Specific detection target Pc_s460833 of Pythium cedarense, the pathogen of cedar trees, and its application

By combining LAMP technology with specific detection targets and primer combinations, the problems of rapid and accurate detection of Pythium cedarum have been solved, achieving highly sensitive detection of Pythium cedarum, which is suitable for primary care institutions.

CN120648833BActive Publication Date: 2026-05-26JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY
Filing Date
2025-02-11
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid and accurate detection of Pythium cedarum. Traditional methods are time-consuming, labor-intensive, and require extensive identification experience, and lack highly sensitive detection methods suitable for grassroots use.

Method used

LAMP technology was used in conjunction with specific detection targets Pc_s135192, Pc_s460833, Pc_s103050, PcPL3_2 and Pc_s376271 to design corresponding primer combinations, and the color change of the amplification product was observed through LAMP reaction for detection.

Benefits of technology

It enables rapid, efficient, and accurate detection of Pythium cedarum, with a sensitivity of 100 pg·μL-1, making it suitable for grassroots inspection and quarantine agencies. The results can be observed with the naked eye.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648833B_ABST
    Figure CN120648833B_ABST
Patent Text Reader

Abstract

This invention discloses a specific detection target Pc_s460833 for the cedar pathogen Pythium cedri and its application. The specific detection target includes the nucleotide sequence Pc_s460833 as shown in SEQ ID NO.7. The LAMP primer composition designed based on the above target gene disclosed in this invention can be used for rapid and efficient detection of Pythium cedri. The detection method has the advantages of high specificity, high accuracy, good sensitivity, simple operation, and visually observable results. When the DNA reaches 100 pg·μL... ‑1 It can identify Pythium cedarum in a short time, making it highly practical.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a specific detection target Pc_s460833 for the cedar pathogen Pythium cedarense and its application, belonging to the field of biotechnology detection. This case is a divisional application of application number 202510150415.5, entitled "A specific detection target for Pythium cedarense, a LAMP primer composition and its application". Background Technology

[0002] *Pythium* is an important plant pathogen belonging to the phylum Oomycota, order Peronosporales, and family Pythiaceae. It parasitizes freshwater algae and is saprophytic in moist soils of vegetable gardens and greenhouses, commonly causing root rot in crops and damping-off in seedlings. The mycelium proliferates in large quantities, appearing as cottony, branched, and non-septate multinucleate hyphae. For example, the most common *Pythium* species infects about 100 cultivated plant species, including melons, beans, cotton, and hemp, causing various rot diseases and damping-off, resulting in very serious economic losses.

[0003] *Pythium cedri*, belonging to the genus *Pythium*, was first isolated and reported in Jiangsu Province in 2017. It can infect the roots of cedar trees, causing root rot and damping-off symptoms. Currently, there are few detection techniques for *Pythium cedri*. Traditional plate isolation and identification methods are time-consuming, labor-intensive, and require extensive experience from the identification personnel, making them unsuitable for grassroots levels. Loop-mediated isothermal amplification (LAMP), a novel nucleic acid amplification technique proposed by Notomi et al. in 2000, has been widely used in pathogen detection and infectious disease diagnosis, showing promising application prospects. This technique has been widely applied in the detection and research of oomycete pathogens. Its greatest advantages are its rapid reaction speed, simple equipment, and easy result identification, making it particularly suitable for grassroots inspection and quarantine institutions and medical institutions. Currently, there are no reports domestically or internationally on the use of LAMP technology for the detection of *Pythium cedri*.

[0004] The core of all current detection methods is to discover target genes with high specificity. Different target sequences exhibit varying degrees of specificity and sensitivity, and the results can differ significantly depending on the selected target sequence and fragment size. The selection of target genes should ensure high conservation among different strains within a species, while exhibiting high variability between species.

[0005] In summary, discovering highly reliable and specific molecular detection targets and establishing a sensitive and accurate detection technology system based on new targets plays an important role in improving the rapid molecular detection research of Pythium cedarum and the early diagnosis of diseases caused by it. Summary of the Invention

[0006] Purpose of the invention: The purpose of this invention is to provide a specific detection target for Pythium cedri, as well as a primer composition for detecting the target and its application.

[0007] Technical Solution: This invention provides a specific detection target for Pythium cedri, wherein the specific detection target includes one or more of the following nucleotide sequences: Pc_s135192 as shown in SEQ ID NO.1, Pc_s460833 as shown in SEQ ID NO.7, Pc_s103050 as shown in SEQ ID NO.13, PcPL3_2 as shown in SEQ ID NO.20, or Pc_s376271 as shown in SEQ ID NO.27.

[0008] SEQ ID NO.1: aacacgattggctgcaagaagggtggcgttggccacgtgacgcatgtcaaggctggtgcgaacatcccagtgcgttactaccgtaacaaccacatt ggtggctttgtccgttggtcgatcatcaagcgtggtgaaccagagacgcgtgagaatttcgacaagaacatcttcttgtacacgtgccgcgaagtcggaaag gattgcatgcctcgcggtctcccttactcgcgttgggaacgtgccaacgacaatgtcgacgtgttcaacattatctgcggtgactacattacgattccaag ctaccttgacgacggtgactacgtgcttcagttcaccaacttcggcacgggccacagcaacggtatccccggccaagctacgccaacctaccgatcgtgcg.

[0009] SEQ ID NO.7:atgtgccaagttcaaatcgccactcgaagctgccgtcttgccaagcctgcttctgccaagatgtcaccaggctacaagcata tgaaggtgacgacacgaagtgcaccagtcattacaatcaagaaggacacggtttgccgtatcgccaagcggataatgaccgaagcgtctggagaagacct ggacctcgaggtcaacctcctccgacatactgtgagcgagatgcagcaccaggtcaacgctgctgcgcggcagatccaggatatccgctccttactcaccca atacatggcaacccag。

[0010] SEQ ID NO.13:acgtgcgacgccatgtgccgctgactgccacggcggagcgctttggactctccaagagaccaggtacgtagctcgtgg gcgtggagcggagctgctcgtggggaccgacggattctgtgcattatcagctgcgtgggtgagtcagcatggtgcgtttgtgctctggatccatggcgcttc cgttggcgagtgtctctcggcattgcccattgtcgacatggtcttgtcctggtcctcgacgccgacgcaagtggtcatgaccaccacgacagcggcagcaaggcagctgttgcaacagcg。

[0011] SEQ ID NO.20:tttggtaagctctaccgttcgtgtggcaactgtaagacgcagtacgaacgccatgtggtagtgagcaacgtgttggcggt gaacccgaagaaggccgtgacgatgatcaacaccaacttgggtgacacggctaccatctccaacttgcacttgacgtcgagcaagggtgacaagacggt gtgcgtgtggtcgaagggtgtgacgagcggtgagccatcggagactggctacggtccatcgaagagctgcatctacacggccaaggacgtgatcttgagcaagcgattgttgcgtgcctaa。

[0012] SEQ ID NO.27: gatcgcaggcaatgacaaggtaggcgaggagtgtgcacggtgtatgagacgcagggtgtgacgtggtgagctacaggtg cgccatcgatgggagatcatcaatgcggggatcccagggagcttttcgcaagattggttattgaacgcgccgaccaaggtatgcacacaagatcctggcg acgtctcatgtagtggcgaatgattcagtgaaacgctgtgtctcccagtactttgagagcgtgatctcctccaacaaacgcacaagcgacgcggaaattgtaattgtcatgctcggctcga.

[0013] The present invention also provides a LAMP primer composition for detecting specific targets of the above-mentioned Pythium cedri, wherein the primer composition comprises primer combinations for detecting Pc_s135192 with nucleotide sequences as shown in SEQ ID NO.2-6, primer combinations for detecting Pc_s460833 with nucleotide sequences as shown in SEQ ID NO.8-12, primer combinations for detecting Pc_s103050 with nucleotide sequences as shown in SEQ ID NO.14-19, primer combinations for detecting PcPL3_2 with nucleotide sequences as shown in SEQ ID NO.21-26, or primer combinations for detecting Pc_s376271 with nucleotide sequences as shown in SEQ ID NO.28-33.

[0014] The present invention also provides the application of the above-described LAMP primer composition in the preparation of a kit for detecting Pythium cedri.

[0015] The present invention also provides a LAMP kit for detecting Pythium cedri, the kit comprising the above-described LAMP primer composition.

[0016] Furthermore, the kit also contains 10×ThermoPolBuffer, MgSO4, dNTPs, betaine, BstDNApolymerase, and hydroxynaphthol blue.

[0017] This invention also provides the application of the above-mentioned LAMP primer composition and LAMP kit in the detection of Pythiumcedri, wherein the detection is for non-disease diagnostic purposes.

[0018] This invention also provides a LAMP method for detecting Pythium cedri, comprising the following steps: extracting DNA from the microorganism to be tested, using the DNA solution as a reaction template, performing a LAMP reaction with the primer composition described above, and then observing the color change of the amplification product. If the amplification product is sky blue, the test result is positive, indicating that Pythium cedri is present in the tested organism; if the amplification product is purple, the test result is negative, indicating that Pythium cedri is not present in the tested organism.

[0019] Furthermore, the LAMP reaction system consisted of: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 0.8 μmol·L⁻¹ of loop primers LB and / or LF -1 0.8 μmol·L -1 Betaine, 8 U·μL -1 BstDNApolymerase, 180 mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to bring the volume to 26 μL.

[0020] Furthermore, the LAMP reaction procedure is as follows: reaction amplification at 63°C for 63–70 min.

[0021] Beneficial Effects: Compared with the prior art, the present invention has the following significant advantages: The present invention discloses target genes Pc_s135192, Pc_s460833, Pc_s103050, PcPL3_2, and Pc_s376271 specifically for detecting Pythium cedri. LAMP primer compositions designed based on the above target genes can be used for rapid and efficient detection of Pythium cedri. The detection method has the advantages of high specificity, high accuracy, good sensitivity, simple operation, and results that can be observed visually. When the DNA reaches 100 pg·μL... -1 It can identify Pythium cedarum in a short time, making it highly practical. Attached Figure Description

[0022] Figure 1 The nucleic acid sequence and primer positions of the Pc_s135192 gene of Pythium cedarum.

[0023] Figure 2This is the specificity verification result of Example 1, where 1-6 are different *Pythium cedri* strains, and 7-35 are *P. acanthicum*, *P. aphanidermatum*, *P. deliense*, *P. myriotylum*, *P. hydnosporum*, *P. oligandrum*, *P. oopapillum*, *P. periilum*, *P. periplocum*, *P. rhizo-oryzae*, *P. xuzhouense*, *Globisporangium huanghuaiense*, *G. irregulare*, *G. middletonii*, *G. paroecandrum*, *G. pengfuense*, *G. recalcitrans*, *G. spinosum*, *G. splendens*, *G. ultimum var. ultimum*, *Phytopythium helicoides*, *Phytopythora cactorum*, *Ph. cinnamomi*, *Ph. boehmeriae*, *Botrytis cinerea*, and *Colletotrichum*, respectively. gloeosporioides, Fusarium graminearum, Saprolegnia parasitica, and ddH2O (negative control).

[0024] Figure 3 The results are the sensitivity verification results for Example 1.

[0025] Figure 4 The results are from the field trial of Example 1. 1 represents *Pythium cedarense* (positive control), 2-8 represent suspected diseased plants, and 9 represents ddH2O (negative control).

[0026] Figure 5 The nucleic acid sequence and primer positions of the Pc_s460833 gene of Pythium cedarum.

[0027] Figure 6The specificity verification results of Example 2, where 1-6 are different *P. cedri* species, and 7-36 are *P. acanthicum*, *P. aphanidermatum*, *P. deliense*, *P. myriotylum*, *P. hydnosporum*, *P. nunn*, *P. oopapillum*, *P. periilum*, *P. periplocum*, *P. rhizo-oryzae*, *P. xuzhouense*, *Globisporangium intermedium*, *G. huanghuaiense*, *G. irregulare*, *G. middletonii*, *G. nodosum*, *G. orthogonon*, *G. paroecandrum*, *G. spinosum*, *G. splendens*, *G. ultimum var. ultimum*, *Phytopythium helicoides*, *P. vexans*, *Phytophthora cactorum*, *Ph. Cinnamomi*, *Ph. boehmeriae*, *Botrytis cinerea*, *Colletotrichum gloeosporioides*, and *Fusarium*, respectively. graminearum and ddH2O (negative control).

[0028] Figure 7 This is the sensitivity verification result for Example 2.

[0029] Figure 8 The nucleic acid sequence and primer positions of the Pc_s103050 gene of Pythium cedarum.

[0030] Figure 9 The results of detecting different strains of Pythium cedarum (P. cedri) and the negative control are shown in Example 3.

[0031] Figure 10The results of the specificity verification in Example 3 are as follows: 1 is *P. cedri* strain, and 2-33 are *P. acanthicum*, *P. aphanermatum*, *P. deliense*, *P. myriotylum*, *P. hydnosporum*, *P. nunn*, *P. oligandrum*, *P. oopapillum*, *P. periilum*, *P. periplocum*, *P. rhizo-oryzae*, *P. subinflatum*, *P. supoonaiense*, *P. xuzhouense*, *Globisporangium intermedium*, *G. irregulare*, *G. middletonii*, *G. nodosum*, *G. orthogonon*, *G. paroecandrum*, *G. spinosum*, *G. splendens*, *G. ultimum var. ultimum*, *Phytopythium helicoides*, *Phytophthoracactorum*, *Ph. cinnamomi*, *Ph. boehmeriae*, and *Botrytis*, respectively. cinerea, Colletotrichumgloeosporioides, Fusarium graminearum, Saprolegnia parasitica, and ddH2O (negative control).

[0032] Figure 11 The results are the sensitivity verification results for Example 3.

[0033] Figure 12 This is the result of spore concentration verification in Example 3.

[0034] Figure 13 The nucleic acid sequence and primer positions of the PcPL3_2 gene of Pythium cedarum.

[0035] Figure 14The results represent the specificity verification of Example 4, where 1-8 are different Pythium cedri species, and 9-30 are P. acanthicum, P. aphandermatum, P. deliense, P. myriotylum, P. oopapillum, P. periilum, P. periplocum, P. rhizo-oryzae, P. sukuiense, Globisporangium irregulare, G. paroecandrum, G. spinosum, G. splendens, G. ultimum var. ultimum, Phytopythium helicoides, Phytophthora cactorum, Ph. cinnamomi, Ph. boehmeriae, Botrytis cinerea, Colletotrichum gloeosporioides, Fusarium graminearum, and ddH2O (negative control).

[0036] Figure 15 Sensitivity verification results of Example 4.

[0037] Figure 16 The nucleic acid sequence and primer positions of the Pythium cedriPc_s376271 gene are shown.

[0038] Figure 17For the specificity verification results of Example 5, 1-7 are different Pythium cedri strains, and 8-32 are Pythium acanthicum, P. aphanermatum, P. deliense, P. myriotylum, P. hydnosporum, P. oopapillum, P. periilum, P. periplocum, Globisporangium huanghuaiense, G. irregulare, G. middletonii, G. paroecandrum, G. spinosum, G. splendens, G. ultimum var. ultimum, Phytopythium helicoides, Ph. vexans, Phytophthora cactorum, Ph. cinnamomi, Ph. boehmeriae, Botrytis cinerea, Colletotrichum gloeosporioides, Fusarium graminearum, Saprolegnia parasitica, and ddH2O (negative control).

[0039] Figure 18 The results are the sensitivity verification results for Example 5. Detailed Implementation

[0040] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0041] Screening and selection of detection targets for Pythium cedarum: This study utilized BLAST sequence search, sequence extraction, alignment, and analysis to mine a large-scale genomic database, thereby identifying detection targets for Pythium cedarum. Through whole-genome alignment, over 1000 specific detection targets for Pythium cedarum were obtained. From these over 1000 specific genes, a subset of genes (with sequences alternating between evolutionary and conserved regions of the Pythium cedarum genome) were randomly selected as candidate genes. Specific primers were designed and screened, ultimately identifying five specific targets: Pc_s135192, Pc_s460833, Pc_s103050, PcPL3_2, and Pc_s376271.

[0042] Example 1: Detection of Pythium cedarense using Pc_s135192 as a specific target

[0043] 1. Specificity verification

[0044] LAMP primer composition for detecting Pythium cedarense: Forward inner primer FIP as shown in SEQ ID NO.2, reverse inner primer BIP as shown in SEQ ID NO.3, forward outer primer F3 as shown in SEQ ID NO.4, reverse outer primer B3 as shown in SEQ ID NO.5, and reverse loop primer LB as shown in SEQ ID NO.6 (Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Detailed information is shown in Table 1. The Pc_s135192 gene sequence and primer positions are as follows...). Figure 1 (As shown).

[0045] Table 1

[0046]

[0047] Detection method: Extract DNA from the microorganism to be tested, use the DNA solution as a reaction template, and add a reaction solution including the primers mentioned above to perform a LAMP reaction. The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 0.8 μmol·L -1 LB circular primer, 0.8 μmol·L⁻¹ -1 Betaine, 8 U·μL -1 BstDNApolymerase, 180 mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to a final volume of 26 μL; the LAMP reaction procedure is as follows: amplify at 63℃ for 70 min, then observe the color change of the amplification product. If it turns sky blue, the test result is positive and Pythium cedarum is present; if it turns purple, the test result is negative and Pythium cedarum is not present.

[0048] To verify the specificity of the LAMP method, six different strains of *Pythium cedarense* and 28 other oomycetes or fungal strains were used as test materials (Table 2). The LAMP results showed that only the reaction tube solution using *Pythium cedarense* as a template showed a sky-blue positive reaction, while the other tested microbial strains and the negative control all showed a purple negative reaction. Figure 2 ).

[0049] Table 2

[0050]

[0051]

[0052] 2. Sensitivity Verification

[0053] To determine the sensitivity of the LAMP detection method, the concentration of the extracted Pythium cedarense DNA was measured using a spectrophotometer and diluted sequentially in 10-fold increments to achieve a mass concentration of 10 ng·μL. -1 1 ng·μL -1 100 pg·μL -1 10 pg·μL -1 1 pg·μL -1 100 fg·μL -1 and 10 fg·μL -1 Two μL of each sample was used as template for LAMP reaction. The reaction program was 63℃ for 70 min. HNB colorimetric results indicated that when the DNA concentration of *Pythium cedarense* reached 100 pg·μL... -1 The solution in the reaction tube will turn sky blue. Figure 3 ).

[0054] 3. Field trials

[0055] To determine the applicability of the LAMP detection method, seven suspected diseased plants were brought back to the laboratory. 2 μL of DNA extracted from the diseased tissue samples, positive control (Pythium cedarense DNA), and negative control ddH2O were used as templates for LAMP reaction. The reaction program was 63℃ for 70 min. Field trial results showed that Pythium cedarense DNA was detected in the diseased tissue of five plants. Figure 4 Meanwhile, pathogens were isolated from the root tissues of 7 diseased samples, and the pathogen species were identified based on the morphological characteristics and ITS sequences of the isolates. The results showed that Pythium cedarum was isolated from 5 samples that tested positive for LAMP, while the bacteria were not isolated from the remaining 2 samples that tested negative for LAMP.

[0056] 4. Primer composition screening

[0057] For the specific target Pc_s135192 of P. cedri, 20 sets of LAMP primers were designed that met the criteria. The most specific and highly sensitive set of primers was ultimately selected, which is the primer sequence used in the specificity verification (SEQ ID NO. 2–6). The remaining primers (only one set randomly selected from the remaining 20 primer pairs is used as a control) are as follows:

[0058] FIP1: 5'-AACGCCACCCTTCTTGCAGCTGAAGGTGGCAAGGAAATCG-3'; BIP1: 5'-ACGTG ACGCATGTCAAGGCTACCAAGTGTGGTTGTTACGGT-3'; F31: 5'-GCTTCTCGAGCCACTGTC-3'; B31: 5'-TGATCGACCAACGGACAAAG-3'; LF1: 5'-TCGTGTTTTGGACATCCTCCA-3'; LB1: 5'-GGTGCGAACATCCCAGTGCG-3'.

[0059] Using the strains listed in Table 2 as test materials (6 different *P. cedri* strains and 28 other oomycete and fungal strains), LAMP detection was performed according to the method in the specificity verification section. The results showed that the selected control primer set had low specificity and poor sensitivity. This indicates that the primer composition used in this invention has high specificity and sensitivity.

[0060] Example 2: Detection of Pythium cedarense using Pc_s460833 as a specific target

[0061] 1. Specificity verification

[0062] LAMP primer composition for detecting P. cedri: forward inner primer FIP as shown in SEQ ID NO. 8, reverse inner primer BIP as shown in SEQ ID NO. 9, forward outer primer F3 as shown in SEQ ID NO. 10, reverse outer primer B3 as shown in SEQ ID NO. 11, and reverse loop primer LB as shown in SEQ ID NO. 12 (primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Detailed information is shown in Table 3. The Pc_s460833 gene sequence and primer positions are as follows...). Figure 5 (As shown).

[0063] Table 3

[0064]

[0065] Detection method: Extract DNA from the microorganism to be tested, use the DNA solution as a reaction template, and add a reaction solution including the primers mentioned above to perform a LAMP reaction. The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -10.8 μmol·L -1 LB circular primer, 0.8 μmol·L⁻¹ -1 Betaine, 8 U·μL -1 BstDNApolymerase, 180 mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to a final volume of 26 μL; the LAMP reaction procedure is as follows: amplify at 63℃ for 68 min, then observe the color change of the amplification product. If it turns sky blue, the test result is positive and P. cedri is present; if it turns purple, the test result is negative and P. cedri is not present.

[0066] To verify the specificity of the LAMP method, six different *P. cedri* strains and 29 other oomycete and fungal strains were used as test materials (Table 4). The LAMP results showed that only the reaction tube solution using *P. cedri* as a template showed a sky-blue positive reaction, while the other tested microbial strains and the negative control all showed a purple negative reaction. Figure 6 ).

[0067] Table 4

[0068]

[0069] 2. Sensitivity Verification

[0070] To determine the sensitivity of the LAMP detection method, the concentration of extracted P. cedri DNA was measured using a spectrophotometer and diluted 10-fold to achieve a final concentration of 10 ng / μL. -1 1 ng·μL -1 100 pg·μL -1 10 pg·μL -1 1 pg·μL -1 100 fg·μL -1 and 10 fg·μL -1 2 μL of each sample was used as template for LAMP reaction. The reaction program was 63℃ for 68 min. HNB colorimetric results indicated that when the concentration of P. cedri DNA reached 100 pg·μL... -1 The solution in the reaction tube will turn sky blue. Figure 7 ).

[0071] 3. Primer composition screening

[0072] For the specific target Pc_s460833 of P. cedri, 20 sets of LAMP primers were designed that met the criteria. The most specific and highly sensitive set of primers was ultimately selected, which is the primer sequence used in the specificity verification (SEQ ID NO. 8–12). The remaining primers (only one set randomly selected from the remaining 20 primer pairs is used as a control) are as follows:

[0073] FIP1: 5'-CGGCAAACCGTGTCCTTCTTGAGATGTCACCAGGCTACAAGC-3'; BIP1: 5'-ATG ACCGAAGCGTCTGGAAGGTGCTGCATCTCGCTCAC-3'; F31: 5'-CAAGCCTGCTTCTGCCAA-3'; B31: 5'-GCGGATATCCTGGATCTGC-3'; LF1: 5'-ACTTCGTGTCGTCACCTTCATAT-3'; LB1: 5'-ACCTGGACCTCGAGGTCAACC-3'.

[0074] Using the strains listed in Table 4 as test materials (6 different *P. cedri* strains and 29 other oomycete and fungal strains), LAMP detection was performed according to the method in the specificity verification section. The results showed that the selected control primer set had low specificity and poor sensitivity. This indicates that the primer composition used in this invention has high specificity and sensitivity.

[0075] Example 3: Detection of Pythium cedarense using Pc_s103050 as a specific target

[0076] 1. Specificity verification

[0077] LAMP primer composition for detecting Pythium cedarense (P. cedri): forward inner primer FIP as shown in SEQ ID NO. 14, reverse inner primer BIP as shown in SEQ ID NO. 15, forward outer primer F3 as shown in SEQ ID NO. 16, reverse outer primer B3 as shown in SEQ ID NO. 17, reverse loop primer LF as shown in SEQ ID NO. 18, and reverse loop primer LB as shown in SEQ ID NO. 19 (primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Detailed information is shown in Table 5. The Pc_s103050 gene sequence and primer positions are as follows...). Figure 8 (As shown).

[0078] Table 5

[0079]

[0080] Detection method: Extract DNA from the microorganism to be tested, use the DNA solution as a reaction template, and add a reaction solution including the primers mentioned above to perform a LAMP reaction. The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 0.8 μmol·L⁻¹ of loop primers LF and LB -1 0.8 μmol·L -1 Betaine, 8 U·μL -1 BstDNApolymerase, 180 mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to a final volume of 26 μL; the LAMP reaction procedure is as follows: amplify at 63℃ for 70 min, then observe the color change of the amplification product. If it turns sky blue, the test result is positive and Pythium cedarii (P. cedri) is present; if it turns purple, the test result is negative and Pythium cedarii (P. cedri) is not present.

[0081] To verify the specificity of the LAMP method, seven strains of Pythium cedarum (P. cedri) and 31 other oomycete or fungal strains were used as test materials (Table 6). The LAMP results showed that only the reaction tube solution using P. cedarum DNA as a template exhibited a sky-blue positive reaction. Figure 9 Other tested microbial strains and the negative control all showed a purple negative reaction. Figure 10 ).

[0082] Table 6

[0083]

[0084]

[0085] 2. Sensitivity Verification

[0086] To determine the sensitivity of the LAMP detection method, the concentration of the extracted Pythium cedarense DNA was measured using a spectrophotometer and diluted sequentially in 10-fold increments to achieve a final concentration of 10 ng / μL. -1 1 ng·μL -1 100 pg·μL -1 10 pg·μL -1 1 pg·μL -1 100 fg·μL -1and 10 fg·μL -1 Two μL of each sample was used as template for LAMP reaction. The reaction program was 63℃ for 70 min. HNB colorimetric results indicated that when the DNA concentration of Pythium cedarense (P. cedri) reached 100 pg·μL... -1 The solution in the reaction tube will turn sky blue. Figure 11 ).

[0087] 3. Primer composition screening

[0088] Twenty sets of primers were designed targeting the specific target Pc_s103050 of *Pythium cedarum*. The most specific and highly sensitive set of primers was ultimately selected, which is the primer sequence used in the specificity verification (SEQ ID NO. 14–19). The remaining primers (only one set randomly selected from the remaining 20 primer pairs for illustration) were used as controls. The specific primer sequences are as follows:

[0089] FIP1: 5'-CCAGCAGTCGGTGTGGGATGAAGATCATCATTGGCGTGGA-3'; BIP1: 5'-GCGTC GAGAGAACGTGGTGATGACTCGAGATGAGGTTCTGGT-3'; F31: 5'-CGCATCAAAGACCTCATT GC-3'; B31: 5'-GCCCATTGATGCGTCCAA-3'; LB1: 5'-CCAGATCGGTGTTCCATCGC-3'.

[0090] Using the strains listed in Table 6 as test materials (7 different *Pythium cedarense* strains and 31 other oomycetes and fungal strains), LAMP detection was performed according to the method in the specificity verification section. The results showed that the selected control primer set had low specificity and poor sensitivity. This indicates that the primer composition used in this invention has high specificity and sensitivity.

[0091] 4. Verification of the detected spore concentration

[0092] To determine the lower limit of LAMP detection of *P. cedri* spore concentration, suspensions of 0, 10, 50, 100, 1000, and 10000 *P. cedri* oospores were added to six 0.25 g sterile soil samples. DNA was extracted from the treated soil samples according to the instructions of a soil DNA extraction kit (MO BIO), with DNA from a standard *P. cedri* strain used as a positive control and ddH2O as a negative control. The presence of *P. cedri* was detected by LAMP amplification when at least 10 *P. cedri* oospores were present in 0.25 g of soil. Figure 12 This result demonstrates that the method has high sensitivity and can effectively detect whether soil samples carry Pythium cedarense (P. cedri).

[0093] Example 4: Detection of Pythium cedarense using PcPL3_2 as a specific target

[0094] 1. Specificity verification

[0095] LAMP primer composition for detecting Pythium cedarense: Forward inner primer FIP as shown in SEQ ID NO.21, reverse inner primer BIP as shown in SEQ ID NO.22, forward outer primer F3 as shown in SEQ ID NO.23, reverse outer primer B3 as shown in SEQ ID NO.24, reverse loop primer LF as shown in SEQ ID NO.25, and reverse loop primer LB as shown in SEQ ID NO.26 (Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Detailed information is shown in Table 7. The PcPL3_2 gene sequence and primer positions are as follows...). Figure 13 (As shown).

[0096] Table 7

[0097]

[0098] Detection method: Extract DNA from the microorganism to be tested, use the DNA solution as a reaction template, and add a reaction solution including the primers mentioned above to perform a LAMP reaction. The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 0.8 μmol·L⁻¹ of loop primers LF and LB -1 0.8 μmol·L-1 Betaine, 8 U·μL -1 BstDNApolymerase, 180 mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to a final volume of 26 μL; the LAMP reaction procedure is as follows: amplify at 63℃ for 63 min, then observe the color change of the amplification product. If it turns sky blue, the test result is positive and Pythium cedarum is present; if it turns purple, the test result is negative and Pythium cedarum is not present.

[0099] To verify the specificity of the LAMP method, eight different strains of *Pythium cedarense* and 21 other oomycetes and fungal strains were used as test materials (Table 8). The LAMP results showed that only the reaction tube solution using *Pythium cedarense* as a template showed a sky-blue positive reaction, while the other tested microbial strains and the negative control all showed a purple negative reaction. Figure 14 ).

[0100] Table 8

[0101]

[0102]

[0103] 2. Sensitivity Verification

[0104] To determine the sensitivity of the LAMP detection method, the concentration of the extracted Pythium cedarense DNA was measured using a spectrophotometer and diluted sequentially in 10-fold increments to achieve a mass concentration of 10 ng·μL. -1 1 ng·μL -1 100 pg·μL -1 10 pg·μL -1 1 pg·μL -1 100 fg·μL -1 and 10 fg·μL -1 Two μL of each sample was used as template for LAMP reaction. The reaction program was 63℃ for 63 min. HNB colorimetric results indicated that when the DNA concentration of *Pythium cedarense* reached 100 pg·μL... -1 The solution in the reaction tube will turn sky blue. Figure 15 ).

[0105] 3. Primer composition screening

[0106] Twenty sets of primers were designed targeting the specific target PcPL3_2 of *Pythium cedarum*. The most specific and highly sensitive set of primers (SEQ ID NO. 21–26) was ultimately selected and used in the specificity verification. The remaining primers (only one set randomly selected from the remaining 20 pairs is used for illustration) serve as controls. The specific primer sequences are as follows:

[0107] FIP1: 5'-ACGATGAAGACGGCGTCCGATTGCGCGCTAACGTCACC-3'; BIP1: 5'-GAGAGCAACGCCACGCTCCGTTGCAGTCGCTGGTTGG-3'; F31: 5'-TG CCCGCAACAAGTACGA-3'; B31: 5'-GCCACAGGCGTTGGTGA-3'; LF1: 5'-TTGAGCGAGCCGACACC-3'; LB1: 5'-CACGGAACAGAAACTCGGTGT-3'.

[0108] Using the strains listed in Table 8 as test materials (8 strains of *Pythium cedarense* and 21 other oomycetes and fungal strains as test materials) and following the specificity verification method, LAMP detection was performed. The results showed that the selected control primer set had low specificity and poor sensitivity. This indicates that the primer composition used in this invention has high specificity and sensitivity.

[0109] Example 5: Detection of Pythium cedarense using Pc_s376271 as a specific target

[0110] 1. Specificity verification

[0111] LAMP primer composition for detecting Pythium cedarense: Forward inner primer FIP as shown in SEQ ID NO.28, reverse inner primer BIP as shown in SEQ ID NO.29, forward outer primer F3 as shown in SEQ ID NO.30, reverse outer primer B3 as shown in SEQ ID NO.31, reverse loop primer LF as shown in SEQ ID NO.32, and reverse loop primer LB as shown in SEQ ID NO.33 (Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Detailed information is shown in Table 9. The Pc_s376271 gene sequence and primer positions are as follows...). Figure 16 (As shown).

[0112] Table 9

[0113]

[0114] Detection method: Extract DNA from the microorganism to be tested, use the DNA solution as a reaction template, and add a reaction solution including the primers mentioned above to perform a LAMP reaction. The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L⁻¹ - 1 MgSO4, 1.2 mmol·L -1 dNTPs, 1.6 μmol·L⁻¹ of internal primers FIP and BIP -1 0.4 μmol·L⁻¹ of outer primers F3 and B3. -1 0.8 μmol·L⁻¹ of loop primers LB and LF -1 0.8 μmol·L -1 Betaine, 8 U·μL -1 BstDNApolymerase, 180 mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to a final volume of 26 μL; the LAMP reaction procedure is as follows: amplify at 63℃ for 63 min, then observe the color change of the amplification product. If it turns sky blue, the test result is positive and Pythium cedri is present; if it turns purple, the test result is negative and Pythium cedri is not present.

[0115] To verify the specificity of the LAMP method, seven different *Pythium cedri* strains and 24 other oomycetes and fungal strains were used as test materials (Table 10). LAMP detection results using *Pc_s376271* as the detection target showed that only the reaction tube solution using *Pythium cedri* as a template showed a sky-blue positive reaction, while the other tested microbial strains and the negative control all showed a purple negative reaction. Figure 17 ).

[0116] Table 10

[0117]

[0118]

[0119] 2. Sensitivity Verification

[0120] To determine the sensitivity of the LAMP detection method, the concentration of extracted Pythium cedri DNA was measured using a spectrophotometer and diluted 10-fold to achieve a final concentration of 10 ng / μL. -1 1 ng·μL -1 100 pg·μL -1 10 pg·μL -1 1 pg·μL -1 100 fg·μL-1 and 10 fg·μL -1 Two μL of each sample was used as template for LAMP reaction. The reaction program was 63℃ for 63 min. HNB colorimetric results indicate that when the DNA concentration of Pythium cedri reaches 100 pg·μL... -1 The solution in the reaction tube will turn sky blue. Figure 18 ).

[0121] 3. Primer composition screening

[0122] Twenty sets of primers were designed to target the specific target Pc_s376271 of *Pythium cedarum*. The most specific and highly sensitive primer set was ultimately selected, which is the primer sequence used in the specificity verification (SEQ ID NO. 28–33). The remaining primers (only one set randomly selected from the remaining 20 primer pairs for illustration) were used as controls. The specific primer sequences are as follows:

[0123] FIP1: 5'-CCTTCTTGCGCAGCGTGTCAAAAACGCCAAGGAGATCAGC-3'; BIP1: 5'-CAAGT ACGTGTGCCTCGCGACAGCATGGAGTTGAGTGGGA-3'; F31: 5'-CATGGCAAGGGCCAAGTC-3'; B31: 5'-CCTGGCACAAAAGTCCTCG-3'; LB1: 5'-GTGGCCAGTTCCACTCCACTTG-3'.

[0124] Using the strains listed in Table 10 as test materials (7 strains of *Pythium cedarense* and 24 other oomycetes and fungal strains as test materials) and following the specificity verification method, LAMP detection was performed. The results showed that the selected control primer set had low specificity and poor sensitivity. This indicates that the primer composition used in this invention has high specificity and sensitivity.

Claims

1. A method for detecting Pythium cedarum ( Pythium cedri The LAMP primer composition of ) is characterized in that, The primer composition consists of primer combinations with nucleotide sequences as shown in SEQ ID NO. 8~12.

2. A LAMP primer composition according to claim 1 for the preparation of a primer for detecting Pythium cedarum (… Pythium cedri Application in the kit.

3. A method for detecting Pythium cedarum ( Pythium cedri The LAMP kit of ) is characterized in that, The kit contains the LAMP primer composition of claim 1.

4. The method for detecting Pythium cedarum according to claim 3 (… Pythium cedri The LAMP kit of ) is characterized in that, The kit also contains 10×ThermoPol Buffer, MgSO4, dNTPs, betaine, Bst DNApolymerase, and hydroxynaphthol blue.

5. A LAMP primer composition according to claim 1, or a LAMP kit according to any one of claims 3-4, for the detection of Pythium cedarense (… Pythium cedri Applications in ).

6. A method for detecting Pythium cedarum ( Pythium cedri The LAMP method of ) is characterized by, Includes the following steps: DNA was extracted from the microorganism to be tested. The DNA solution was used as a reaction template, and a LAMP reaction was performed using the primer composition described in claim 1. The color change of the amplification product was then observed. If the amplification product was sky blue, the test result was positive, indicating that *Pythium cedarense* was present in the microorganism to be tested. Pythium cedri If the amplification product is purple, the test result is negative, indicating that Pythium cedarum is not present in the tested microorganism. Pythium cedri ); The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L -1 MgSO4, 1.2 mmol·L - 1 dNTPs, 1.6 μmol·L each of inner primers FIP and BIP -1 , 0.4 μmol·L each of outer primers F3 and B3 -1 , 0.8 μmol·L of loop primer LB -1 , 0.8 μmol·L -1 Betaine, 8 U·μL -1 Bst DNA polymerase, 180 mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterilized water to 26 μL.

7. The *Pythium cedarense* according to claim 6 (Pythium cedri) The LAMP method of ) is characterized by, The LAMP reaction procedure is as follows: reaction amplification at 63℃ for 63~70 min.

Citation Information

Patent Citations

  • Cedar mildew rot fungus CRN effect protein and application thereof

    CN118388611A

  • Application of Ypt1 gene as specific target in detection of pythium variabilis

    CN118910310A