Application of silencing miR529b in positive regulation of rice resistance to brown planthopper
By silencing miR529b in rice, and using artificially synthesized hairpin loop nucleotide sequences to link with vectors and transform rice, the problem of decreased resistance to brown planthopper in rice was solved, and significant enhancement of rice plant resistance to brown planthopper was achieved, supporting the breeding of insect-resistant rice varieties.
Patent Information
- Application Number
- CN202510779657.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2045-06-12
AI Technical Summary
The lack of effective genes for resisting brown planthoppers in existing technologies leads to a decrease in the resistance of resistant rice varieties when facing new biotypes of brown planthoppers, affecting the safety of rice production.
By artificially synthesizing a specific hairpin loop nucleotide sequence and linking it to the pBWA(V)HS vector, miR529b was silenced, transformed into Escherichia coli and introduced into Agrobacterium, and finally transformed into rice to obtain STTM-miR529b transgenic rice, which enhances its resistance to brown planthopper.
Silencing miR529b significantly enhanced the resistance of rice plants to brown planthoppers, providing a new research basis for the breeding of insect-resistant rice varieties.
Smart Images

Figure CN120648746B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering, in particular to the application of silencing miR529b in the positive regulation of rice resistance to brown planthopper. BACKGROUND
[0002] Brown planthopper is one of the important pests in rice production in China. It directly sucks rice juice, causing rice to lose nutrients, turn yellow and wither, and even die. At the same time, it also spreads many bacteria, thereby indirectly harming rice. They cause rice to reduce yield or even absolute yield, which seriously threatens food security.
[0003] Exploring and utilizing rice resistance to brown planthopper genes, cultivating and planting insect-resistant rice varieties is the preferred measure for controlling brown planthopper, which is economic, effective, green and pollution-free. This method can control the reproduction of brown planthopper in a certain period of time, but with the emergence of new biotypes of brown planthopper, the resistance of early insect-resistant rice will be overcome, causing the insect-resistant rice to be susceptible again. Therefore, we need to continuously explore new insect-resistant genes and cultivate new resistant rice varieties. Fully exploring and utilizing more resistance regulation key genes is crucial to curb the harm of brown planthopper and ensure the safety of rice production.
[0004] microRNA (miRNA) is a class of endogenous non-coding single-stranded RNA with a length of about 22 nt, which is a small molecule regulator that can widely participate in various life activities such as embryo development, cell growth, differentiation, metabolism, etc. of organisms, and plays an important role in post-transcriptional regulation, with the characteristics of simplicity and efficiency. It mainly regulates the transcription of genes or directly degrades the mRNA of target genes in plants to exert post-transcriptional regulation function on target genes. miRNA not only participates in the regulation of plant growth and development, metabolism, etc., but also participates in the response of plants to biological and non-biological stress. In summary, miRNA and resistance-related genes play an important role in insect resistance evolution and can be used as an important target for pest control. At present, there is no relevant research report on the application of miR529b in the regulation of rice resistance to brown planthopper in the present application.
[0005] STTM( S hort T andem T argets MSTTM (short tandem target mimic) is a short synthetic tandem mimic, which has a 48nt specific nucleotide sequence in the middle and target miRNA binding sites at both ends, each miRNA binding sequence includes 3 non-complementary bases (CTA), the sequence can bind with target miRNA to form a non-complete complementary double strand, thereby effectively preventing miRNA from binding with target gene, making miRNA silence and increasing the expression of target gene. The technology has been widely used in the function research of miRNA of Arabidopsis, rice, tomato, soybean and the like. The function of miR529b is researched by using the STTM technology, and further brown planthopper prevention and treatment work is carried out, which contributes to cultivating rice varieties resistant to brown planthopper at a cell level. SUMMARY
[0006] In order to solve the above problems, the application provides an application of silencing miR529b in positively regulating rice resistance to brown planthoppers, the rice plant after silencing miR529b has enhanced resistance to brown planthoppers, and the miRNA is a key gene for regulating rice resistance to brown planthoppers, and the miRNA has important research value for breeding new rice varieties resistant to brown planthoppers.
[0007] In order to achieve the above purpose, the application provides the following technical scheme.
[0008] The application provides an application of silencing miR529b in positively regulating rice resistance to brown planthoppers.
[0009] Preferably, the nucleotide sequence of miR529b is shown as SEQ ID No. 1.
[0010] Preferably, the application comprises the following steps.
[0011] 1) A 48nt specific hairpin loop structure nucleotide sequence is artificially synthesized, and target miRNA binding sites are added at both ends, each miRNA binding sequence includes 3 non-complementary bases, the 3 non-complementary bases are CTA, and the obtained hairpin structure nucleotide sequence is shown as SEQ ID No. 3;
[0012] 2) The sequence SEQ ID No. 3 obtained in the step 1) is connected with a pBWA(V)HS vector to obtain a connection vector pBWA(V)HS-STTM529b;
[0013] 3) The connection vector pBWA(V)HS-STTM529b obtained in the step 2) is transformed into E. coli, and a plasmid is extracted;
[0014] 4) The plasmid obtained in the step 3) is transformed into Agrobacterium to obtain transformed bacteria;
[0015] 5) transforming the transformed bacteria obtained in step 4) into rice to obtain the transgenic rice STTM-miR529b with silenced miR529b and resistance to brown planthopper.
[0016] Preferably, the connecting vector pBWA(V)HS-STTM529b is characterized in that the primers for amplifying the sequence shown in SEQ ID No. 3 in step 1) are forward primer TG1 and reverse primer TG2, the nucleotide sequence of the forward primer TG1 is shown in SEQ ID No. 4, the nucleotide sequence of the reverse primer TG2 is shown in SEQ ID No. 5, and the template sequence is SEQ ID No. 2.
[0017] Preferably, the system used for amplifying the hairpin structure sequence is as follows:
[0018] 2 μL of the forward primer TG1 with a concentration of 100 μM, 2 μL of the reverse primer TG2 with a concentration of 100 μM, 1 μL of the spacer template, 25 μL of Pfu PCR Mix, and 20 μL of ddH2O; the hairpin structure sequence is shown in SEQ ID No. 3.
[0019] Preferably, the running program for amplifying the target sequence is as follows: 1) 94 ℃ for 5 min; 2) 30 cycles of 94 ℃ for 30 s, 50 ℃ for 45 s, and 72 ℃ for 3 s; 3) 72 ℃ for 10 min; 4) storage at 4 ℃; and the target sequence is shown in SEQ ID No. 3.
[0020] Preferably, the pBWA(V)HS vector and the hairpin structure nucleotide sequence SEQ ID No. 3 are subjected to enzyme digestion with BsaI / Eco31I and then connected using T4 DNA ligase to obtain the recombinant vector pBWA(V)HS-STTM529b.
[0021] Preferably, the E. coli is E. coli DH5α, and the Agrobacterium is Agrobacterium EHA105.
[0022] The application further provides the use of the silenced miR529b in the forward selection of the rice with resistance to brown planthopper.
[0023] The application has the following beneficial effects:
[0024] In the embodiment of the present application, the pBWA(V)HS-STTM529b vector is transformed into rice Nipponbare to obtain a transgenic plant STTM-miR529b with miR529b expression inhibited. The seedling group method is used to identify the resistance of the T2 generation homozygous transgenic plant to brown planthopper. Compared with the transgenic receptor parent Nipponbare, STTM-miR529b is more resistant to insects, which confirms that miR529b is related to the resistance of rice to brown planthopper and can be used to create new germplasm of rice resistant to brown planthopper. BRIEF DESCRIPTION OF DRAWINGS
[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below.
[0026] Figure 1 Figure 1 is a map of the pBWA(V)HS-STTM529b vector, wherein the target1-spacer-target2 sequence is a fusion hairpin loop sequence containing the miR529b binding site inserted;
[0027] Figure 2 Figure 2 is a brown planthopper resistance identification of the miR529b-STTM transgenic plant; A is the insect resistance phenotype of the STTM-miR529b transgenic plant, NIP is the Nipponbare plant (negative control), and STTM-miR529b-1 and STTM-miR529b-1 are two independent T2 generation lines of the pBWA(V)HS-STTM529b vector transgenic plant; B is the brown planthopper resistance value of the rice plant corresponding to the A graph. DETAILED DESCRIPTION
[0028] The application provides application of silencing miR529b in positive regulation of rice resistance to brown planthopper. In the application, the nucleotide sequence of the miR529b is shown as SEQ ID No. 1. In the application, the application comprises the following steps: 1) artificially synthesizing a specific hairpin loop structure nucleotide sequence of 48 nt as shown in SEQ ID No. 2, adding target miRNA binding sites at both ends respectively, each miRNA binding sequence comprising three non-complementary bases, the three non-complementary bases being CTA, and obtaining a hairpin structure nucleotide sequence as shown in SEQ ID No. 3; 2) connecting the sequence SEQ ID No. 3 obtained in the step 1) with a pBWA(V)HS vector to obtain a connecting vector pBWA(V)HS-STTM529b; 3) transforming the connecting vector pBWA(V)HS-STTM529b obtained in the step 2) into E. coli to extract a plasmid; 4) transferring the plasmid obtained in the step 3) into Agrobacterium to obtain transformed bacteria; 5) transforming the transformed bacteria obtained in the step 4) into rice to obtain STTM-miR529b, a transgenic rice with silenced miR529b and resistance to brown planthopper.
[0029] In the application, the connecting vector pBWA(V)HS-STTM529b, the primers for amplifying the sequence shown in SEQ ID No. 3 in the step 1) are a forward primer TG1 and a reverse primer TG2, the nucleotide sequence of the forward primer TG1 is shown as SEQ ID No. 4, the nucleotide sequence of the reverse primer TG2 is shown as SEQ ID No. 5, and the template sequence is SEQ ID No. 2. In the application, the system used for amplifying the hairpin structure sequence is: 2 μL of the forward primer TG1 with a concentration of 100 μM, 2 μL of the reverse primer TG2 with a concentration of 100 μM, 1 μL of spacer template, 25 μL of Pfu PCR Mix, and 20 μL of ddH2O; the hairpin structure sequence is shown as SEQ ID No. 3. In the application, the running program for amplifying the target sequence is: 1) 94 ℃ for 5 min; 2) 30 cycles of 94 ℃ for 30 s, 50 ℃ for 45 s, and 72 ℃ for 3 s; 3) 72 ℃ for 10 min; 4) 4 ℃ storage; and the target sequence is shown as SEQ ID No. 3. In the application, the pBWA(V)HS vector and the hairpin structure nucleotide sequence SEQ ID No. 3 are subjected to enzyme digestion with BsaI / Eco31I and then connected using T4 DNA ligase to obtain a recombinant vector pBWA(V)HS-STTM529b. In the application, the E. coli is E. coli DH5α, and the Agrobacterium is Agrobacterium EHA105.
[0030] The application further provides application of the silenced miR529b in the positive selection of the brown planthopper-resistant rice.
[0031] SEQ ID No. 1:
[0032] 19-AGAAGAGAGAGAGUACAGCUU-39.
[0033] SEQ ID No. 2:
[0034] GTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT.
[0035] SEQ ID No. 3:
[0036] aagctgtactcctatctctcttcTGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCT AAAGAAGAAGAATtaagctgtactcctatctctcttct.
[0037] SEQ ID No. 4: cagtGGTCTCacaacaagctgtactcctatctctcttctgttgttgttgttatggt;
[0038] SEQ ID No. 5: cagtGGTCTCatacaagaagagagataggagtacagcttattcttcttctttaga.
[0039] In order to further illustrate the present application, the present application is described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.
[0040] Example 1
[0041] I. Experimental materials
[0042] 1. Rice materials
[0043] The rice material used in the present application is Nipponbare (NIP). The rice material for testing is planted in the Institute of Genetics, Wuhan University, and is cultivated under natural conditions outdoors from May to October, and is cultivated in a plant greenhouse for the rest of the year, with the cultivation temperature controlled at 28℃, the relative humidity controlled between 70-80%, and the light cycle controlled at 16h light / 8h darkness per day.
[0044] 2. Brown planthoppers and rearing
[0045] The brown planthopper was collected from the natural population in the field in Wuhan and was reared on a susceptible rice variety without insect-resistant genes. The brown planthopper was reared in a greenhouse of Wuhan University, and the temperature was controlled at 27±1°C, the relative humidity was 70-80%, and the light cycle was 16h light / 8h dark. The rice seedlings in the vegetative growth stage and in good condition were selected for rearing the brown planthopper, and the rice seedlings were replaced in time according to the density of the brown planthopper and the growth state of the rice seedlings.
[0046] II. Experimental procedure
[0047] 1. Design of the simulated target sequence
[0048] According to the sequence of miR529b, the corresponding complementary oligonucleotide chain was designed. These sequences were designed to form an incomplete complementary bubble structure with the cleavage site of miR529b, so as to prevent the effective cleavage of miR529b.
[0049] The nucleotide sequence of miR529b (SEQ ID No. 1) is as follows:
[0050] 19-AGAAGAGAGAGAGUACAGCUU-39;
[0051] The STTM hairpin structure sequence containing miR529b (SEQ ID No. 3) is as follows: aagctgtactcctatctctcttcTGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAA GAAGAAGAATtaagctgtactcctatctctcttct.
[0052] 2. Construction of the vector
[0053] 1) Vector enzyme treatment: the enzyme system was 1 μL BsaI / Eco31I, 5 μL Buffer, 200 ng / μL pBWA(V)HS vector 5 μL, ddH2O 39 μL, and incubation at 37°C for 1 h.
[0054] 2) Vector purification and recovery: after the completion of the vector enzyme incubation, electrophoresis was performed, and the large fragment was recovered using a DC301 DNA gel recovery kit (Nanjing Novozyme Bio-tech Co., Ltd.), and 40 μL eluent was used for elution to obtain the purified product after vector enzyme treatment.
[0055] 3) PCR amplification of the target sequence: according to the sequence of miR529b, a forward primer TG1 (SEQ ID No. 4) cagtGGTCTCacaacaagctgtactcctatctctcttctgttgttgttgt tatggt and a reverse primer TG2 (SEQ ID No. 5) cagtGGTCTCatacaagaagagagatagga gtacagcttattcttcttctttaga were designed. Spacer (SEQ ID No. 2) GTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT was used as a template for PCR amplification. The running program for amplifying the target sequence was: 1) 94°C for 5 min; 2) 30 cycles: 94°C for 30 s, 50°C for 45 s, 72°C for 5 s; 3) 72°C for 10 min; 4) 4°C storage.
[0056] 4) Purification and recovery of PCR product: after the end of the PCR amplification reaction, electrophoresis was performed to cut the gel, and the target fragment was recovered using a DC301 DNA gel recovery kit. 40 μL of eluent was used for elution to obtain the purified PCR product.
[0057] 5) Enzymatic digestion of PCR product: the enzyme digestion system used 1 μL of BsaI / Eco31I, 5 μL of Buffer, 40 μL of purified PCR product obtained in step 4) above, 4 μL of ddH2O, and was incubated at 37°C for 1 h.
[0058] 6) Purification and recovery of PCR product after enzyme digestion: after the completion of the incubation of the PCR product after enzyme digestion, electrophoresis was performed to cut the gel, and the target fragment was recovered using a DC301 DNA gel recovery kit. 40 μL of eluent was used for elution to obtain the purified PCR product after enzyme digestion.
[0059] 7) Ligation: the purified vector and PCR product obtained by steps 2) and 6) were ligated. The ligation system used 2 μL of the purified product after vector digestion, 6 μL of the purified product after PCR product digestion, 1 μL of T4 ligase, and 1 μL of Buffer, and was incubated at 4°C for 16 h.
[0060] 8) Transformation: the ligation product obtained in step 7) above was used to transform E. coli DH5α strain by heat shock method. Clones were selected for PCR amplification and sequencing verification. The forward primer TG1 and the reverse primer GUS-R (SEQ ID No. 6) ataaaagagaaaagggtcctaacc were used for sequencing.
[0061] The plasmid which is compared correctly is transformed into Agrobacterium EHA105 strain, and the strain is used to transform Nipponbare, and hygromycin is used to screen to obtain T0 generation transgenic rice, which is STTM-miR529b transgenic line, and is named as STTM-miR529b.
[0062] 3. Identification of transgenic rice
[0063] PCR amplification, sequencing verification and sequence analysis are carried out on the T2 generation transgenic plants: the amplification primers are hygromycin marker primers: HYG-F (SEQ ID No. 7): CGAGAGCCTGACCTATTGCAT; HYG-R (SEQ ID No. 8): CTGCTCCATACAAGCCAACCAC. The positive plants are used for subsequent experiments.
[0064] Example 2
[0065] The STTM-miR529b transgenic rice and its transgenic receptor NIP are subjected to resistance identification of brown planthopper by seedling group method, and the identification work is completed by Wuhan Hetaiqinqing Biotechnology Co., Ltd.
[0066] The brown planthopper used for identification is collected in a rice field under natural conditions and is cultured on the brown planthopper susceptible rice material "Taichung No. 1" in the Plant Genetics Center of Wuhan University.
[0067] The seeds of the test material are sown in a plastic cup with a diameter of 12 cm and a height of 15 cm. When the seedlings grow to four-leaf stage, two to three instar nymphs of brown planthopper are introduced into each seedling at a quantity of 8. The identification variety is infected with brown planthopper to a specific variety death, the damage degree of the single plant is investigated, the reading rating is read, and the single plant grading evaluation standard of rice seedling resistance identification is as follows:
[0068] Table 1 Single plant grading evaluation standard of rice seedling resistance identification
[0069]
[0070] The T2 generation transgenic homozygous line of STTM-miR529b is subjected to resistance identification of brown planthopper, and the insect resistance identification result shows that after the test material is introduced into brown planthopper, until the feeding of brown planthopper causes most of the transgenic receptor plants NIP to appear the phenotype of plant death Figure 2A) When the resistance score was 9, only a few plants of two T2 generation transgenic lines STTM-miR529b-1 and STTM-miR529b-2 of STTM-miR529b plants wilted or turned yellow, and the resistance scores were 4.4 and 3.5, respectively. The lower the score of resistance grade identification, the stronger the resistance of the plants. The data were the average and standard deviation of three independent biological replicates. The data were analyzed by ANOVA test, and the P values of comparison between the experimental group and the control group are shown in the figure Figure 2 B).
[0071] The experimental results showed that silencing the expression of miR529b could significantly enhance the resistance of Nipponbare plants to BPH, indicating that miR529b indeed regulated the resistance of rice to BPH.
[0072] Although the above embodiments have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which all belong to the protection scope of the present application.
Claims
1. Application of silencing miR529b in positive regulation of rice resistance to brown planthopper.
2. The application according to claim 1, characterized in that, The nucleotide sequence of miR529b is shown in SEQ ID No.
1.
3. The application according to claim 1 or 2, characterized in that, The application includes the following steps: 1) A hairpin loop structure with a nucleotide sequence as shown in SEQ ID No. 2 is artificially synthesized, and target miRNA binding sites are added to both ends. Each miRNA binding site includes 3 non-complementary bases, and the 3 non-complementary bases are CTA, to obtain a hairpin structure with a nucleotide sequence as shown in SEQ ID No. 3; 2) Connect the hair clip structure obtained in step 1) to the pBWA(V)HS carrier to obtain the connecting carrier pBWA(V)HS-STTM529b; 3) Transform the ligation vector pBWA(V)HS-STTM529b obtained in step 2) into Escherichia coli and extract the plasmid; 4) The plasmid obtained in step 3) is transferred into Agrobacterium to obtain the transformant; 5) Transform the transformant bacteria obtained in step 4) into rice to obtain STTM-miR529b transgenic rice resistant to brown planthopper with silenced miR529b.
4. The application according to claim 3, characterized in that, The primers for amplifying the hairpin structure in step 1) are forward primer TG1 and reverse primer TG2. The nucleotide sequence of the forward primer TG1 is shown in SEQ ID No. 4, the nucleotide sequence of the reverse primer TG2 is shown in SEQ ID No. 5, and the template sequence is SEQ ID No.
2.
5. The application according to claim 3, characterized in that, The system used to amplify the hairpin structure is as follows: 2 µL of 100 µM forward primer TG1, 2 µL of 100 µM reverse primer TG2, 1 µL of spacer template, 25 µL of Pfu PCR Mix, and 20 µL of ddH2O.
6. The application according to claim 3, characterized in that, The procedure for amplifying the hairpin structure is as follows: 1) 94℃ for 5 min; 2) 30 cycles: 94℃ for 30 s, 50℃ for 45 s, 72℃ for 3 s; 3) 72℃ for 10 min; 4) Store at 4℃.
7. The application according to claim 3, characterized in that, The pBWA(V)HS vector and hairpin structure were double-digested with BsaI / Eco31I and then ligated using T4 DNA ligase to obtain the ligation vector pBWA(V)HS-STTM529b.
8. The application according to claim 3, characterized in that, The *Escherichia coli* is *Escherichia coli* DH5α; the *Agrobacterium* is *Agrobacterium* EHA105.
9. Application of silencing miR529b in positive selection of brown planthopper-resistant rice.
Citation Information
Patent Citations
A method for constructing a monocotyledonous miRNA efficient silencing vector
CN109207510A
Application of rice source Osa-miR529a to prevention and treatment of brown planthopper
CN118562806A