Fungus strain for promoting seed germination of old crow petal and application thereof

By using Aspergillus niger strain AN01 in combination with seed germination substrate, the problem of low seed germination rate of *Cinnamomum camphora* was solved, achieving improved seed germination rate and shortened germination time, providing technical support for large-scale planting.

CN120665722BActive Publication Date: 2026-06-23WEST ANHUI UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
WEST ANHUI UNIV
Filing Date
2025-05-29
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

The natural germination rate of *Cinnamomum camphora* seeds is extremely low and the growth cycle is long. Existing artificial cultivation mainly relies on asexual reproduction of bulbs, which has a low reproduction coefficient and is difficult to meet market demand, thus limiting its large-scale planting and medicinal supply.

Method used

The Aspergillus niger strain AN01 and its metabolites were combined with the seed germination substrate to form a bacterial substrate. The substrate was kept moist to promote the germination of *Cinnamomum camphora* seeds.

Benefits of technology

It significantly improved the germination rate and shortened the germination time of *Cinnamomum camphora* seeds, laying the foundation for large-scale cultivation of *Cinnamomum camphora*.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665722B_ABST
    Figure CN120665722B_ABST
Patent Text Reader

Abstract

The present application relates to the field of biotechnology, and provides a strain capable of accelerating and promoting seed germination of old crow petal and application thereof, the strain is isolated from soil of old crow petal seedling, and is identified as Aspergillus niger through ITS sequence sequencing after purification, and the taxonomic name is Aspergillus niger, and the preservation number is CCTCC NO: M 2025709. Through the concomitant germination test of the strain and old crow petal plant seeds, the results show that the strain can obviously accelerate the seed germination of old crow petal, and improve the seed germination rate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a strain that promotes the germination of *Cinnamomum camphora* seeds and its application. Background Technology

[0002] *Tulipa edulis* (Miq.) Baker, a plant belonging to the genus *Tulipa* in the family Liliaceae, is a traditional Chinese medicine. Its dried bulb, after the outer skin is removed, is known as "Guang Ci Gu". It has specific growing requirements, typically found in sunny, well-drained locations such as grassy slopes, roadsides, and forest edges. *Tulipa edulis* possesses significant medicinal value, with its bulb being the primary medicinal part. Modern medical research indicates that it exhibits anti-tumor and antibacterial activities, demonstrating great potential in the pharmaceutical field and thus attracting considerable attention, possessing significant scientific and economic value.

[0003] Due to the unique structure of *Cinnamomum camphora* seeds, germination under natural conditions requires specific environmental conditions and biological factors, resulting in an extremely low germination rate and a slow, long growth cycle. Currently, artificial cultivation of *Cinnamomum camphora* primarily relies on asexual reproduction of bulbs. However, this method has a low propagation coefficient, limiting the scale of cultivation and making it difficult to meet the growing market demand, thus contributing to persistently high prices for this medicinal material. Therefore, sexual reproduction is a potentially feasible method for expanding production.

[0004] In conclusion, identifying key factors that can effectively promote the germination of *Cinnamomum camphora* seeds or developing applicable technologies is of great significance for significantly improving its seed germination rate. This will lay a solid foundation for the rational protection of *Cinnamomum camphora* resources and subsequent large-scale artificial cultivation. Summary of the Invention

[0005] This invention addresses the aforementioned technical problems by providing a strain that promotes the germination of *Cinnamomum camphora* seeds, and provides a specific method for applying this strain in promoting the germination of *Cinnamomum camphora* seeds.

[0006] Specifically, the present invention provides the following technical solution:

[0007] In a first aspect, the present invention provides a concomitant strain that promotes the germination of seeds of plants in the Liliaceae family, characterized in that the ITS sequence of the strain contains a sequence that has more than 99% identity with the sequence shown in SEQ ID NO.1.

[0008] In a preferred embodiment, the ITS sequence of the strain comprises the sequence shown in SEQ ID NO.1.

[0009] In a preferred embodiment, the accompanying strain promoting the germination of Liliaceae seeds is Aspergillus niger AN01, which was deposited on April 7, 2025, at the China Center for Type Culture Collection, Wuhan University, Wuhan City, Hubei Province, China. The deposit address is Bayi Road, Wuchang District, Wuhan City, Hubei Province, China, and the strain accession number is CCTCC NO: M 2025709.

[0010] On the other hand, the present invention provides a seed soaking solution, seed soaking powder, or microbial agent containing the aforementioned strain. The seed soaking solution, seed soaking powder, or microbial agent can promote the germination of seeds of Liliaceae plants.

[0011] Furthermore, the plant in question belongs to the genus *Corydalis*.

[0012] On the other hand, the present invention provides the application of any of the aforementioned strains in promoting plant seed germination.

[0013] Furthermore, the plant in question is a member of the lily family.

[0014] Furthermore, the plant in question belongs to the genus *Corydalis*.

[0015] Furthermore, the strain is used to shorten the germination time of plant seeds and / or increase the germination rate of plant seeds.

[0016] On the other hand, the present invention provides the application of any of the aforementioned strains in promoting the formation of protocorms from plant seeds.

[0017] Furthermore, the plant in question is a member of the lily family.

[0018] Furthermore, the plant in question belongs to the genus *Corydalis*.

[0019] On the other hand, the present invention provides a method for promoting plant seed germination, characterized by comprising the following steps:

[0020] 1) Use a substrate containing any of the aforementioned strains and / or their metabolites to combine with a seed germination substrate to form a microbial substrate;

[0021] 2) Contact the seeds with the bacterial substrate;

[0022] 3) Keep the substrate moist.

[0023] In a preferred embodiment, the substrate contains only bacterial strains.

[0024] Furthermore, the combination of the fungal substrate and the seed germination substrate involves mixing the fungal substrate into the substrate or placing the fungal substrate on the surface of the substrate to form a fungal-containing substrate.

[0025] Furthermore, the contact between the seeds and the bacterial substrate is described as scattering the seeds into the substrate.

[0026] Furthermore, maintaining the substrate in a moist state involves spraying water to keep the substrate moist.

[0027] Furthermore, the plant in question is a member of the lily family.

[0028] Furthermore, the plant in question belongs to the genus *Corydalis*.

[0029] On the other hand, the present invention provides a method for promoting the formation of protocorms from plant seeds, characterized by comprising the following steps:

[0030] 1) Use a substrate containing any of the aforementioned strains and / or their metabolites to combine with a seed germination substrate to form a microbial substrate;

[0031] 2) Contact the seeds with the bacterial substrate;

[0032] 3) Keep the substrate moist.

[0033] In a preferred embodiment, the substrate contains only bacterial strains.

[0034] Furthermore, the combination of the fungal substrate and the seed germination substrate involves mixing the fungal substrate into the substrate to form a fungal-containing substrate.

[0035] Furthermore, the contact between the seeds and the bacterial substrate is described as scattering the seeds into the substrate.

[0036] Furthermore, maintaining the substrate in a moist state involves spraying water to keep the substrate moist.

[0037] Furthermore, the plant in question is a member of the lily family.

[0038] Furthermore, the plant in question belongs to the genus *Corydalis*.

[0039] On the other hand, the present invention provides a DNA barcode for identifying Aspergillus niger, wherein the DNA barcode comprises a sequence as described in SEQ ID NO.1, or a sequence that is inversely complementary to a sequence as described in SEQ ID NO.1.

[0040] Furthermore, the *Aspergillus niger* is a fungus that was deposited on April 7, 2025, at the China Center for Type Culture Collection, Wuhan University, Wuhan City, Hubei Province, with the accession number CCTCC NO: M 2025709.

[0041] On the other hand, the present invention provides an application of the aforementioned DNA barcode in the identification of Aspergillus niger.

[0042] On the other hand, the present invention provides a method for identifying Aspergillus niger, the method comprising,

[0043] (1) Extract DNA from the genome of the fungus to be tested.

[0044] (2) PCR was performed using primers, namely ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' and ITS4: 5'-TCCTCCGCTTATTGATATGC-3'.

[0045] (3) Sequencing of the PCR products.

[0046] (4) Determine the specific species of fungus based on the sequencing results. When the sequencing results are consistent with the aforementioned DNA barcode sequence, the fungus to be tested is determined to be the same fungus as the strain deposited on April 7, 2025 at the China Center for Type Culture Collection, Wuhan University, Wuhan City, Hubei Province, with the accession number CCTCC NO: M 2025709.

[0047] Compared with the prior art, the present invention has the following advantages:

[0048] 1) This invention provides a novel strain that can significantly promote the germination of seeds of the genus *Corydalis*.

[0049] 2) The method of the present invention can promote the germination of seeds of the genus *Coprinus*, increase the germination rate of *Coprinus* seeds and shorten the germination time of *Coprinus* seeds, thus laying the foundation for the rational protection of its resources and large-scale planting. Attached Figure Description

[0050] The beneficial effects of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0051] Figure 1 The colonies formed by the strain isolated in this invention (preservation number CCTCC NO: M 2025709) on PDA plates show the characteristic colony morphology. Figure 1 A is a frontal photograph of the plate bacteria. Figure 1 B is a reverse photo of the plate bacteria.

[0052] Figure 2 It utilizes the strain of this invention to co-expose seeds of *Cinnamomum camphora* ( Figure 2 A) Germination photos at 95 days and strain-free co-existing *Laoya chinensis* seeds ( Figure 2 B) Germination photos at 120 days. Detailed Implementation

[0053] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0054] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0055] Example

[0056] Example 1: Isolation, purification, and identification of bacterial strains

[0057] Isolation and purification of the strain: Humus soil from under the tubers of wild *Lactuca indica* was collected from the Medicinal Botanical Garden of Wanxi University, Yu'an District, Lu'an City, Anhui Province. Most impurities in the soil were removed by selection. The soil was inoculated into prepared potato dextrose agar (PDA) medium in a clean bench, with three plates inoculated simultaneously as the primary culture medium. The inoculated plates were placed in a 28°C incubator for dark incubation. Every three days, based on the different morphologies and sizes of the newly formed colonies, colonies (including the corresponding solid culture medium area) were cut off using different sterile scalpels and placed into new culture media. This process was repeated until pure cultured colonies were obtained. The isolated strain was named AN01. The isolation medium was PDA medium, purchased from Guangdong Huankai Microbial Technology Co., Ltd., prepared according to their instructions by adding 1 L of deionized water per 40.1 g.

[0058] Identification of strains:

[0059] 1. Morphological observation (see Figure 1 On potato dextrose agar (PDA) medium, *Aspergillus niger* colonies are initially white, gradually turning black or dark brown as they grow. The colony texture is generally fluffy or fibrous, with a radially wrinkled surface and regular or irregular edges. Colonies grow rapidly, covering a large area in a short time. The mycelium of *Aspergillus niger* consists of many branched hyphae, which are colorless or pale, septate, and multicellular. There are two types of hyphae: vegetative hyphae, which creep along the surface of the culture medium and are responsible for absorbing nutrients; and aerial hyphae, which grow vertically from the vegetative hyphae into the air and can further differentiate to produce structures such as conidiophores.

[0060] 2. Molecular identification:

[0061] (1) Extraction of fungal genome DNA: DNA of the strain was extracted using the SoLarbio fungal genome DNA extraction kit, and the concentration and purity of the DNA were detected by a multi-functional microplate reader.

[0062] (2) Primer design: The ITS sequence of ribosomal DNA was designed and synthesized by General Biotechnology (Anhui) Co., Ltd., and the primer sequence was ITS1 5. , -TCCGTAGGTGAACCTGCGG-3 , ,ITS4 5'-TCCTCCGCTTATTGATATGC-3'.

[0063] (3) PCR amplification system:

[0064]

[0065] (4) PCR cycling conditions:

[0066]

[0067] (5) Sequencing results: Molecular sequencing and bacterial species identification were performed by General Biotechnology (Anhui) Co., Ltd. The ITS sequences of the sequencing results were compared for homology using BLAST in NCBI. The comparison results were based on a similarity of 99% or higher for molecular identification of the bacterial species, and the identification result was Aspergillus niger.

[0068] The strain isolated in this embodiment was deposited on April 7, 2025, at the China Center for Type Culture Collection, Wuhan University, Wuhan City, Hubei Province. The deposit address is Bayi Road, Wuchang District, Wuhan City, Hubei Province. The strain accession number is CCTCC NO: M 2025709.

[0069] 5'-GGCTCGAGTGCGGGTCTTTGGGCCCACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCG

[0070] GCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGT

[0071] CTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAA

[0072] TGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGG

[0073] GGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGG

[0074] GCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCG

[0075] CCTGCCGACGTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAA

[0076] AGTCCCGGAGGAACG-3' (SEQ ID NO.1)

[0077] Example 2: Aspergillus niger AN01 strain promotes the germination of *Cinnamomum camphora* seeds.

[0078] To verify that the Aspergillus niger strain isolated in this invention promotes the germination of *Cinnamomum camphora* seeds, a comparative experiment was conducted on the promotion of seed germination between uninoculated and inoculated strains (AN01 obtained in this invention). The strain was AN01 (obtained in this invention).

[0079] 2.1 Materials

[0080] Potato glucose agar (PDA) medium, *Cinnamomum camphora* seeds, and *Aspergillus niger* strain AN01.

[0081] 2.2 Methods

[0082] 2.2.1 Preparation of slant culture medium for AN01 strain: The culture medium used was potato dextrose agar (PDA, 5 g / L potato extract, 15 g / L agar, 20 g / L glucose, 0.1 g / L chloramphenicol, pH 5.8-6.2). The prepared culture medium was sterilized at 121℃ for 20 min before use.

[0083] 2.2.2 Soaking of *Aspergillus niger* seeds and preparation of mycelial suspension by *Aspergillus niger*: Soak *Aspergillus niger* seeds in a 0.3% KMnO4 solution for 5 minutes as a disinfectant. After soaking, rinse thoroughly and then soak in water for 12-36 hours. After soaking, remove and set aside. Inoculate the mycelium onto a slant culture medium to form spores. Under aseptic conditions, inject 3-5 ml of sterile water and gently scrape off the mycelial growth with an inoculation loop or spatula to prepare a mycelial suspension.

[0084] 2.2.3 Grouping: Prepare two groups of sterilized fine river sand, one as the control group and the other as the experimental group. Aspergillus niger was inoculated into the fine river sand in the experimental group, while no inoculation was performed on the fine river sand in the control group (the bacterial solution was dripped into the sand using a sterile pipette until it saturated the sand).

[0085] 2.2.4 Sowing and Cultivation: The soaked seeds were mixed evenly with fine river sand. Each group was replicated in 3 replicates, with each replicate containing 30 mature seeds and an equal amount of river sand. The mixture was placed in the dark at 20°C for 50 days, then in the dark at 4°C for 30 days, and then cultivated in the dark at 15°C.

[0086] 2.2.5 Cultivation and Observation: Two groups of seed-bearing cultivation devices were placed under identical and suitable environmental conditions for cultivation and observation. After dark cultivation at 15℃, seed germination was observed every three days, and the number of days required for germination (counted as the first seedling breaking through the seed coat and sand) and the number of germinating seeds were recorded and statistically analyzed (the breaking of the seed coat and sand was used as the marker of seed germination; observation continued until no new seeds germinated for 10 consecutive days). Observations showed that after dark cultivation at 15℃, infected seeds germinated in 9-16 days, while sterile seeds germinated in 36-40 days. The statistical results of three replicates in each treatment and control group are shown in Tables 1 and 2.

[0087] Table 1. Statistics on seed germination days

[0088]

[0089] Table 2 Seed germination rate statistics

[0090]

[0091] As can be seen from the above, the seed germination rate in moist sand containing the *Aspergillus niger* fungus of the present invention is significantly higher than that in moist sand without the fungus, and the number of days required for seed germination in moist sand containing the *Aspergillus niger* fungus of the present invention is significantly shorter than that in moist sand without the fungus. Therefore, the *Aspergillus niger* fungus isolated by the present invention can promote earlier germination and increase the germination rate of *Cinnamomum camphora* seeds.

[0092] Based on the disclosure and teachings of the foregoing specification, those skilled in the art can make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the protection scope of the claims of the present invention. Furthermore, although some specific terms are used in this specification, these terms are only for convenience of explanation and do not constitute any limitation on the present invention.

Claims

1. A bacterial strain that promotes seed germination in plants of the genus *Corydalis*, characterized in that, The strain is Aspergillus niger ( Aspergillus niger AN01 was deposited on April 7, 2025, at the China Center for Type Culture Collection, Wuhan University, Wuhan, Hubei Province, China. The deposit address is CCTCC NO: M 2025709.

2. A seed soaking solution, seed soaking powder, or microbial agent comprising the strain described in claim 1.

3. The application of the strain described in claim 1 in promoting seed germination of plants in the genus *Corydalis*.

4. The application as described in claim 3, characterized in that, The strain is used to shorten the germination time of seeds of the genus *Corydalis* and / or increase the germination rate of seeds of the genus *Corydalis*.

5. A method for promoting seed germination of plants in the genus *Corydalis*, characterized in that, Includes the following steps: 1) A bacterial substrate is formed by combining the strain described in claim 1 with a seed germination substrate; 2) Contact the seeds with the bacterial substrate; 3) Keep the substrate moist.

Citation Information

Patent Citations

  • Method for breaking hard seed dormancy in astragalus seeds

    CN102870524A

  • Phosphorus-dissolving fungi and method for preparing biological phosphate fertilizer through fermenting edible fungi residues by phosphorus-dissolving fungi

    CN103695318A

  • Method for improving seedling cultivating quality

    CN106105488A

  • Kiwi berry seed initiator, and initiation method

    CN108738484A

  • Aspergillus niger capable of rapidly and simultaneously degrading three mycotoxins and application thereof

    CN113373060A