OsNUC1 gene and application of gene mutant constructed by OsNUC1 gene in regulation and control of plant height, leaf length and panicle type of rice

By using CRISPR/Cas9 technology to perform targeted editing of the OsNUC1 and OsARF7 genes and constructing an OsNUC1 gene mutant, the difficult problems of regulating rice plant height, leaf length and panicle shape were solved, and significant improvements in rice growth rate and panicle traits were achieved.

CN120648738APending Publication Date: 2025-09-16FUJIAN AGRI & FORESTRY UNIV
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510911868.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-02
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively regulate rice plant height, leaf length and panicle shape, and lack an in-depth understanding of the role of nucleolin in rice growth and development.

Method used

The CRISPR/Cas9 technology was used to perform targeted editing of the OsNUC1 gene to construct an OsNUC1 gene mutant, and combined with the OsARF7 gene for double gene mutation to regulate rice plant height, leaf length and panicle shape.

Benefits of technology

It significantly increased rice plant height and leaf length, improved panicle shape and grain type, and regulated growth rate and panicle traits, confirming the important role of nucleolin genes in rice growth and development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648738A_ABST
    Figure CN120648738A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant gene engineering, and particularly relates to an OsNUC1 gene and application of a gene mutant constructed by the OsNUC1 gene to regulation and control of rice plant height, leaf length and panicle type. The regulation is to regulate the plant height and leaf growth of the rice and influence the shape of the ear part. Compared with the prior art, the OsNUC1 gene mutant has the following advantages: (1) the OsNUC1 is directionally edited by utilizing a CRISPR / Cas9 gene editing technology, an OsNUC1 gene mutant rice material is obtained, the biological phenotype of the OsNUC1 gene mutant rice material is investigated, the phenotype investigation on T1-generation seedlings of the OsNUC1 shows that the plant heights and the leaf lengths of one-week-old and two-week-old seedlings of the mutant are obviously higher than those of wild seedlings, the leaf widths have no obvious difference, and the OsNUC1 gene mutant rice material has a good application prospect; the result shows that the OsNUC1 can regulate the plant height and the leaf growth of the rice and influence the shape of the ear part. (2) it is proved that the nucleolin gene OsNUC1 is negatively regulated by a transcription factor OsARF7, and the phenotypes such as the plant height, the leaf length, the grain length and the grain width of the OsNUC1 / OsARF7 mutant are more obvious than those of the OsNUC1 mutant. The invention further proves the application of the OsNUC1 gene in regulation and control of rice plant height and leaf growth.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to, in particular to, the application of the OsNUC1 gene and a gene mutant constructed thereof in regulating rice plant height, leaf length and panicle shape. Background Art

[0002] Nucleolin is an important multifunctional protein that participates in numerous important biological regulatory processes, including cell proliferation and growth, cytokinesis, environmental stress responses, and embryogenesis. It is essential for biological growth and development. Uncovering the biological functions of nucleolin in organisms is crucial for understanding the mechanisms of biological growth and metabolism and can also provide fundamental theoretical guidance for obtaining high-quality rice germplasm resources. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide the application of the OsNUC1 gene and the gene mutant constructed therefrom in regulating rice plant height, leaf length and panicle shape.

[0004] The present invention is achieved in that:

[0005] The present invention first provides an application of the OsNUC1 gene in regulating rice plant height and leaf growth, wherein the regulation is to adjust the rice plant height and leaf growth and affect the panicle shape.

[0006] The present invention also provides the use of an OsNUC1 gene mutant in regulating rice plant height, leaf length and panicle shape, wherein the gene mutant is a single gene mutant or a double gene mutant.

[0007] Furthermore, the single gene mutant is obtained by directing editing OsNUC1 using CRISPR / Cas9 technology.

[0008] Furthermore, the method for obtaining the single gene mutant includes the following steps:

[0009] (1) Based on the OsNUC1 sequence structure, two specific editing target sites of 20 bp in length were designed at positions +1827-+1846 and +2079-+2098 in the coding region, respectively. The first editing target site was located in exon 2, and the second editing target site was located in exon 3.

[0010] (2) The complementary double-stranded DNA target sequence 1 was connected to the intermediate vector pYL-U6a-gRNA, and the target sequence 2 was connected to the pYL-U6b-gRNA vector. The U6a promoter-gRNA1 expression cassette and the U6b promoter-gRNA2 expression cassette were obtained by nested PCR amplification. After a second PCR amplification, specific enzyme cutting sites and ligation adapters were added, and the products after gel recovery and purification were connected to the editing vector pYLCRISPR / Cas9-MT to obtain the pYLCRISPR / Cas9-NUC1-T12 recombinant editing expression vector;

[0011] (3) The recombinant editing vector plasmid was transformed into rice callus tissue using Agrobacterium-mediated method to obtain genetically transformed plants.

[0012] Furthermore, the nucleotide sequence of the first editing target site in step (1) is CCTCTGTCTCAGTCTCAGAG, and the nucleotide sequence of the second editing target site is GGTTGAGAGCAGCAGTTCTG.

[0013] Furthermore, the double gene mutant is a double gene mutant of OsARF7 and OsNUC1.

[0014] Furthermore, the double gene mutant uses CRISPR / Cas9 technology to simultaneously edit and mutate the OsNUC1 and OsARF7 genes of ZH11, including the following steps:

[0015] (1) A 20-bp specific editing target site was designed at positions +381 to +400 of the OsARF7 gene. This editing target site spanned the first exon and the first intron. The 12 bases following the PAM sequence (CTGTGCCACCGC) were located in the first exon, and the remaining 8 bases (ACACGAAC) were located in the first intron. The second editing target site used the second editing target site of OsNUC1 to achieve the purpose of simultaneously mutating both OsARF7 and OsNUC1 genes.

[0016] (2) The pYLCRISPR / Cas9-NUC1-T12 method was used to construct the pYLCRISPR / Cas9-ARF7-NUC1-T12 recombinant editing expression vector for double gene mutant plants;

[0017] (3) The recombinant editing vector plasmid was transformed into rice callus tissue using Agrobacterium-mediated method to obtain genetically transformed plants.

[0018] Specifically, in step (1), the nucleotide sequence of the specific editing target site of the OsARF7 gene is ACACGAACCTGTGCCACCGC, and the nucleotide sequence of the specific editing target site of the OsNUC1 gene is GGTTGAGAGCAGCAGTTCTG.

[0019] The present invention has the following advantages:

[0020] (1) OsNUC1 was targeted and edited using CRISPR / Cas9 gene editing technology to obtain OsNUC1 gene mutant rice materials and investigate their biological phenotypes. The results showed that the plant height and leaf length of the one-week-old and two-week-old mutant seedlings were significantly higher than those of the wild type, while there was no significant difference in leaf width, indicating that OsNUC1 regulates rice plant height and leaf growth and affects panicle shape.

[0021] (2) The present invention demonstrates that the nucleolin gene OsNUC1 is negatively regulated by the transcription factor OsARF7. The phenotypes of the OsNUC1 / OsARF7 mutant, including plant height, leaf length, grain length, and grain width, are more pronounced than those of the OsNUC1 mutant. This further demonstrates the utility of the OsNUC1 gene in regulating plant height and leaf growth in rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0023] Figure 1 Editing sites and vector construction methods, as well as sequencing analysis

[0024] (A) Location of the two target sites in the OsNUC1 gene; (B) Schematic diagram of the assembly of the pYLCRISPR / Cas9-NUC1-T12 and pYLCRISPR / Cas9-ARF7-NUC1-T12 expression vectors; (C) Sequencing results of the target sites 1 and 2 of pYLCRISPR / Cas9-NUC1-T12.

[0025] Figure 2 This is the phenotype of T1 generation OsNUC1 mutant seedlings;

[0026] (A) Phenotype of one-week-old seedlings of OsNUC1; (B) Phenotype of two-week-old seedlings of OsNUC1.

[0027] Figure 3 This is a line graph showing the statistical data of plant height and leaf length of T1 generation OsNUC1 mutants from 1 to 7 days;

[0028] (A) Statistical line graph of plant height data from 1 to 7 days; (B) Statistical line graph of leaf length data from 1 to 7 days, where circles represent ZH11, squares represent OsNUC1-6, equilateral triangles represent OsNUC1-9, and inverted triangles represent OsNUC1-28.

[0029] Figure 4 The locations of the two targets in the gene and the sequencing results of the target sequences of the recombinant vector;

[0030] (A) Location of target 1 in the OsARF7 gene; (B) Location of target 2 in the OsNUC1 gene; (C) Sequencing results of target sequences 1 and 2 of pYLCR ISPR / Cas9-ARF7-NUC1-T12.

[0031] Figure 5 (A) PCR detection of DNA fragments near target site 1 of the OsNUC1 / OsARF7 double mutant; (B) PCR detection of DNA fragments near target site 2 of the OsNUC1 / OsARF7 double mutant; (C) gene sequencing results of OsNUC1 / OsARF7-2; (D) gene sequencing results of OsNUC1 / OsARF7-17; (E) gene sequencing results of OsNUC1 / OsARF7-29; (F) gene sequencing results of OsNUC1 / OsARF7-34.

[0032] Figure 6 for the comparison between the OsNUC1 / OsARF7 mutant and the ZH1180-d plant;

[0033] (A) ZH11 at 80 days; (B) OsNUC1 / OsARF7 mutant at 80 days, scale bar is 1m.

[0034] Figure 7 Comparison of panicle shape, grain length and grain width between the OsNUC1 / OsARF7 mutant and ZH11;

[0035] (A) Comparison of panicle shape between OsNUC1 / OsARF7 and ZH11, scale bar is 5 cm; (B) Comparison of grain length between OsNUC1 / OsARF7 and ZH11, scale bar is 1 cm; (C) Comparison of grain width between OsNUC1 / OsARF7 and ZH11, scale bar is 1 cm.

[0036] Figure 8 This is the phenotype of T1 generation OsNUC1 / OsARF7 double mutant seedlings;

[0037] (A) Phenotype of one-week-old seedlings of OsNUC1 / OsARF7; (B) Phenotype of two-week-old seedlings of OsNUC1 / OsARF7.

[0038] Figure 9 This is a line graph showing the statistical data of plant height and leaf length of T1 generation OsNUC1 / OsARF7 mutants from 1 to 7 days.

[0039] (A) Statistical line graph of plant height data from 1 to 7 days; (B) Statistical line graph of plant height data from 1 to 7 days. Circles represent ZH11, squares represent OsNUC1 / OsARF7-17, equilateral triangles represent OsNUC1 / OsARF7-23, and inverted triangles represent OsNUC1 / OsARF7-29. DETAILED DESCRIPTION

[0040] The technical solutions of the present invention will be described clearly and completely below in conjunction with the accompanying drawings and specific embodiments. Where specific conditions are not specified in the examples, conventional conditions or those recommended by the manufacturer were used. Reagents or instruments used where the manufacturer is not specified are conventional products that can be purchased commercially.

[0041] 1. Test materials

[0042] The plant materials used in this experiment include Zhonghua 11 (japonica rice) and transgenic rice materials with Zhonghua 11 as the genetic background.

[0043] 2 Test methods

[0044] 2.1 OsNUC1 gene acquisition

[0045] The rice OsNUC1 gene (ID: LOC_Os04g52960) was obtained through the NCBI database.

[0046] 2.2 gRNA target design

[0047] The exon sequence information for the rice gene OsNUC1 was accessed through the National Center for Biotechnology Information (NCBI) website, and gRNA for OsNUC1 was designed. According to target design principles, a 20-bp sequence was selected from the second exon of the positive strand of the OsNUC1 gene as the first target, with a PAM sequence of GGG. GCCG and AAAC restriction sites were added to the 5' ends of the positive and reverse strand target sequences, respectively. After digestion with Bsa I (NBE), the target sequences were ligated into the intermediate vector pYL-U6a-gRNA. A 20-bp sequence was selected from the third exon of the positive strand of OsNUC1 as the second target, with a PAM sequence of AGG. GTT and AAAC restriction sites were added to the 5' ends of the positive and reverse strand target sequences, respectively. After digestion with Bsa I, the target sequences were ligated into the intermediate vector pYL-U6b-gRNA. To prevent Cas9 protein cleavage at other nonspecific sites, these target sequences were retrieved from the rice genome database.

[0048] 2.3 Construction of editing mutation vector

[0049] (1) Synthesis of complementary double-stranded DNA: 10 μL of each upstream and downstream primer of the editing target and 30 μL of ddH2O were mixed to form a 50 μL system. After high-temperature denaturation treatment at 95°C for 5 min, the system was annealed at 25°C for 20 min to synthesize complementary double-stranded DNA.

[0050] (2) The DNA double strands were connected to the corresponding intermediate vectors (pYL-U6a-gRNA and pYL-U6b-gRNA) using the cutting and ligation method. First, 20 ng of pYL-U6a-gRNA and pYL-U6b-gRNA were taken and mixed with the DNA double strand target sequence of the first target and the DNA double strand target sequence of the second target, respectively. 1 μL of each DNA target sequence was taken, and then 1 μL of 10× Ligation Buffer, 1 μL of T4 DNA Ligase (20 U), 1 μL of Cut Smart, 0.5 μL of BsaⅠ endonuclease (5 U), and 5.25 μL of ddH2O were added to the PCR tube for enzyme digestion and ligation. The enzyme digestion was carried out at 37°C for 5 minutes, and then ligated at 16°C for 5 minutes. A total of 12 cycles of enzyme digestion and ligation were performed.

[0051] (3) Nested PCR: The constructed intermediate vector was used as a template to amplify the U6a-gRNA1 and U6b-gRNA2 expression cassettes. 1 μL template, 0.2 μL KOD high-fidelity enzyme, 1 μL Buffer, 0.6 μL MgCl2 were added to the system. 2+ , 1 μL of dNTP, 5.2 μL of ddH2O, and 0.5 μL of upstream and downstream primers. The amplification primer pair is UF:

[0052] CTCCGTTTTACCTGTGGAATCG-3', gRNA-R: CGGAGGAAAATTCCATCCAC-3', and then the amplified PCR product was diluted 10 times for the second PCR amplification to amplify the U6a-gRNA1 and U6b-gRNA2 expression cassettes respectively. The primers corresponding to the U6a-gRNA1 expression cassette are Uctcg-B1': 5'

[0053] -TTCAGAGGTCTCCTCGACTAGTGGAATCG GCAGCAAAGG-3', gRctga-B2: 5'

[0054] -AGCGTGGGTCTCGTCAGGGTCCATCCACT CCAAGCTC-3', the primer corresponding to the U6b-gRNA2 expression cassette is Uctga-B2': 5'-TTCAGA

[0055] GGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3', gRcggt-BL: 5'-AGCGTG

[0056] GGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3', the reaction system was 50 μL, and the reaction conditions were set at 94°C for 2 min, 98°C denaturation for 10 s, 58°C annealing for 30 s, 68°C extension for 45 s, for 30 cycles, and finally 68°C extension for 10 min. The amplified PCR product was connected to the corresponding enzyme cutting site and specific linker, and the obtained product was recovered and purified for the next experiment.

[0057] (4) Take 15 ng each of the U6a-gRNA1 expression cassette and the U6b-gRNA2 expression cassette containing restriction sites and specific linkers, mix them with 70 ng of the pYLCRISPR / Cas9-MT empty vector, and add 0.5 μL of 10× Ligation Buffer, 0.5 μL of T4 DNA Ligase (20 U), 0.5 μL of Cut Smart, 0.2 μL of Bsa I (5 U) endonuclease, and add an appropriate amount of ddH2O to mix into a 5 μL reaction system. Perform enzyme digestion and ligation reactions alternately for 12 cycles at 37°C and 16°C for 5 min each to obtain the recombinant vector.

[0058] (5) Add the recombinant plasmid to the DH5α E. coli competent cell mixture and stir gently with a pipette tip. After ice bathing for 30 minutes, place in a 42℃ metal bath for 1 minute, then place on ice for 2-3 minutes. Add 1mL of LB liquid medium in a clean bench, culture on a shaker at 37℃ for 1 hour, centrifuge at 6000rpm for 1 minute, retain part of the supernatant and mix with the precipitate, and evenly apply it on the plate culture medium. After culture at 37℃ for 12 hours, pick a single colony for bacterial liquid PCR verification, select the positive bacterial liquid and send it to the biological company for sequencing. After the results are returned, compare them with the designed target sequence.

[0059] (6) The recombinant editing vectors were transformed into Agrobacterium EHA105, and positive Agrobacterium clones were selected to transform japonica rice ZH11 callus tissue to obtain mutant rice.

[0060] 2.4 Rice material planting management

[0061] Rice seeds were placed in a Petri dish and soaked at room temperature for two days. They were then transferred to a 37°C incubator to encourage germination. Once the seeds germinated, they were transplanted into a black hydroponic box and grown using Kimura's complete culture medium. The rice seedlings were then placed in a light-incubator with a set temperature of 28°C, 14 hours of light, and 60% humidity during the day, and a nighttime temperature of 24°C with 10 hours of no light. The rice seedlings' growth conditions and duration were adjusted in real time based on experimental needs, and samples were collected for subsequent testing and analysis.

[0062] The rice materials were planted in the experimental farm of Fujian Agriculture and Forestry University in Fuzhou City, Fujian Province. Before planting rice, preliminary preparations such as weeding and tillage were required. Manual weeding was used, and 4-week-old rice seedlings were transplanted into the fields. The rice was gradually managed according to the management methods of conventional rice in Fujian Province. Field weeds were regularly removed, and pesticides were sprayed for disease and pest control.

[0063] 2.5 Agronomic traits survey

[0064] During the rice maturity stage, we investigated and analyzed agronomic traits including plant height, tillering, panicle formation rate, panicle length, panicle weight, number of filled grains, seed set rate, 1000-grain weight, yield per plant, and seed length, width, number of primary and secondary branches. Means and standard deviations of the corresponding traits were calculated using SPSS 13.0 software. One-way analysis of variance was used to analyze the significance of the measured indicators, and GraphPad Prism software was used to plot the statistical results.

[0065] 2.6 DNA and total RNA extraction and cDNA synthesis

[0066] DNA of rice samples was extracted using the CTAB method. Total RNA of rice samples was extracted according to the instruction manual of Trizol UP kit. The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit for gene amplification and quantitative expression analysis.

[0067] 3 Test results

[0068] 3.1 Construction of OsNUC1 mutants

[0069] 3.1.1 gRNA target design and pYLCRISPR / Cas9-NUC1-T12 expression vector construction

[0070] To further study the biological function of OsNUC1 in rice, the present invention used CRISPR / Cas9 technology to obtain the OsNUC1 mutant of ZH11. According to the sequence structure of OsNUC1, two specific editing target sites with a length of 20 bp were designed at +1827 to +1846 and +2079 to +2098 in the coding region, respectively. The first editing target site was in the second exon, and the second editing target site was located in the third exon ( Figure 1 Middle (A), dual targeting was used to increase the probability of editing mutation of OsNUC1.

[0071] The complementary double-stranded DNA target sequence 1 was connected to the intermediate vector pYL-U6a-gRNA, and the target sequence 2 was connected to the pYL-U6b-gRNA vector. The U6a promoter-gRNA1 expression cassette and the U6b promoter-gRNA2 expression cassette were obtained by nested PCR amplification. After a second PCR amplification, the specific enzyme cutting site BsaI and the ligation adapter were added respectively. The products after gel recovery and purification were connected to the editing vector pYLCRISPR / Cas9-MT to obtain the target gene. Figure 1 pYLCRISPR / Cas9-NUC1-T12 recombination editing expression vector with medium B connection method.

[0072] Sequencing showed that the target sequences 1 and 2 of the pYLCRISPR / Cas9-NUC1-T12 recombinant editing vector were consistent with the target sequence on the OsNUC1 gene ( Figure 1 C), can be used for genetic transformation of rice.

[0073] 3.1.2 Identification of mutation sites in OsNUC1 mutants

[0074] The recombinant editing vector plasmid was transformed into ZH11 callus to obtain 30 genetically transformed plants, and the resulting mutants were analyzed for mutation type identification. The two target sites of the OsNUC1 mutant are separated by 233 bases. Therefore, an upstream primer was designed upstream of target 1 and a downstream primer was designed downstream of target 2, with the amplified 627 bp fragment encompassing both targets 1 and 2.

[0075] Sequencing analysis of PCR products showed that 4 of the 30 transformed plants were homozygous mutants, 20 were heterozygous mutants, and 6 had no mutations at either target site. The changes in the 4 homozygous mutants were 6, 19, 25, and 28. Target site 1 of 6 had no mutation, and the third base C before the PAM sequence of target 2 was deleted. The mutation types of the other 3 plants were exactly the same, with an A base inserted between the third and fourth bases before the PAM sequence of target 1, and a T before the fourth base of the PAM sequence of target 2 was deleted. Among the 16 heterozygous mutants, plants 1, 3, 4, 5, 7, 8, 10, 11, 13, 14, 15, 17, 18, and 22 had no mutations at either target site. Plants 2 and 21 had no mutations in target 1, but developed mismatches and double peaks starting at target 2. Plants 9 and 27 had an A insertion at the third and fourth bases before the PAM sequence of target 1, and mismatches and double peaks began at target 2. Plant 20 had a TC deletion at the fifth and sixth bases before the PAM sequence of target 1, and mismatches and double peaks began at target 2. Plant 24 had mismatches and double peaks starting 15 bp before target 1. Plants 12, 16, 23, 26, 29, and 30 had no mutations at either target site.

[0076] 3.1.3 Field phenotypic observation

[0077] Compared with the wild-type ZH11, the rice ears of the OsNUC1 mutant plants at the same growth stage were greener, developed relatively later, and had a more compact plant shape, indicating that the OsNUC1 mutation extended the plant's growth period, delayed rice heading and flowering, and slowed the overall growth rate of the plant.

[0078] 3.1.4 Ear traits of OsNUC1 mutants

[0079] Compared with the wild type ZH11, the grain length of the T0 generation mutants OsNUC1-10 and OsNUC1-28 was shorter than that of the wild type ZH11, while there was no significant difference between the other strains and the wild type; the grain width of the mutants OsNUC1-7, OsNUC1-13, OsNUC1-27 and OsNUC1-28 was smaller than that of the wild type; the number of primary branches of the mutants OsNUC1-6, OsNUC1-11 and OsNUC1-13 was less than that of the wild type ZH11; while the number of secondary branches varied greatly among the mutant strains, among which the number of secondary branches of the mutants OsNUC1-7, OsNUC1-9, OsNUC1-10 and OsNUC1-20 was more, while the number of secondary branches of OsNUC1-11, OsNUC1-13, OsNUC1-25 and OsNUC1-27 was less.

[0080] 3.1.5 Phenotype of OsNUC1 mutants in the T1 line

[0081] To further explore the role of OsNUC1 in rice growth and development, the present invention selected homozygous lines with low OsNUC1 expression levels among OsNUC1 mutants for phenotypic investigation. We photographed and counted the phenotypes of one-week and two-week-old rice plants. The results are as follows Figure 2 As shown in the figure, at one week old, OsNUC1 was 6.7 cm taller than ZH11; at two weeks old, the difference in plant height became more pronounced. Statistical results also showed that the plant heights of different OsNUC1 strains converged to the same level, with the average height of the six mutant strains being 30.4 cm, significantly higher than ZH11's 22.6 cm, a difference of 7.8 cm. This suggests that the mutant exhibited a faster growth advantage.

[0082] Rice growth is largely dependent on leaf growth, and OsNUC1 is expressed at high levels in leaves. Therefore, the present invention investigated leaf growth in mutant strains. Measurements of leaves from one- and two-week-old OsNUC1 and ZH11 seedlings revealed that the leaf lengths of the six OsNUC1 strains were longer than those of the wild-type ZH11, while the leaf widths were not significantly different from those of the wild-type. This suggests that OsNUC1 significantly affects the longitudinal growth of rice leaves, but has relatively little effect on the lateral direction.

[0083] In order to better compare the changes in plant height and leaf length of OsNUC1 and ZH11 rice seedlings within one week of age, three representative strains of OsNUC1 and ZH11 were selected for growth records within one week, and the data were plotted as a line graph ( Figure 3 The results showed that the plant height and leaf length of the OsNUC1 mutant were not significantly different from those of the wild type on the first day, but as time went on, the growth rate of the plant height and leaf length of the OsNUC1 mutant was significantly higher than that of ZH11.

[0084] 3.2 Construction of OsNUC1 / OsARF7 double gene mutant

[0085] 3.2.1 gRNA target design and pYLCRISPR / Cas9-NUC1 / ARF7-T12 expression vector construction

[0086] To further explore the regulatory characteristics of the interaction between the transcription factors OsARF7 and OsNUC1 genes on rice growth and development, the present invention used CRISPR / Cas9 technology to simultaneously edit and mutate the OsNUC1 and OsARF7 genes of ZH11, wherein a specific editing target site of 20 bp in length was designed at +381 to +400 of the OsARF7 gene ( Figure 4The editing target site spans the first exon and the first intron. The 12 bases after the PAM sequence (CTGTGCCACCGC) are located on the first exon, and the remaining 8 bases (ACACGAAC) are located on the first intron. Figure 4 (B) in the middle, in order to achieve the goal of simultaneously mutating both OsARF7 and OsNUC1 genes.

[0087] The experimental method of constructing pYLCRISPR / Cas9-NUC1-T12 was used to construct the pYLCRISPR / Cas9-ARF7-NUC1-T12 recombinant editing expression vector for double gene mutant plants. Sequencing showed that the target sequences 1 and 2 of the pYLCRISPR / Cas9-NUC1-T12 recombinant editing vector were consistent with the target sequences selected on the OsNUC1 and OsARF7 genes, respectively ( Figure 4 C), can be used for genetic transformation of rice.

[0088] 3.2.2 Identification of mutation sites in the OsNUC1 / OsARF7 double gene mutant

[0089] The recombinant editing vector plasmid was transformed into ZH11 callus to obtain 34 genetically transformed plants, and the mutant plants obtained were subjected to mutation type identification and analysis. Two amplification regions were designed to identify the mutation type of the OsNUC1 / OsARF7 mutants. The amplification region used to identify target 1 was 427 bp in length and located on the OsARF7 gene. The amplification region used to identify target 2 was 627 bp in length and located on the OsNUC1 gene. Agarose gel electrophoresis showed that all 68 fragments used to identify the two mutation sites were successfully amplified, and the actual amplified fragment sizes were consistent with the expected design fragment lengths ( Figure 5 A and B).

[0090] Sequencing analysis of PCR products showed that among the 34 transformed plants, 6 were homozygous mutants, 24 were heterozygous mutants, and 4 had no mutations at both target sites. Among the 6 homozygous mutants, 4 had mutations at both target sites, namely, No. 2, 17, 29, and 34 ( Figure 5 CF), strain 2 had an A insertion at target site 1 and a five-base deletion (AGTTC) at target site 2; strain 17 had a T insertion at target site 1 and a T deletion at target site 2; strain 29 had a C insertion at target site 1 and a T deletion at target site 2; and strain 34 had an A insertion at target site 1 and a T deletion at target site 2. The remaining two strains, strains 15 and 19, had mutations only at target site 2, with no mutations at target site 1, indicating single mutations in OsNUC1.

[0091] Of the 24 heterozygous mutants, 21 strains (numbers 1, 5, 7, 10, 11, 12, 13, 14, 18, 20, 21, 22, 23, 24, 25, 26, 28, 30, 31, 32, and 33) had mutations at both target sites. The four strains without mutations were numbers 3, 6, 16, and 27. Of the 34 transgenic rice strains obtained, 25 had mutations at both target sites, with a simultaneous editing efficiency of 74%, of which 11.8% had homozygous, stably inherited mutations.

[0092] 3.2.3 Field phenotype

[0093] from Figure 6 Compared to wild-type ZH11, the OsNUC1 / OsARF7 mutant plants exhibited similar characteristics to the OsNUC1 mutant plants, with greener panicles, slower development, and a more compact plant shape. Furthermore, the OsNUC1 / OsARF7 mutant plants were also relatively taller, indicating that simultaneous mutations in both OsNUC1 and OsARF7 extend the plant's growth period, delaying heading and flowering, and promoting longitudinal growth.

[0094] 3.2.4 Ear traits of OsNUC1 / OsARF7 mutants

[0095] Depend on Figure 7 The results showed that the panicle shape of the OsNUC1 / OsARF7 double mutant was larger than that of the wild type ZH11, and the grain length and width were both increased compared with the wild type.

[0096] As shown in Table 1, the grain length and width of the OsNUC1 / OsARF7 double mutants were significantly increased compared with the wild type. Among them, the grain length of mutant lines 5, 7, 8, 13, 17, 19, 21, 22, 23, 26 and 29 was significantly increased compared with the wild type; except for line 9, the grain width of the other mutants was wider than that of the wild type; in addition, the number of primary and secondary branches of mutant line 28 was significantly increased compared with the wild type, and the number of primary branches of mutant line 10 was increased. These results indicate that the knockout mutations of OsNUC1 and OsARF7 have improved the panicle shape and grain traits of rice to a certain extent.

[0097] Table 1 Statistics of panicle traits of different strains of the 1n7 (OsNUC1 / OsARF7) mutant and ZH11

[0098]

[0099] The data listed in the table are mean ± standard error; the same letters after the data in the same column in the table indicate no significant difference at the 0.05 level, and different letters indicate significant difference at the 0.05 level.

[0100] 3.2.5 Phenotype of OsNUC1 / OsARF7 mutants in T1 line

[0101] Quantitative analysis of OsNUC1 and OsARF7 expression in the T1 generation of the OsNUC1 / OsARF7 double mutant revealed that both OsNUC1 and OsARF7 expression levels were significantly lower in the mutant than in the wild type. Three lines with relatively low OsNUC1 and OsARF7 expression levels, OsNUC1 / OsARF7-17, OsNUC1 / OsARF7-23, and OsNUC1 / OsARF7-29, were selected for phenotypic investigation.

[0102] from Figure 8 The phenotype showed that the plant heights of the three mutant strains of OsNUC1 / OsARF7 at one week old were significantly higher than that of ZH11, and the difference in plant height between OsNUC1 / OsARF7 and ZH11 at two weeks old became more obvious.

[0103] The average plant height of the three OsNUC1 / OsARF7 strains was 34.7 cm, while the average plant height of ZH11 was only 24.5 cm, a difference of 10.2 cm. Leaf length statistics showed similar results to those for plant height. The average leaf length of the three two-week-old OsNUC1 / OsARF7 strains reached 22.1 cm, 7 cm longer than that of ZH11. There were no significant differences in leaf width.

[0104] In addition, the growth dynamics of the three OsNUC1 / OsARF7 lines showed that the growth trend of plant height and leaf length of OsNUC1 / osarf was significantly greater than that of ZH11 ( Figure 9 ), the plant height and leaf length of the OsNUC1 / OsARF7 double mutant were significantly better than those of the wild type, indicating that OsNUC1 and OsARF7 are involved in the regulation of rice growth and development.

[0105] 4 Conclusion

[0106] (1) Using CRISPR / Cas9 technology, we obtained rice materials with mutants of the nucleolin gene OsNUC1. The panicle traits of the T0 generation of OsNUC1 mutants were examined, and it was found that the OsNUC1 mutants developed more slowly than the wild type, with varying degrees of changes in grain length, grain width, number of primary branches, and number of secondary branches. Phenotypic examination of the T1 generation of OsNUC1 seedlings revealed that the plant height and leaf length of the one-week-old and two-week-old mutants were significantly higher than those of the wild type, while there was no significant difference in leaf width. This suggests that OsNUC1 regulates plant height and leaf growth in rice and affects panicle shape.

[0107] (2) Using CRISPR / Cas9 technology, we generated double-gene mutants of OsNUC1 and OsARF7. Statistical analysis of agronomic traits showed that the T0 generation double-gene mutants developed more slowly than the wild type, and most lines had higher grain length, grain width, primary branch number, and secondary branch number than the wild type. The plant height and leaf length of the one-week-old and two-week-old seedlings of the T1 generation double-gene mutants were significantly higher than those of the wild type, while there was no significant difference in leaf width. The plant height, leaf length, grain length, and grain width phenotypes of the OsNUC1 / OsARF7 mutants were more pronounced than those of the OsNUC1 mutant.

[0108] In summary, the nucleolin gene OsNUC1 participates in regulating processes such as leaf growth and plant height development by being regulated by the transcription factor OsARF7, thereby affecting the growth rate of rice and regulating the formation of panicle traits such as grain length, grain width, and branch development.

[0109] Although the specific embodiments of the present invention are described above, those skilled in the art should understand that the specific embodiments described are merely illustrative and are not intended to limit the scope of the present invention. Equivalent modifications and changes made by those skilled in the art in accordance with the spirit of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. OsNUC1 The application of genes in regulating rice plant height, leaf length and panicle shape is characterized by: The regulation is to adjust the plant height and leaf growth of rice and affect the shape of the panicle.

2. OsNUC1 The application of gene mutants in regulating rice plant height, leaf length and panicle shape is characterized by: The gene mutant is a single gene mutant or a double gene mutant.

3. The use according to claim 2, characterized in that: The single gene mutants were mutated using CRISPR / Cas9 technology OsNUC1 Perform targeted editing to obtain OsNUC1 Single gene mutants.

4. The use according to claim 3, characterized in that: The method for obtaining the single gene mutant comprises the following steps: (1) According to OsNUC1 Sequence structure, two specific editing target sites with a length of 20 bp were designed at +1827 to +1846 and +2079 to +2098 of the coding region, respectively. The first editing target site is in the second exon, and the second editing target site is located in the third exon; (2) The complementary double-stranded DNA target sequence 1 was connected to the intermediate vector pYL-U6a-gRNA, and the target sequence 2 was connected to the pYL-U6b-gRNA vector. The U6a promoter-gRNA1 expression cassette and the U6b promoter-gRNA2 expression cassette were obtained by nested PCR amplification. After a second PCR amplification, specific enzyme cutting sites and ligation adapters were added respectively. The products after gel recovery and purification were connected to the editing vector pYLCRISPR / Cas9-MT to obtain the pYLCRISPR / Cas9-NUC1-T12 recombinant editing expression vector; (3) The recombinant editing vector plasmid was transformed into rice callus tissue using Agrobacterium-mediated method to obtain genetically transformed plants.

5. The use according to claim 4, characterized in that: The nucleotide sequence of the first editing target site in step (1) is CCTCTGTCTCAGTCTCAGAG, and the nucleotide sequence of the second editing target site is GGTTGAGAGCAGCAGTTCTG.

6. The use according to claim 2, characterized in that: The double gene mutant is OsARF7 and OsNUC1 Double gene mutants.

7. The use according to claim 6, characterized in that: The double gene mutant was modified by CRISPR / Cas9 technology to generate ZH11 OsNUC1 and OsARF7 Gene editing and mutation are performed simultaneously, including the following steps: (1) In OsARF7 A 20 bp specific editing target site was designed at +381 to +400 of the gene. The editing target site spanned the first exon and the first intron. The 12 bases after the PAM sequence, CTGTGCCACCGC, were located on the first exon, and the remaining 8 bases, ACACGAAC, were located on the first intron. OsNUC1 A 20 bp specific editing target site was designed at +2079 to +2098 of the gene, and the target site was located in the third exon to achieve simultaneous mutation. OsARF7 and OsNUC1 The purpose of both genes; (2) Construction of the pYLCRISPR / Cas9-ARF7-NUC1-T12 recombinant editing expression vector for double gene mutant plants; (3) The recombinant editing vector plasmid was transformed into rice callus tissue using Agrobacterium-mediated method to obtain genetically transformed plants.

8. The use according to claim 7, characterized in that: In step (1) OsARF7 The nucleotide sequence of the gene-specific editing target is ACACGAACCTGTGCCACCGC, OsNUC1 The nucleotide sequence of the gene-specific editing target is GGTTGAGAGCAGCAGTTCTG.

Citation Information

Cited By

  • Application of biological product overexpressing OsARF7 gene in improving disease resistance of rice

    CN121495988A

  • Application of biological preparation of overexpressed osarf7 gene in improving disease resistance of rice

    CN121495988B