system is an Escherichia coli protein expression system.
3. The method according to any one of claims 1 or 2, characterized in that: The target protein is CRP protein.
4. The method according to claim 3, wherein: The gene sequence of the CRP protein is shown in SEQ ID No.
23.
5. The method according to any one of claims 1 to 4, characterized in that: The first amino acid after the start codon of the target protein is at least one of serine, leucine, proline, arginine, alanine, glycine, and glutamic acid.