Corn kernel size and kernel weight related protein, encoding gene and application thereof

Abstract

This invention discloses proteins and related biological materials, as well as the application of these proteins, or substances regulating the expression of the protein-coding gene, or substances regulating the activity or content of the protein, in regulating plant seed size and / or seed weight; the protein is a protein with the amino acid sequence SEQ ID No. 1. Knockout experiments based on the CRISPR-Cas9 system successfully obtained knockout transgenic lines of this protein-coding gene. Phenotypic identification and comparison of seeds obtained from self-pollination of transgenic positive plants with wild-type results showed that knocking out the target gene increased the seed size and / or seed weight of maize inbred lines; while overexpression of the protein-coding gene in Arabidopsis resulted in smaller and lighter seeds, thus demonstrating that gene Zm00001d025992 has an important biological function in seed size and seed weight phenotypes.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a protein related to corn kernel size and weight, its encoding gene, and its applications. Background Technology

[0002] Maize (Zea mays L.) is one of the most important food, feed, and energy crops, and its production security plays a crucial role in national food security. With the continuous increase in the world's population, human demand for food will continue to rise. However, given the current situation of continuously decreasing arable land, increasing yield per unit area has become the fundamental way to solve the supply and demand contradiction of maize. Grain is the main harvest target in the maize production process, and continuously increasing grain yield is the ultimate goal of high-yield maize breeding. Grain weight is one of the three basic factors of maize yield (grain weight, number of grains per ear, and number of ears per acre). Therefore, finding proteins and their encoding genes related to maize grain weight and size for research on the genetic basis of grain formation or molecular design for germplasm improvement is of great significance for breeding new maize varieties. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to increase plant yield, such as how to increase corn yield.

[0004] To solve the above-mentioned technical problems, the present invention provides the application of a protein or a substance that regulates the expression of the protein-coding gene or a substance that regulates the activity or content of the protein, wherein the application may be any one of the following D1)-D4):

[0005] D1) The use of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in regulating plant seed size and / or seed weight.

[0006] D2) The use of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in the preparation of products that regulate plant seed size and / or seed weight.

[0007] D3) The application of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in the preparation of products for cultivating high-yield plants;

[0008] D4) Application of proteins or substances that regulate the expression of the protein-encoding genes or substances that regulate the activity or content of the proteins in plant breeding.

[0009] The protein may be A1), A2), or A3):

[0010] A1) The amino acid sequence of this protein is that of SEQ ID No. 1;

[0011] A2) A protein that has more than 80% identity with and has the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 1.

[0012] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0013] The above-mentioned proteins can be obtained from corn.

[0014] SEQ ID No.1 consists of 469 amino acid residues.

[0015] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0016] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0017] Furthermore, in the aforementioned applications, the substance regulating the expression of the protein-coding gene or the substance regulating the activity or content of the protein can be a biological material, which can be any one of B1) to B9) below:

[0018] B1) Nucleic acid molecules that encode the above proteins;

[0019] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0020] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0021] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0022] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0023] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0024] B7) A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3);

[0025] B8) Nucleic acid molecules that inhibit or reduce the expression of the genes encoding the above proteins or nucleic acid molecules that inhibit or reduce the activity of the above proteins;

[0026] B9) Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cell lines containing the nucleic acid molecules described in B8).

[0027] When the substance regulating the expression of the protein-coding gene or the substance regulating the activity or content of the protein is a biological material of type B1) to B7), the regulation of plant seed size and / or seed weight may be to reduce the seed size and / or seed weight of the plant, such as reducing the seed size and / or seed weight of Arabidopsis thaliana. When the substance regulating the expression of the protein-coding gene or the substance regulating the activity or content of the protein is a biological material of type B8) or B9), the regulation of plant seed size and / or seed weight may be to increase the seed size and / or seed weight of the plant, such as increasing the seed size and / or seed weight of maize.

[0028] Furthermore, in the above application, the nucleic acid molecule described in B1) can be any of the following DNA molecules shown in b1) to b3):

[0029] b1) The coding sequence of the coding strand is the DNA molecule shown in SEQ ID No. 2;

[0030] b2) The nucleotide sequence of the coding strand is the DNA molecule shown in SEQ ID No. 2;

[0031] b3) has more than 80% identity with the nucleotide sequence defined by b1) or b2) and is a DNA molecule encoding the above-mentioned protein;

[0032] The nucleic acid molecule described in application B8) above is a DNA molecule expressing a gRNA that targets the protein-coding gene or is a gRNA that targets the protein-coding gene.

[0033] In the above applications, identity refers to the similarity between amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0034] In the above applications, the 80% or more of identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0035] In the above applications, the DNA molecule expressing the gRNA targeting the protein-coding gene can be any of the following:

[0036] g1) A DNA molecule whose coding sequence is as shown in positions 437-542 of SEQ ID No. 4; and / or,

[0037] g2) A DNA molecule whose coding sequence is as shown in positions 437-542 of SEQ ID No. 5; and / or,

[0038] g3) A DNA molecule whose coding sequence is as shown in positions 437-542 of SEQ ID No. 6; and / or,

[0039] The gRNA targeting the above-mentioned protein-coding genes can be the RNA molecules encoded by g1), g2) or g3) mentioned above.

[0040] Furthermore, the target sequence of the above gRNA may be: the nucleotide shown at positions 82-101 of SEQ ID No. 3 (i.e., 5'-GAGCATGCAACCGTCGTGCC-3'), and / or the nucleotide shown at positions 179-198 of SEQ ID No. 3 (i.e., 5'-CATAGGGCTTCCGCCTCGTG-3'), and / or the nucleotide shown at positions 259-278 of SEQ ID No. 3 (i.e., 5'-TAACGACCGTGCCGCCAAGG-3').

[0041] Furthermore, in the aforementioned applications, the substance that regulates the expression of the protein-coding gene or the substance that regulates the activity or content of the protein may be the biological material described in B8) or B9), and the regulation of plant seed size and / or seed weight may be to increase the seed size and / or seed weight of the plant.

[0042] Furthermore, the plant mentioned in the above applications can be any one of the following P1)-P5):

[0043] P1) Monocotyledons;

[0044] P2) Plants of the order Poales;

[0045] P3) Gramineae plants;

[0046] P4) Plants of the genus *Zea*;

[0047] P5) Corn.

[0048] Furthermore, in the above applications, the substance that regulates the expression of the protein-coding gene or the substance that regulates the activity or content of the protein can be any one of the biological materials from B1) to B7), and the regulation of plant seed size and / or seed weight can be to reduce the seed size and / or seed weight of the plant.

[0049] Furthermore, in the above applications, the plant can be any one of the following (E1)-E5):

[0050] E1) Dicotyledons;

[0051] E2) Plants of the order Papaverales;

[0052] E3) Cruciferous plants;

[0053] E4) Plants of the genus *Mucor*

[0054] E5) Arabidopsis thaliana.

[0055] In the above applications, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the gene transcription level; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of gene translation; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0056] In the above applications, the regulation of gene expression can be achieved by inhibiting or reducing gene expression, which can be achieved by gene knockout or gene silencing.

[0057] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0058] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0059] In the above applications, the substance regulating gene expression can be a reagent that inhibits or reduces the expression of the gene. The reagent that inhibits or reduces the expression of the gene can be a gene knockout reagent, such as a reagent that knocks out the gene through homologous recombination or a reagent that knocks out the gene through CRISPR-Cas9. The reagent that inhibits or reduces the expression of the gene can contain a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0060] The present invention also provides a method for increasing corn kernel size and / or kernel weight, the method comprising increasing corn kernel size and / or kernel weight by knocking out the gene encoding the protein described above in corn.

[0061] In the above method, the corn may include a maize inbred line.

[0062] In the above method, the knockout can be performed using a CRISPR / Cas9 system.

[0063] The CRISPR / Cas9 system may include a vector expressing sgRNA that targets the coding gene of the protein described above.

[0064] Furthermore, in the method, knocking out the gene encoding the aforementioned protein in maize can be achieved by performing at least one of the following mutations (F1) or F2) on the DNA molecule in maize whose coding sequence is shown in SEQ ID No. 2:

[0065] F1) The DNA molecule in maize with the coding sequence shown in SEQ ID No. 2 was mutated to the gene Zm00001d025992 / +1bp,-94bp, and the coding sequence of the coding strand of the Zm00001d025992 / +1bp,-94bp gene is shown in SEQ ID No. 8.

[0066] F2) The DNA molecule in maize with the coding sequence shown in SEQ ID No. 2 is mutated to the gene Zm00001d025992 / +1bp,-93bp, and the coding sequence of the coding strand of the Zm00001d025992 / +1bp,-93bp gene is shown in SEQ ID No. 9.

[0067] The present invention also provides the application of the above method in the creation of maize mutant plants and / or maize breeding.

[0068] Knockout experiments using the CRISPR-Cas9 system successfully obtained transgenic plants with the above-mentioned protein-coding genes knocked out. Phenotypic identification and comparison of the grains obtained from self-pollination of transgenic positive plants with wild-type plants showed that knocking out the Zm00001d025992 gene could increase the grain size and / or grain weight of maize inbred lines. In contrast, overexpression of the Zm00001d025992 gene in Arabidopsis resulted in smaller and lighter grains in transgenic positive Arabidopsis compared to wild-type plants, thus demonstrating that the Zm00001d025992 gene has an important biological function in grain size and grain weight phenotypes.

[0069] Compared with the prior art, the present invention has the following advantages:

[0070] (1) After knocking out the gene encoding the Zm00001d025992 protein of the present invention, the size and weight of corn kernels increased significantly.

[0071] (2) Based on CRISPR-Cas9 technology, this invention provides a new target gene, and there is no technical guidance for knocking out the corresponding gene in the prior art.

[0072] (3) This invention provides a more precise, efficient, time-saving, labor-saving, safe, and exogenous DNA-free technical method for creating maize mutant plants and / or maize breeding. It enables precise improvement of grain size and grain weight traits, promotes the commercialization of maize breeding, overcomes the shortcomings of traditional breeding, shortens the breeding cycle, and does not affect other traits. Attached Figure Description

[0073] Figure 1These are the co-located loci of HKW, HKV, and KL on chromosome 10. HKW represents the 100-kernel weight (HKW), the average of three random samples of 100 kernels from each plot after threshing, in grams. HKV represents the 100-kernel volume (HKV), the volume of three random samples of 100 kernels from each plot after threshing, in centimeters. 3 10KL represents 10-kernel length, which is the average of 10 kernels randomly sampled from 3 separate samples after threshing the ears of grain in each plot, and is expressed in cm.

[0074] Figure 2 Figure a shows the phenotypes of extreme materials for grain weight and grain size, and the relative expression levels of the Zm00001d025992 gene. Figure a contains phenotypic data for 100-kernel weight and 100-kernel volume of extreme materials for grain weight and grain size. HKW represents 100-kernel weight (HKW), the average of 100 kernels randomly sampled from three plots after threshing, in g. HKV represents 100-kernel volume (HKV), the volume of 100 kernels randomly sampled from three plots after threshing, in cm³. 3 Figure b shows the relative expression levels of the Zm00001d025992 gene in the extreme materials at 6 days (6d), 12 days (12d), and 18 days (18d) after maize kernel pollination. The results show that the 100-kernel weight and 100-kernel volume data in the extreme small-kernel material are significantly lower than those in the extreme large-kernel material, but the relative expression level of the Zm00001d025992 gene in the extreme small-kernel material is significantly higher than that in the extreme large-kernel material.

[0075] Figure 3 This study investigated the relative expression level of the gene Zm00001d025992 in the transformed Arabidopsis thaliana line and its seed phenotype. Figure a shows the relative expression level of the Zm00001d025992 gene; Figure b shows a comparison of the seed appearance of wild-type and transformed Arabidopsis thaliana lines; Figure c shows the seed phenotype data analysis of wild-type and transformed Arabidopsis thaliana lines. In the figures, seed length represents the average seed length from three random samples collected from each plot (in mm); seed width represents the average seed width from three random samples collected from each plot (in mm); and thousand-seed weight represents the average weight of 1000 seeds from three random samples collected from each plot (in mg). The results showed that the relative expression level of the Zm00001d025992 gene in the transformed Arabidopsis thaliana line was significantly higher than that in the wild type. The seeds of the transformed Arabidopsis thaliana line were smaller than those of the wild type, and the seed length, width, and thousand-seed weight of the transformed line were significantly lower than those of the wild type.

[0076] Figure 4 The kernel phenotype of the Zm00001d025992 gene knockout line is shown in Figure a. Figure a compares the 10-kernel length between the knockout line and the wild-type line. Figure b compares the 10-kernel width between the knockout line and the wild-type line. Figure c shows the data analysis of the 10-kernel length, 10-kernel width, and 100-kernel weight of the knockout line and the wild-type line. The 10-kernel length (10-kernel length) is the average of 10 kernels from 3 random samples taken from each ear after threshing, in cm. The 10-kernel width (10-kernel width) is the average of 10 kernels from 3 random samples taken from each ear after threshing, in cm. The 100-kernel weight (100-kernel weight) is... kernel weight (HKW) was the average of 100 kernels randomly sampled three times after threshing each ear of each plot, in g. The results showed that the kernel length and 100-kernel weight of the Zm00001d025992 gene knockout line were significantly higher than those of the wild type, while the kernel width was not significantly different from that of the wild type.

[0077] Figure 5 A schematic diagram of the construction of the recombinant vector PCAMBIA3301-Zm00001d025992 and a vector map of the recombinant vector.

[0078] Figure 6 This diagram illustrates the construction of the recombinant vector CPB-sgRNA and shows the vector map of the recombinant vector.

[0079] Figure 7 The mutant strain genotype obtained in Example 4; wherein, Figure 7 In the image, 'a' represents the agarose gel electrophoresis pattern of the genomic DNA of the mutant strain. Figure 7 In the text, b represents the mutant genotype of the mutant strain. Detailed Implementation

[0080] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0081] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0082] Maize inbred line B104 was derived from the US National Plant Germplasm System ( https: / / npgsweb.ars-grin.gov / gringlobal / search ).

[0083] The maize inbred line B73 was derived from the National Germplasm Resource Bank.

[0084] Arabidopsis Col-0, Columbia ecotype Arabidopsis, is a product of the Arabidopsis Biological Resource Center. For details, please visit http: / / abrc.osu.edu / .

[0085] The vector pCAMBIA3301 was purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd., catalog number ZK868.

[0086] The CPB vector was provided by Professor Xie Chuanxiao's research group at the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and is disclosed in the literature "Zhao, Y., Zhang, C., Liu, W. et al. An alternative strategy for targeted gene replacement inplants using a dual-sgRNA / Cas9 design. Sci Rep 6, 23890 (2016)." The public can obtain the above-mentioned biological material from the applicant. The obtained biological material is only used for repeating the experiments of this invention and cannot be used for other purposes.

[0087] The pLB vector was purchased from Tiangen Biotech (Beijing) Co., Ltd., catalog number VT205.

[0088] Fast-T1 Escherichia coli competent cells were purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number C505-03.

[0089] EHA105 Agrobacterium competent cells were purchased from Beijing Bomed Gene Technology Co., Ltd., catalog number BC303.

[0090] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0091] Example 1: Identification of the Target Gene

[0092] 1.1 Determination of ear height and flowering time traits and genome-wide association analysis

[0093] 1604 maize inbred lines were planted in the field using a completely randomized block design with two replicates. Each material was planted in a single row, 3 meters long and 0.6 meters wide, with 13 maize plants per row. All were open-pollinated, and 5 plants were harvested from each plot for the investigation of kernel-related traits, primarily kernel length, kernel width, and 100-kernel weight. Ten kernels were consecutively selected from the middle of each ear, and the 10-kernel length (10-KL) and 10-kernel width (10-KW) were measured in cm. The 100-kernel weight (HKW) was the average of three randomized samples of 100 kernels from each ear after threshing, measured in g. The 100-kernel volume (HKV) was the volume of three randomized samples of 100 kernels from each ear after threshing, measured in cm³. 3 .

[0094] Based on resequencing, 18,169,560 high-quality SNPs covering the entire genome were obtained. Genome-wide association analysis was performed on HKW, HKV, and KL using the EMMAX software package, with a threshold of P < 1.0 × 10⁻⁶. 6 .

[0095] 1.2 Identification of Zm00001d025992, a gene related to maize kernel size and weight.

[0096] Genome-wide association analysis revealed significant association signals on chromosome 10 for three traits: weight per 100 grains, volume per 100 grains, and grain length. Figure 1 Further analysis of the associated signals revealed that the significantly associated SNP site was located within the Zm00001d025992 gene. Zm00001d025992 encodes a protein with an unknown function. In this study, 20 extreme grain samples (10 with large grains and high grain weight, and 10 with small grains and low grain weight) were selected from 1604 samples for qRT-PCR. Significant differences in the expression levels of Zm00001d029992 were found between the two groups at three post-pollination times: 6 days (6d), 12 days (12d), and 18 days (18d). Figure 2 . Figure 2 The results showed that the expression level of the Zm00001d025992 gene in small-grained maize was significantly higher than that in large-grained maize. Therefore, Zm00001d025992 was considered a candidate gene for regulating maize kernel size and weight, and functional verification of the gene was carried out based on this.

[0097] The genomic sequence of the Zm00001d025992 gene is a DNA molecule as shown in SEQ ID No. 3, its coding sequence is a DNA molecule as shown in SEQ ID No. 2, and its encoded amino acid sequence is a protein as shown in SEQ ID No. 1. The encoded protein is named Zm00001d025992 protein or protein Zm00001d025992.

[0098] Example 2: Amplification and recovery sequencing of the Zm00001d025992 genome and its coding genes.

[0099] 2.1 Obtaining the full-length genome and cDNA of candidate genes

[0100] 2.1.1 Preparation of plant materials required for amplifying candidate genes

[0101] Select plump maize inbred line B73 seeds and plant them in flowerpots filled with nutrient soil, with 3 seedlings per pot. Place them in a light incubator (28℃, light). When the seedlings reach the six-leaf-one-heart stage, collect leaves. Use some leaves to extract genomic DNA, and use the other part of the leaves to extract RNA, which is then stored at -80℃.

[0102] 2.1.2 Extraction of genomic DNA from maize materials

[0103] 1) Quickly place the leaves into a sterilized mortar and grind them thoroughly with liquid nitrogen, adding liquid nitrogen continuously during the process. After grinding, add the liquid nitrogen to a 2.0ml centrifuge tube, filling the tube to 1 / 3 full.

[0104] 2) Preheat the pre-prepared CTAB extraction solution in a 65°C water bath. Then add 800 μl of preheated CTAB buffer to the centrifuge tube from the previous step and shake vigorously to mix thoroughly.

[0105] 3) Place the mixed extract in a 65℃ constant temperature water bath for 30 minutes, shaking it every 10 minutes to ensure a full reaction.

[0106] 4) Take out the centrifuge tube that has undergone sufficient reaction, add an equal volume of chloroform / isoamyl alcohol (volume ratio 24:1), mix slowly for 15 min, and let stand for 10 min.

[0107] 5) Place the centrifuge tubes into the centrifuge and centrifuge at 12,000 rpm for 20 minutes.

[0108] 6) Carefully aspirate the supernatant into another clean 2.0 ml centrifuge tube, add an equal volume of pre-cooled (-20℃) isopropanol, gently mix, and place the centrifuge tube in a -20℃ freezer for 30 minutes until a large amount of white precipitate forms.

[0109] 7) Use a sterilized pipette tip to remove the white precipitate and place it in another clean centrifuge tube. Add 500 μL of 75% ethanol and rinse 2-3 times.

[0110] 8) Centrifuge, discard 75% ethanol, remove excess ethanol with a pipette tip, and dry at room temperature. Dissolve the DNA in 1×TE.

[0111] 9) Add RNase for purification (final concentration 10ug / ul), and incubate at 37℃ for 1 hour.

[0112] 10) Add an equal volume of phenol / chloroform / isoamyl alcohol (volume ratio 25:24:1) for extraction once, centrifuge at high speed (12000 rpm) for 10 min, carefully aspirate the supernatant, and then extract once more with an equal volume of chloroform / isoamyl alcohol (volume ratio 24:1), centrifuge at high speed (12000 rpm) for 10 min.

[0113] 12) Precipitate the DNA with pre-cooled anhydrous ethanol and centrifuge (12000 rpm) for 10 min.

[0114] 13) Discard the ethanol, let it dry completely to avoid inhibiting the downstream PCR reaction, add an appropriate amount of TE to dissolve, and store in a -20℃ refrigerator for later use.

[0115] 2.1.3 Extraction and purification of total RNA from maize materials

[0116] Total RNA was extracted from plants using the Gene-better Polysaccharide-Polyphenol Plant Total RNA Extraction Kit (with gDNA filter). The specific procedure is as follows (all experimental instruments used below were sterilized at high temperature to remove RNase):

[0117] 1) Pour liquid nitrogen into an RNase-free mortar that has been treated at 180℃, then take out the frozen leaves from the -76℃ ultra-low temperature freezer, add liquid nitrogen and grind them thoroughly, continuously replenishing liquid nitrogen during the process until they are fully ground.

[0118] 2) Before adding the sample to the centrifuge tube, immerse the 1.5 ml RNase-free centrifuge tube completely in liquid nitrogen for quick freezing. Then quickly add the ground sample. Do not add too much sample, generally add to 1 / 3 (about 50 mg). Add 500 μL of lysis buffer and 50 μL of PLANTaid to the centrifuge tube and vortex for 20 seconds to ensure complete lysis.

[0119] 3) Centrifuge the lysate at 13,000 rpm for 10 minutes to precipitate unlysed fragments and PLANTaid bound with polysaccharides and polyphenols.

[0120] 4) Transfer the supernatant of the lysate to a new centrifuge tube. Add an equal volume of anhydrous ethanol to the supernatant and immediately mix by pipetting; do not centrifuge.

[0121] 5) Add the mixture (less than 720 μL each time, which can be added in two batches) to a genomic DNA filter, centrifuge at 13,000 rpm for 2 min, and discard the waste liquid.

[0122] 6) Place the genomic DNA filter in a clean 2ml centrifuge tube, add 500ul of lysis buffer RLT PLUS to the filter, centrifuge at 13000rpm for 30s, collect the filtrate, estimate the filtration volume accurately with a pipette, and add 0.5 times the volume of anhydrous ethanol. Precipitation may occur at this time, but it will not affect the extraction process. Immediately mix by pipetting and do not centrifuge.

[0123] 7) Immediately add the mixture to an adsorption column RA, centrifuge at 13000 rpm for 2 min, and discard the waste liquid.

[0124] 8) Add 700 μL of protein removal solution RW1, let stand at room temperature for 1 min, centrifuge at 13000 rpm for 30 s, and discard the waste liquid.

[0125] 9) Add 500 μL of wash buffer RW, centrifuge at 13000 rpm for 30 seconds and discard the waste liquid. Add 500 μL of wash buffer RW again and repeat once. Place the adsorption column RA back into the empty collection tube, centrifuge at 13000 rpm for 2 minutes to remove as much wash buffer as possible to avoid residual ethanol in the wash buffer inhibiting the downstream reaction.

[0126] 10) Take out the RA adsorption column, put it into an RNase-free centrifuge tube, add 30-50 μL of RNase-free water in the middle of the adsorption membrane, let it stand at room temperature for 1 minute, and centrifuge at 13,000 rpm for 1 minute.

[0127] The quality of the extracted RNA was determined by 1% agarose gel electrophoresis for 18 min, and the concentration of the extracted RNA was determined by spectrophotometer. An appropriate amount of RNA was used for purification and reverse mixing, and the remaining RNA was stored at -76℃ for long-term storage.

[0128] 2.1.4. Reverse transcription to synthesize first-strand cDNA

[0129] Using the total RNA extracted in section 2.1.3 as a template, cDNA was synthesized by reverse transcription according to the Transgen One-Step gDNA Removal and cDNA Synthesis SuperMix manual. The procedure is as follows:

[0130] 20 μL reverse transcription reaction mixture (placed in a 0.2 mL RNase-free centrifuge tube)

[0131]

[0132] Incubate at 50℃ for 30 min, then heat at 85℃ for 5 s to inactivate the enzyme, and quickly transfer to ice. Dilute the cDNA stock solution 5-fold, perform PCR amplification using the internal control gene GADPH, check the reverse conversion efficiency, and store at -20℃ for later use.

[0133] 2.1.5 Amplification of candidate genomic DNA

[0134] Download the candidate gene sequence corresponding to reference genome B73 from the Maize GDB database (https: / / www.maizegdb.org / ), design primers using Primer5 software, and amplify the full-length candidate genome DNA using the genomic DNA extracted in section 2.1.2 as a template. The amplification system is as follows:

[0135]

[0136] The candidate gene is 4420 bp in length. Due to its long length, primers were designed to amplify the full gene in segments. Primers were designed using the full gene length and the upstream and downstream 500 bp sequences as reference sequences. The primer sequences are as follows:

[0137] Forward Primer 1: 5'-GCACAAACTTTCATATGGGTAGAC-3'

[0138] Reverse Primer 1: 5'-AGCCATGTAACATATCCTGGACAG-3'

[0139] Forward Primer 2: 5'-CCGATTCTCCGTTCCTCCACAGT-3'

[0140] Reverse Primer 2: 5'-GATCTCAGAGCCATGACCACCAT-3'

[0141] Forward Primer 3: 5'-CTTCTCGCCAATCACAGCAGAG-3'

[0142] Reverse Primer 3: 5'-AAGTCGCAGCAACAACTGGTTC-3'

[0143] Forward Primer 4: 5'-GAACCAGTTGTTGCTGCGACTT-3'

[0144] Reverse Primer 4: 5'-TGGCGTTGCACTGACTTCGTAT-3'

[0145] Forward Primer 5: 5'-TCCAGACGCAACCGAACAAGT-3'

[0146] Reverse Primer 5: 5'-TGCCATCAGACAAGACAAGCTC-3'

[0147] The PCR amplification procedure is as follows:

[0148]

[0149] 2.1.6 Amplification of full-length cDNA of candidate genes

[0150] Primers were designed based on the amplified genomic DNA sequence. Using the cDNA obtained in section 2.1.4 as templates for gene amplification, primers were designed to amplify the full-length cDNA sequence of the gene. The amplification system is as follows:

[0151]

[0152] The primer sequences are as follows:

[0153] Forward Primer: 5'-GATTCTCCGTTCCTCCACAGT-3'

[0154] Reverse Primer: 5'-GGGAAGGTTTGGTGTATTAGAT-3'

[0155] The PCR amplification procedure is as follows:

[0156]

[0157] 2.2 Recovery and sequencing of candidate genomic DNA and cDNA fragments

[0158] 2.2.1 Recovery of candidate genomic DNA and cDNA fragments

[0159] For fragment recovery, refer to the instruction manual of the FastPure Gel DNAExtraction Mini Kit from Beijing Novizan Biotechnology Co., Ltd.:

[0160] 1) Add 1g of agarose to 100ml of TAE solution, heat to boiling in a microwave oven, then add 10ul of 10000×GelStain dye, pour into a plate with a comb, and prepare a 1% agarose gel. Perform agarose gel electrophoresis (125v) on the PCR products of 2.1.5 and 2.1.6 with loading buffer added for 25min. Under long-wave ultraviolet light, cut the target bands and put them into 1.5ml centrifuge tubes.

[0161] 2) Add 400 μL of Buffer GDP to the centrifuge tube for sol-gel preparation.

[0162] 3) Place the centrifuge tubes in a 55°C water bath and incubate. Invert the tubes every 5 minutes to mix until the gel is completely melted and the solution turns pale yellow. Allow the solution to stand at room temperature until it cools down to room temperature before proceeding to the next step of the reaction.

[0163] 4) Transfer the solution from the centrifuge tube in the previous step into the adsorption column, place the centrifuge tube in a centrifuge, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and then put the adsorption column back into the empty collection tube.

[0164] 5) Add 300 μL of Buffer GDP to the adsorption column, let stand for 1 min, add the centrifuge tube to the centrifuge, centrifuge at 12000 rpm for 30 s, and discard the waste liquid.

[0165] 6) Place the adsorption column in the collection tube, add 700 μL of Buffer GW to the adsorption column, and centrifuge at 12,000 rpm for 30 seconds; discard the filtrate. Wash twice.

[0166] 7) Place the adsorption column back into the empty collection tube and centrifuge at 12,000 rpm for 2 minutes.

[0167] 8) Remove the adsorption column and place it in a clean 1.5ml sterile centrifuge tube. Let it stand at room temperature for 5 minutes. Add 25ul of elution buffer to the middle of the adsorption membrane. Let it stand at room temperature for 5 minutes. Centrifuge at 12000rpm for 2 minutes and collect the precipitate.

[0168] 9) Repeat step 8).

[0169] 2.2.2 Sequencing of candidate genomic DNA and cDNA fragments

[0170] Referring to the instructions for Tiangen Biotech's pLB zero-background rapid cloning kit, the operating steps are as follows:

[0171] 1) Ligate the recovered DNA fragment obtained in 2.2.1 to the pLB vector, and gently tap the centrifuge tube to mix the reaction solution. The ligation system is as follows:

[0172]

[0173] 2) Place the mixed reaction solution in a 22°C constant temperature metal bath and react for 15 minutes. After the reaction is complete, place the centrifuge tube on ice for subsequent conversion experiments.

[0174] 3) Prepare LB agarose plates containing ampicillin at a final concentration of 100 ug / ml, and place the plates at 37℃ for 20 min.

[0175] 4) Add 10 μL of the ligation product to 100 μL of E. coli TOP10 competent cells (the competent cells were taken out of the -80℃ freezer and placed on ice. The ligation product was added when the cells were just thawed). Gently tap the cells to mix. Incubate on ice for 30 min.

[0176] 5) Then place the centrifuge tubes in a 42°C water bath for 90 seconds, and immediately place them in an ice bath for 5 minutes.

[0177] 6) Add 500 μL of LB (antibiotic-free) medium to the centrifuge tube and incubate at 150 rpm and 37°C for 60 min with shaking to allow the bacteria to recover.

[0178] 7) Mix the bacterial culture in the centrifuge tube thoroughly, add 100 μL to LB solid agar medium containing ampicillin, and gently spread the bacterial culture with a sterile bent glass rod. After the surface of the plate is dry, invert the plate and incubate at 37°C for 12 hours.

[0179] 8) Remove the plate, pick the milky white positive single clones onto 600 μl of LB liquid medium (containing 100 ug / ml ampicillin), and incubate at 37℃ with shaking for 8 h. Perform bacterial PCR using pLB vector universal primers. Clones identified as positive by agarose gel electrophoresis are sequenced for verification, and plasmids are extracted for subsequent experiments.

[0180] The universal primer sequences for the pLB vector are as follows:

[0181] Forward Primer: 5'-CGACTCACTATAGGGAGAGCGGC-3'

[0182] Reverse Primer: 5'-AAGAACATCGATTTTCCATGGCAG-3'

[0183] Example 3: Transformation of Arabidopsis thaliana Col-0 by Zm00001d025992

[0184] 3.1 Construction of plant expression vectors for candidate genes

[0185] The steps for constructing the PCAMBIA3301-Zm00001d025992 vector are as follows:

[0186] 1) Linearization of the PCAMBIA3301 vector

[0187] The vector pCAMBIA3301 was digested with Nco I and BstE II restriction enzymes in a 37°C water bath, as follows:

[0188]

[0189]

[0190] Bath in a 37°C water bath for 3 hours, then cut and recycle the rubber.

[0191] 2) Preparation of Zm00001d025992 fragment

[0192] Using the cDNA recovered in 2.2.1 as a template, the gene fragment encoding Zm00001d025992 was amplified by PCR. The primers used included target fragment-specific primers and vector overlapping sequences. The primer sequences are as follows:

[0193] LF: 5'- ACGGGGGACTCTTGAC ATGCAACCGTCGTGCCTGGGC-3'

[0194] LR: 5'- ATTCGAGCTGGTCAC TTATGGAACTGATTGATACCA-3'

[0195] The PCR reaction system is as follows:

[0196]

[0197] The PCR amplification procedure is as follows:

[0198]

[0199] The amplified products were validated by electrophoresis and recovered by gel cutting.

[0200] 3) The linear fragment of the vector obtained in step 1) and the target gene fragment obtained in step 2) are ligated to generate a recombinant vector. The ligation principle is in-fusion, and the reagent used is the Seamless Assembly Cloning Kit from Clone Smarter Technologies. The ligation system is as follows:

[0201]

[0202] Mix gently and react at 50°C for 15 minutes.

[0203] 4) Transformation

[0204] Thaw Fast-T1 E. coli competent cells on ice. Add 10 μL of recombinant product to 100 μL of competent cells, gently tap the centrifuge tube to mix, and place on ice for 30 min. Then heat shock in a 42°C water bath for 30 s, and immediately transfer to ice to cool for 2 min. Add 450 μL of LB medium at room temperature, and then culture in a shaker at 37°C and 200 rpm for 1 hour. After that, take 100 μL of cells and spread them evenly on a kanamycin-resistant LB plate and incubate overnight in a 37°C incubator.

[0205] 5) Screening for positive clones

[0206] Use the following primers to perform positive clone PCR screening, and extract plasmids from the bacterial cultures that have been sequenced correctly for later use.

[0207] LF: 5'- ACGGGGGACTCTTGAC ATGCAACCGTCGTGCCTGGGC-3'

[0208] LR: 5'- ATTCGAGCTGGTCAC TTATGGAACTGATTGATACCA-3'

[0209] Sequencing results showed that the recombinant vector pCAMBIA3301-Zm00001d025992 is a 5'- of pCAMBIA3301. ACGGGGGACTCTTGAC -3' and 5'- GTGACCAGCTCGAAT The small fragment between -3' was replaced with the gene whose nucleotide sequence is Zm00001d025992 of SEQ ID No. 2, while keeping the other nucleotides of pCAMBIA3301 unchanged, resulting in a recombinant expression vector expressing the Zm00001d025992 gene. In pCAMBIA3301-Zm00001d025992, the promoter initiating transcription of the Zm00001d025992 gene is the CaMV 35S promoter.

[0210] The construction diagram of the recombinant vector PCAMBIA3301-Zm00001d025992 and the vector spectrum of the recombinant vector are shown below. Figure 5 As shown.

[0211] 3.2 Preparation of Agrobacterium infection solution

[0212] 1) Take Agrobacterium EHA105 competent cells stored at -70℃ and thaw them on ice.

[0213] 2) Add 1 μg of plasmid DNA to competent cells, mix gently, and incubate on ice for 5 minutes.

[0214] 3) Place the centrifuge tubes in liquid nitrogen for 5 minutes to freeze quickly, then quickly place them in a 37°C water bath for 5 minutes without shaking the water surface; then place the centrifuge tubes back on the ice and keep them in an ice bath for 5 minutes.

[0215] 4) Under aseptic conditions, add 800 μL of antibiotic-free LB liquid medium and shake the medium at 28°C for 2-3 hours to revive the bacteria.

[0216] 5) Centrifuge at 5000 rpm for 1 min to collect the bacteria, keep 100 μL of supernatant, gently resuspend the bacteria by pipetting, spread on LB agar plates containing the appropriate antibiotic, and incubate upside down in a 28°C incubator for 48-72 hours.

[0217] 3.3 Agrobacterium infection in Arabidopsis thaliana

[0218] 1) Pick a single colony with an inoculation needle and incubate it in 50ml LB liquid medium (containing 50ug / ml Kan) at 28℃ for 2 days.

[0219] 2) Centrifuge at 5000 rpm for 8 minutes and collect the bacterial cells.

[0220] 3) Resuspend the bacterial cells; first prepare a bacterial resuspension (100ml ddH2O, 5g sucrose, 10ul Silwet L-77), then resuspend the bacterial cells using the resuspension solution to achieve the final OD. 600nm The value is 0.8.

[0221] 4) Select Arabidopsis thaliana plants that have grown for about 4 weeks, are developing normally, and have just started to flower. First, remove the pods from the plant, pour the prepared bacterial suspension into a petri dish, and immerse the entire inflorescence in the bacterial suspension for 10 seconds.

[0222] 5) Soaked Arabidopsis ecotype col-0 (hereinafter referred to as wild Arabidopsis) plants were treated in the dark for 24 hours, and then normal light was restored.

[0223] 6) After the Arabidopsis thaliana matures, the seeds (T1) are harvested, dried, disinfected with 6% sodium hypochlorite, planted on MS medium containing 50 ug / ml glufosinate herbicide, and positive transformation plants (T1) are obtained by culturing Arabidopsis thaliana. The seeds of Arabidopsis thaliana T2 are then harvested.

[0224] 3.4 Overexpression of Zm00001d025992 resulted in smaller Arabidopsis seeds.

[0225] Total DNA was extracted from leaves at the flowering stage (T1) of Arabidopsis thaliana as a template. Primers were designed as follows: F1: 5'-GGAGTGCTGTGCTTGACGAAGAA-3'; R1: 5'-ACATGGATATTTGCTGGGCTGGC-3'. Real-time quantitative PCR (qRT-PCR) was used to detect the expression level of the target gene. The results showed that the expression level of the target gene was significantly increased in transgenic positive plants. Figure 3 Figure a) shows that transgenic plants overexpressing the target gene were successfully obtained. After the T1 plants matured, Arabidopsis seeds (T2) were harvested. Seeds from the T2 generation of Arabidopsis lines OE-4, OE-9, and OE-10 (transgenic with the Zm00001d025992 gene) and wild-type Arabidopsis (WT) were measured. 70 seeds from each line were used, and seed length, width, and weight were measured. Data were processed using SPSS 11.5 statistical software. Experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 indicated a significant difference compared to wild-type Arabidopsis.

[0226] The results showed that the grain length, grain width, and grain weight of the three transgenic lines were significantly lower than those of wild-type Arabidopsis thaliana. Figure 3 c) indicates that overexpression of Zm00001d025992 can reduce the size of Arabidopsis seeds.

[0227] Example 4: Construction of the Zm00001d025992 maize CRISPR / Cas9 transgenic line

[0228] 4.1 Constructing the knockout vector for Zm00001d025992

[0229] 1) Linearization of CPB vector

[0230] The CPB vector was linearized by digesting it with HindIII restriction enzyme at 37°C. The enzyme digestion system is as follows:

[0231] plasmid 1ug

[0232] HindⅢ 1ul

[0233] Buffer 10ul

[0234] Bath in a 37°C water bath for 3 hours, then cut and recycle the rubber.

[0235] 2) Screening of target genes for Zm00001d025992 gene

[0236] Generate a target list using the online target prediction website (http: / / crispor.tefor.net / ), and select the following targets:

[0237] T1: 5′-GAGCATGCAACCGTCGTGCC-3′,

[0238] T2: 5′-CACGAGGCGGAAGCCCTATG-3′,

[0239] T3: 5′-TAACGACCGTGCCGCCAAGG-3′

[0240] 3) Construction of sgRNA expression cassette

[0241] The sgRNA expression cassette template is shown in Sequence 7. The target sequences T1, T2, and T3 are replaced at positions nnnnnnnnnnnnnnnnnn in Sequence 7 to obtain the sgRNA1, sgRNA2, and sgRNA3 sequences. These are then sent to a biotechnology company for synthesis.

[0242] The expression cassette of sgRNA1 is a DNA molecule with the nucleotide sequence shown in SEQ ID No. 4, wherein nucleotides 1-17 and 543-568 of SEQ ID No. 4 are homologous arm sequences linking to CPB; the expression cassette of sgRNA2 is a DNA molecule with the nucleotide sequence shown in SEQ ID No. 5, wherein nucleotides 1-17 and 543-568 of SEQ ID No. 5 are homologous arm sequences linking to CPB; the expression cassette of sgRNA3 is a DNA molecule with the nucleotide sequence shown in SEQ ID No. 6, wherein nucleotides 1-17 and 543-568 of SEQ ID No. 6 are homologous arm sequences linking to CPB.

[0243] 4) The linear fragment of the CPB vector obtained in step 1) and the sgRNA expression cassette fragment obtained in step 3) were ligated using homologous recombination. The ligation principle is in-fusion, and the reagent used was the Seamless Assembly Cloning Kit from Clone Smarter Technologies. The ligation system is as follows:

[0244]

[0245] Gently mix and react at 50°C for 15 minutes to obtain recombinant vectors CPB-sgRNA1, CPB-sgRNA2, and CPB-sgRNA3, respectively.

[0246] 5) Transformation

[0247] Thaw Fast-T1 competent cells on ice. Add 10 μL of the recombinant vector obtained in step 4) to each 50 μL competent cell. Gently tap the centrifuge tube to mix. Place on ice for 30 minutes. Then heat shock in a 42°C water bath for 30 seconds. Immediately transfer to ice to cool for 2 minutes. Add 450 μL of LB medium at room temperature. Then culture at 37°C and 250 rpm for 1 hour. After that, take 100 μL of cells and spread them evenly on LB plates containing kanamycin resistance. Incubate overnight at 37°C.

[0248] 6) Screening for positive clones

[0249] The bacterial cells obtained from step 5) are screened for positive clones, and plasmids are extracted from the bacterial cultures that have been sequenced correctly for later use.

[0250] A schematic diagram of the construction of the recombinant vector CPB-sgRNA and a vector map of the recombinant vector CPB-sgRNA are shown below. Figure 6 As shown.

[0251] Sequencing results show that:

[0252] The recombinant vector CPB-sgRNA1 is formed by inserting the gene from positions 18-542 of SEQ ID No. 4 into the 5′- of CPB. TCACGCTGCACTGCACA -3′ and 5′- CTTGGCACTGGCCGTCGTTTTACAAC Between -3′, a recombinant expression vector expressing sgRNA1 was obtained.

[0253] The recombinant vector CPB-sgRNA2 is created by inserting the gene from positions 18-542 of SEQ ID No. 5 into the 5′- of CPB. TCACGCTGCACTGCACA -3′ and 5′- CTTGGCACTGGCCGTCGTTTTACAAC Between -3′, a recombinant expression vector expressing sgRNA2 was obtained.

[0254] The recombinant vector CPB-sgRNA3 is created by inserting the gene from positions 18-542 of SEQ ID No. 6 into the 5′- of CPB. TCACGCTGCACTGCACA -3′ and 5′- CTTGGCACTGGCCGTCGTTTTACAAC Between -3′, a recombinant expression vector expressing sgRNA3 was obtained.

[0255] 4.2 Obtaining EHA105 / CPB-sgRNA1 / CPB-sgRNA2 / CPB-sgRNA3

[0256] Recombinant plasmid CPB-sgRNA1, recombinant vector CPB-sgRNA2, and recombinant vector CPB-sgRNA3 were introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium, which were named EHA105 / CPB-sgRNA1, EHA105 / CPB-sgRNA2, and EHA105 / CPB-sgRNA3, respectively.

[0257] 4.3 Obtaining T0 generation maize with Zm0000d025992 gene knocked out

[0258] The transformation method using Agrobacterium-mediated transformation of maize embryos was employed. EHA105 / CPB-sgRNA1, EHA105 / CPB-sgRNA2, and EHA105 / CPB-sgRNA3 prepared in section 4.2 were transformed into B104 cells to obtain T0 generation transgenic maize. Basta was applied to the leaves of the T0 generation transgenic maize plants; plants whose leaves grew normally (resistant seedlings) were identified as T0 generation transgenic plants. The transgenic T0 plants were self-pollinated, and harvested after maturity to obtain T1 generation transgenic seeds, including knockout lines KO#1 and KO#2 mutant plants.

[0259] 4.4 Genotype and Phenotype of the Zm00001d025992 Knockout Line

[0260] Seeds of maize inbred line B104(WT), T1 generation transgenic seeds of knockout line KO#1 mutant plants and T1 generation transgenic seeds of KO#2 mutant plants were planted in two rows for each material, with a row length of 3 meters, a plant spacing of 0.25 meters, a row spacing of 0.6 meters, and three replicates.

[0261] Leaves from transgenic plants were collected for DNA extraction. DNA extraction was performed using the same method as described in section 2.1.2. DNA level detection was performed on positive plants of the Zm00001d025992 gene knockout mutant. Genomic DNA was extracted from the knockout mutant plants and used as a template, with F2 and R2 primers for amplification. Wild-type plant genomic DNA and ddH2O served as negative controls. The reaction system is as follows:

[0262]

[0263] The nucleotide sequences of F2 and R2 are as follows:

[0264] F2: 5′-CGCCGAGCGACACCG-3′

[0265] R2: 5′-CCATCCCCTTCCCCTCG-3′

[0266] The amplification reaction program was as follows: Round 1: denaturation at 95℃ for 5 min; Round 2: denaturation at 95℃ for 15 sec, annealing at 55℃ for 15 sec, extension at 72℃ for 10 sec, 35 cycles; Round 3: extension at 72℃ for 5 min. After the program, the results were detected by 2.0% agarose gel electrophoresis. Figure 7 As shown in Figure a, compared to the wild-type material, the mutant plants in the transgenic plant material showed smaller bands, and some even had two bands. Plants with smaller bands indicate a small deletion in the gene; plants with two bands are heterozygous. The target bands were excised and sequenced. Sequencing results showed that the main mutant genotypes of the transgenic positive plants were... Figure 7 The types shown in b are:

[0267] There are two types of mutations, one of which is Figure 7 Band 2 in sequence a, obtained by adding a T base between positions 98 and 99 of the Zm00001d025992 genome and deleting 94 nucleotides from positions 182 to 275 while keeping the rest of the nucleotide sequence unchanged, yields a DNA molecule whose coding sequence is obtained by adding a T base between positions 13 and 14 of sequence 2 in the sequence listing and deleting 94 nucleotides from positions 97 to 190 while keeping the rest of the nucleotide sequence unchanged. The coding sequence of this DNA molecule is shown in Sequence 8 and is named the Zm00001d025992 / +1bp,-94bp gene. This mutation leads to premature termination of translation, and the encoded protein is named Zm00001d025992 / +1bp,-94bp.

[0268] Another one is Figure 7 Band 9 in sequence a represents a DNA molecule obtained by adding a T base between positions 98 and 99 of the Zm00001d025992 genome and deleting 93 nucleotides from positions 183 to 275, while keeping the other nucleotide sequences of sequence 3 unchanged. Its coding sequence is obtained by adding a T base between positions 13 and 14 of sequence 2 in the sequence listing and deleting 93 nucleotides from positions 98 to 190, while keeping the other nucleotide sequences of sequence 2 unchanged. The coding sequence of this DNA molecule is shown in sequence 9 and is named the Zm00001d025992 / +1bp,-93bp gene. This mutation leads to premature termination of translation, and the encoded protein is named Zm00001d025992 / +1bp,-93bp.

[0269] 4.5 Grain phenotype of the Zm00001d025992 knockout line

[0270] After harvest, the grain length, grain width, and 100-grain weight of the T2 generation were investigated.

[0271] The results showed that, compared with wild-type B104, the knockout plants of KO#1 and KO#2 had larger grain weight and longer grain length, while the grain width did not change significantly. Figure 4 The results showed that knocking out the Zm00001d025992 gene significantly increased maize kernel weight and length, thus proving that the target gene has an important biological function in regulating maize kernel development.

[0272] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Institute of Crop Science, Chinese Academy of Agricultural Sciences <120> Maize kernel size and weight related proteins, their encoding genes and applications <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> 469 <212> PRT <213> Corn (Zea mays) <400> 1 Met Gln Pro Ser Cys Leu Gly Ala Cys Ser Gly Gly Gly Leu Ala Leu 1 5 10 15 Ser Ala Arg Arg Leu Arg Ala Pro Ser Tyr Cys Arg Val Ala Pro His 20 25 30 Arg Ala Ser Ala Ser Cys Ser Ala Gly Gly Gly Gly Lys Ala Ser Pro 35 40 45 Arg Gly Lys Asp Asn Val Trp Ser Val Asp Asn Asp Arg Ala Ala Lys 50 55 60 Glu Ala Val Arg Gly Pro Lys His Arg Arg Arg Lys Arg Pro Ser Gly 65 70 75 80 Arg Arg Leu Pro Pro Pro Arg Arg Lys Gly Met Asp Ala Gly Ser Arg 85 90 95 Val Leu Val Ser Gly Ala Met Leu Val Glu Val Glu Thr Val Leu Gln 100 105 110 Thr Gln Glu Pro Val Ile Lys Pro Ser Trp Asp Thr Phe Ala Ser Ser 115 120 125 Leu Thr Gly Asn Trp Lys Gly Val Gly Ala Ile Phe Ser Pro Ile Thr 130 135 140 Ala Glu Met Glu Pro Val Gly Val Gly Asn Lys Glu Glu Tyr Leu Tyr 145 150 155 160 Asp Cys Tyr Thr Leu Ser His Ile Glu Arg Ser Phe Asp Gly Gly His 165 170 175 Gly Ser Glu Ile Arg Arg Lys Thr Asn Trp Val Pro Ile Asn Pro Phe 180 185 190 Gly Glu Ala Glu Lys Gln Ile Thr Ser Tyr Asp Gly Gly Ser Gln Ser 195 200 205 Thr Ser Ser Gly Lys Gly Ile Ala Asp Leu Pro Ser Tyr Glu Ser Phe 210 215 220 Asp Leu Asn Arg Ser Ala Val Leu Asp Glu Glu Thr Phe Ser Met Glu 225 230 235 240 Pro Gly Ile Val Phe Phe Glu Asp Gly Ser Tyr Ser Arg Gly Pro Val 245 250 255 Asp Ile Ala Ile Gly Glu Tyr Asp Glu Ser Lys Tyr Phe Leu Ser Pro 260 265 270 Thr Tyr Lys Phe Glu Gln Cys Leu Val Lys Gly Cys His Lys Arg Leu 275 280 285 Arg Ile Val His Thr Ile Glu Phe Asn Glu Gly Gly Ala Asn Ile Gln 290 295 300 Ile Val Arg Val Ala Val Tyr Glu Glu Lys Trp Ala Ser Pro Ala Asn 305 310 315 320 Ile His Val Glu Asp Asp Thr Leu Val Asp Leu Lys Pro Phe Ser Gln 325 330 335 Arg Ser Arg Thr Lys Pro Ser Glu Leu Thr Gly Ser Trp Lys Val Tyr 340 345 350 Glu Val Ser Ala Thr Pro Ile Phe Ser Asp Lys Val Gln Glu Leu Glu 355 360 365 Gly Gly Ser Pro Leu Val Tyr Leu Cys Met Glu Thr Val Lys Lys Arg 370 375 380 Asn Leu Pro Glu Ser Ser Val Phe Phe Gly Glu Glu Glu Met Leu Asp 385 390 395 400 Val Gln Asp Val Thr Val Leu Trp Leu Pro Gly Gly Val Thr Ala Tyr 405 410 415 Val Asp Ile Ser Glu Asp Gly Ile Leu Cys Ile Gly Val Gly Trp Tyr 420 425 430 Ser Glu Glu Gly Ile Asn Leu Val Met Glu Arg Asp Tyr Gly Thr Asp 435 440 445 Gly Arg Leu Arg Glu Val Arg Ser Lys Thr Glu Val Lys Arg Arg Trp 450 455 460 Tyr Gln Ser Val Pro 465 <210> 2 <211> 1410 <212> DNA <213> Zea mays <400> 2 atgcaaccgt cgtgcctggg cgcatgcagc ggtggaggac tagcactttc cgcccgccgc 60 ctccgcgccc cctcctactg ccgcgtcgcg ccgcataggg cttccgcctc gtgctccgcc 120 ggtggcggcg gcaaggcatc gccgcggggg aaggacaacg tctggagcgt cgataacgac 180 cgtgccgcca aggaggcggt ccggggcccg aagcaccgcc gcaggaaacg ccccagcggt 240 cgccgcctgc cgccgccgag gaggaagggg atggatgcgg ggtcgagggt tctagtgtct 300 ggagccatgc tcgtggaggt cgaaactgtg ctccaaactc aggaacctgt tataaagcct 360 tcttgggata catttgcaag tagtttaact ggtaactgga agggtgttgg agctatcttc 420 tcgccaatca cagcagagat ggagcctgtt ggggttggga acaaagaaga gtacctttat 480 gactgctaca ctctttctca cattgagaga tcttttgatg gtggtcatgg ctctgagatc 540 cgaaggaaaa caaattgggt cccaatcaat ccgtttgggg aagctgagaa gcaaatcaca 600 tcatatgatg gtgggagtca aagcacttcc agtggaaagg gaattgctga tttaccttca 660 tatgagtctt ttgatcttaa caggagtgct gtgcttgacg aagaaacttt ttctatggag 720 cctggaattg tattttttga ggacggatca tactctagag gtccagttga tatagcaatt 780 ggtgaatatg atgaatctaa atacttcctt tcaccaacat ataagtttga gcaatgcctt 840 gttaaaggtt gccacaaaag attgcggatt gtgcatacaa ttgagtttaa cgaaggagga 900 gctaacatac aaattgtaag ggttgctgtg tatgaagaaa aatgggccag cccagcaaat 960 atccatgttg aagatgatac acttgttgac cttaaaccat tctctcaaag aagccggacc 1020 aaaccgtcag aactgacagg ctcctggaaa gtatacgaag tcagtgcaac gccaattttc 1080 agtgataaag tgcaagaact agagggcggt tctccattgg tctacttgtg catggagacg 1140 gtgaagaaga gaaacctgcc agagagttca gttttctttg gggaggagga gatgctcgac 1200 gtgcaggatg tcaccgtgct ttggttacct ggtggcgtca ctgcctatgt tgacatcagc 1260 gaagacggca tactctgtat cggagttggg tggtactccg aagaaggtat caacctggtg 1320 atggagagag actatggaac cgatgggagg ctcagggagg ttcggtcgaa aactgaagta 1380 aagcgcaggt ggtatcaatc agttccataa 1410 <210> 3 <211> 4420 <212> DNA <213> Zea mays <400> 3 atccccaacc tcgccgattc tccgttctcc acagtcctcc acactcgccg agcgacaccg 60 cgcgggacga ccgagcaagc agagcatgca accgtcgtgc ctgggcgcat gcagcggtgg 120 aggactagca ctttccgccc gccgccg cgccccctcc tactgccgcg tcgcgcgca 180 tagggcttcc gcctcgtgct ccgccggtgg cggcggcaag gcatcgccgc gggggaagga 240 caacgtctgg agcgtcgata acgaccgtgc cgccaaggag gcggtccgg gcccgaagca 300 ccgccgcagg aaacgcccca gcggtcgccg cctgccgccg ccgaggagga aggggatgga 360 tgcggggtcg agggttctag tgtctggagc catgctcgtg gaggtcgaaa ctgtgctcca 420 aactcaggta ttcatgctgc atcttatcat ctatctacct gtccaggata tgttacatgg 480 ctacagaatt aaagttaagg tggaatggtg gatactggat acgtgtgttt ccagcactat 540 tgtactgata ccgcactatt gtactaatac cattttggcg gatatatgtc ctgttcgtcc 600 tgcgaaatcc aatcaattgc tttagttatt cacattaatt gacagtttaa agctagttta 660 ttagagtcta tacagtggat gcataaaaga tgcaagaata atggttgggt aattcttggt 720 taaggcattc taattagtac tagctagtgc tggtaggatt catataggca tatagcgatg 780 aatggttgga ttaatctggg tagaacagca ttctcccagc agattgtatt aataatttaa 840 tttaacgttt attattcctg tcataacgat ttggtgcaac cttctgattt ctgaagttgt 900 tacttttcaa tcttaggaac ctgttataaa gccttcttgg gatacatttg caagtagttt 960 aactggtaac tggaagggtg ttggagctat cttctcgcca atcacagcag agatggagcc 1020 tgttggggtt gggaacaaag aagagtacct ttatgactgc tacactcttt ctcacattga 1080 gagatcttt gatggtggtc atggctctga gatccgaagg aaaacaaatt gggtcccaat 1140 caatccgttt ggggaagctg agaagcaaat cacatcatat gatggtggga gtcaaagcac 1200 ttccagtgga aagggaattg ctgatttacc ttcatatgag tctttgatc ttaacaggag 1260 tgctgtgctt gacgaagaaa ctttttctat ggagcctgga attgtatttt ttgaggtaat 1320 tttattttgt cttcgcctcc atttggtgtt tttgaaatgt agtgatatgg ttatatgcag 1380 aactgtcttt atatttattg ctaattgaaa accatggcat agtttctttc atcaacatat 1440 tttactatgc tttgcaaaat caggaatcca tcacttctgt ttgccgccag cctaccagga 1500 tcttcattta tcaattgta atttagtatt tcttcttgca aagcttgaat atttagatgg 1560 gttctctgtc gggaaaagaa gctagttgtg aaggattgac tgtaatgtct caaattgtt 1620 agaactatta cacattaag cctagattat ctatgtgcgt ttacaagcta catttaaaaa 1680 gtaaatcatt ctttagtgtg ttcagtgat attgatgctt cacatattca ttcttgttca 1740 agtgcttat tctctggcca ttaatctct ctgatagagt gggttattgt aacacttgtg 1800 tgttcttttt ttatgaataa tcagtactt attccttttgg cgattgtgct tacattttca 1860 ggacggatca tactctagag gtccagttga tatagcaat ggtgaatg atgaatctaa 1920 atactcctt tcaccacat ataagtttga gcaagtacgt ttactgcact tacatttaca 1980 ttttcaattt ttgtgacaca catggaaag gtttaggcat acttgattga tagaattct 2040 tgttgtgcta agtagaatag gttgcttcct tacacctac atgcacatat ccatatttga 2100 acagcttttc ttgagaaaa ttacaaggca gatgcatgtg attttcttt ttcctcttg 2160 tttacatgtg gatgccataa cttggctgt tgtgctttg ctggatggac ttttgctgt 2220 caaaaatg tgccacttct aggcaatgtc atttaagtttt gcaattgaat tatacatgtg 2280 tataaataa atagcaatt cagcaccat gtatttactt tgtaggata agggaaaaa 2340 aatccttcga accatggctt atagagggac atgtgtgaat tatatgttac taatgaacca 2400 gttgttgctg cgactttcaa gtttgaaca tattatttt tgaagaggc tcctgttttg 2460 tgtctagatg actgtgattc tgtttcttg atgctgcctg tgtgcctgc actctggttt 2520 accaattgat agcttacacc cattctata cagtgccttg ttaaaggttg ccacaaaga 2580 ttgcggattg tgcatacaat tgagtttaac gaaggaggag ctaacataca aattgtagg 2640 gttgctgtgt atgaagaaaa atgggccagc ccagcaaata tccatgttga agagtaagcc 2700 tgcttaatta caatttttct catctgcttt gctaatagtt ctagattggt gggaccaatc 2760 cagaaaggat aaaaaatta aagatcgctg ttttaaaag attcagttaa gattcttcca 2820 aaaactttat tgtgactgat tcactcata gtatggtgac attctctat aaggtttgga 2880 ctcaatttgt tcctgattag ctacagtgtc ttccaaaga gactgacctt gtatttggca 2940 acaaaacatt tgtgtctatc aaatatgtcc accaaaagtg gcaccaaatt ggcttttcta 3000 gatccataga tttttctatg catctagata tacactatgt ctagatgcat agtaaaaact 3060 atgaatctat caaagctaat atgacttata atttggaaca gatggagtag gttattgggg 3120 attacattcc tttgggtttc cagatctcta gtatgattcc aaacttgcac atcagttcaa 3180 agaaactaat aagaaagaaa cgcaggaatc ttttctaggc acaattctcc tttacttcaa 3240 tatttagtgg ttgattgtgg tttcaaacct aattcttggt tcaccactaa aggcttgttc 3300 ggttgcgtct ggatcgaagg ggattaaggg actgtttagt tcgtggctaa ttgtgcacac 3360 tttgcctaag gcagttgttc gaattgaata actaacctta ggcagaaaag ttaggcaaag 3420 tgtgacaagt taggcaggga accaaacagc ccttaaatcc ctccctagtc aaaatcaaaa 3480 tggaattgag ggggattaaa tcccttctat tcaattttga ctagggaggg atttaatccc 3540 cttcgatcca gacgcaaccg aacaagtctg tggaccctaa caaaaaaaaa caaattggaa 3600 gagcaaatat gagcagagga gccatttgat ttaataaatc cagaatttct caatgggaga 3660 gatagaatg atcatgatta ttaaaaaaaa cagaatttgt tttatgtgg tctggtgta 3720 taaaaaacgc ctaggtctcc acagttttc taatgtttat ctcctatgca gtgatacact 3780 tgttgacctt aaaccattct ctcaagaag ccggaccaaa ccgtcagaac tgacaggctc 3840 ctggaaagta tacgaagtca gtgcaacgcc aattttcagt gataagtgc aagaactaga 3900 gggcggttct ccattggtct acttgtgcat ggagacggtg aagagagaa acctgccaga 3960 gagttcagtt ttctttgggg aggaggat gctcgacgtg caggatgtca ccgtgctttg 4020 gttacctggt ggcgtcactg cctatgttga catcagcgaa gacggcatac tctgtatcgg 4080 agttgggtgg tactccgaag aaggtatcaa cctggtgatg gagagact atggaccga 4140 tgggaggctc agggaggttc ggtcgaaaac tgaagtaag cgcaggtggt atcaatcagt 4200 tccataataa cccaaagtttt atttttgat ttctgcttaa attaatcttt gtttctaaat 4260 agcggcctag gatcagtatc taatacacca aaccttcccg ttgacaggg tcgatgtact 4320 tcatagctaa gctgtaactt ttgttgccta tgtagaatgt gatgttctg gtttgaacga 4380 taagaaaaat gagcttaaaa tccattctca tacgccacaa 4420 <210> 4 <211> 568 <212> DNA <213> Artificial Sequence <400> 4 tcacgctgca ctgcacaatc gggaattcgt aatcatgtca aaattggccc ttacaaaata 60 gctagacgtg caggtggctg gatgtgcgct ccctgaatat caacttgtgt ctcctccgat 120 tcagtccgca gatgaaactt ggtaataact gcagctgatc cgtcgtcatt catgctatgc 180 aggggattcg atcttcagca tgtgcagtgc aggcaacaac aatctacgtt gtctgggctt 240 gcgataggta cacgaccacg agggaaggca acgcgtgatg tatgggccgc gcctaagcat 300 ccagcccacg cgggcgtgcg cgtcgtcgct acggcttgcg ggggaaggga tcaagggacg 360 aaccgagaac tagtaccaga ccggccagcg agcattgcag acaccggctt ataagttcag 420 ctgcgaccac cgctccgagc atgcaaccgt cgtgccgttt tagagctaga aatagcaagt 480 taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt gcttttttta 540 agcttggcac tggccgtcgt tttacaac 568 <210> 5 <211> 568 <212> DNA <213> Artificial Sequence <400> 5 tcacgctgca ctgcacaatc gggaattcgt aatcatgtca aaattggccc ttacaaaata 60 gctagacgtg caggtggctg gatgtgcgct ccctgaatat caacttgtgt ctcctccgat 120 tcagtccgca gatgaaactt ggtaataact gcagctgatc cgtcgtcatt catgctatgc 180 aggggattcg atcttcagca tgtgcagtgc aggcaacaac aatctacgtt gtctgggctt 240 gcgataggta cacgaccacg agggaaggca acgcgtgatg tatgggccgc gcctaagcat 300 ccagcccacg cgggcgtgcg cgtcgtcgct acggcttgcg ggggaaggga tcaagggacg 360 aaccgagaac tagtaccaga ccggccagcg agcattgcag acaccggctt ataagttcag 420 ctgcgaccac cgctcccacg aggcggaagc cctatggttt tagagctaga aatagcaagt 480 taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt gcttttttta 540 agcttggcac tggccgtcgt tttacaac 568 <210> 6 <211> 568 <212> DNA <213> Artificial Sequence <400> 6 tcacgctgca ctgcacaatc gggaattcgt aatcatgtca aaattggccc ttacaaaata 60 gctagacgtg caggtggctg gatgtgcgct ccctgaatat caacttgtgt ctcctccgat 120 tcagtccgca gatgaaactt ggtaataact gcagctgatc cgtcgtcatt catgctatgc 180 aggggattcg atcttcagca tgtgcagtgc aggcaacaac aatctacgtt gtctgggctt 240 gcgataggta cacgaccacg agggaaggca acgcgtgatg tatgggccgc gcctaagcat 300 ccagcccacg cgggcgtgcg cgtcgtcgct acggcttgcg ggggaaggga tcaagggacg 360 aaccgagaac tagtaccaga ccggccagcg agcattgcag acaccggctt ataagttcag 420 ctgcgaccac cgctcctaac gaccgtgccg ccaagggttt tagagctaga aatagcaagt 480 taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt gcttttttta 540 agcttggcac tggccgtcgt tttacaac 568 <210> 7 <211> 568 <212> DNA <213> Artificial Sequence <400> 7 tcacgctgca ctgcacaatc gggaattcgt aatcatgtca aaattggccc ttacaaaata 60 gctagacgtg caggtggctg gatgtgcgct ccctgaatat caacttgtgt ctcctccgat 120 tcagtccgca gatgaaactt ggtaataact gcagctgatc cgtcgtcatt catgctatgc 180 aggggattcg atcttcagca tgtgcagtgc aggcaacaac aatctacgtt gtctgggctt 240 gcgataggta cacgaccacg agggaaggca acgcgtgatg tatgggccgc gcctaagcat 300 ccagcccacg cgggcgtgcg cgtcgtcgct acggcttgcg ggggaaggga tcaagggacg 360 aaccgagaac tagtaccaga ccggccagcg agcattgcag acaccggctt ataagttcag 420 ctgcgaccac cgctccnnnn nnnnnnnnnn nnnnnngttt tagagctaga aatagcaagt 480 taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt gcttttttta 540 agcttggcac tggccgtcgt tttacaac 568 <210> 8 <211> 1317 <212> DNA <213> Zea mays <400> 8 atgcaaccgt cgttgcctgg gcgcatgcag cggtggagga ctagcacttt ccgcccgccg 60 cctccgcgcc ccctcctact gccgcgtcgc gccgcatagg aggcggtccg gggcccgaag 120 caccgccgca ggaaacgccc cagcggtcgc cgcctgccgc cgccgaggag gaaggggatg 180 gatgcggggt cgagggttct agtgtctgga gccatgctcg tggaggtcga aactgtgctc 240 caaactcagg aacctgttat aaagccttct tgggatacat ttgcaagtag tttaactggt 300 aactggaagg gtgttggagc tatcttctcg ccaatcacag cagagatgga gcctgttggg 360 gttgggaaca aagaagagta cctttatgac tgctacactc tttctcacat tgagagatct 420 tttgatggtg gtcatggctc tgagatccga aggaaaacaa attgggtccc aatcaatccg 480 tttggggaag ctgagaagca aatcacatca tatgatggtg ggagtcaaag cacttccagt 540 ggaaagggaa ttgctgattt accttcatat gagtcttttg atcttaacag gagtgctgtg 600 cttgacgaag aaactttttc tatggagcct ggaattgtat tttttgagga cggatcatac 660 tctagaggtc cagttgatat agcaattggt gaatatgatg aatctaaata cttcctttca 720 ccaacatata agtttgagca atgccttgtt aaaggttgcc acaaaagatt gcggattgtg 780 catacaattg agtttaacga aggaggagct aacatacaaa ttgtaagggt tgctgtgtat 840 gaagaaaaat gggccagccc agcaaatatc catgttgaag atgatacact tgttgacctt 900 aaaccattct ctcaaagaag ccggaccaaa ccgtcagaac tgacaggctc ctggaaagta 960 tacgaagtca gtgcaacgcc aattttcagt gataaagtgc aagaactaga gggcggttct 1020 ccattggtct acttgtgcat ggagacggtg aagaagagaa acctgccaga gagttcagtt 1080 ttctttgggg aggaggagat gctcgacgtg caggatgtca ccgtgctttg gttacctggt 1140 ggcgtcactg cctatgttga catcagcgaa gacggcatac tctgtatcgg agttgggtgg 1200 tactccgaag aaggtatcaa cctggtgatg gagagagact atggaaccga tgggaggctc 1260 agggaggttc ggtcgaaaac tgaagtaaag cgcaggtggt atcaatcagt tccataa 1317 <210> 9 <211> 1318 <212> DNA <213> Zea mays <400> 9 atgcaaccgt cgttgcctgg gcgcatgcag cggtggagga ctagcacttt ccgcccgccg 60 cctccgcgcc ccctcctact gccgcgtcgc gccgcataag gaggcggtcc ggggcccgaa 120 gcaccgccgc aggaaacgcc ccagcggtcg ccgcctgccg ccgccgagga ggaaggggat 180 ggatgcgggg tcgagggttc tagtgtctgg agccatgctc gtggaggtcg aaactgtgct 240 ccaaactcag gaacctgtta taaagcctt ttgggataca tttgcaagta gtttaactgg 300 taacgggaag ggtgttggag ctatcttctc gccaatcaca gcagagatgg agcctgttgg 360 ggttgggaac aaaagaagt acctttatga ctgctacact ctttctcaca ttgagagatc 420 ttttgatggt ggtcatggct ctgagatccg aagaaaaca aattgggtcc caatcaatcc 480 gtttgggggaa gctgagaagc aaatcacatc atatgatggt gggagtcaaa gcacttccag 540 tggaaggga attgctgatt taccttcata tgagtctttt gatcttaaca ggagtgctgt 600 660 ctctagaggt ccagttgata tagcaattgg tgaatatgat gaatctaaat acttcctttc 720 accaacatat aagtttgagc aatgccttgt taaaggttgc cacaaaagat tgcggattgt 780 gcatacaatt gagtttaacg aaggaggagc taacatacaa attgtaaggg ttgctgtgta 840 tgaagaaaaa tgggccagcc cagcaatat ccatgttgaa gatgatacac ttgttgacct taaccattc tctcaaaga gccggacca accgtcaga ctgacaggct cctggaagt attack agtgcaacgc caattttcag tgataaagtg caagaactag agggcggttc tccattggtc tacttgtgca tggagacggt gaagagaga aacctgccag agagttcagt 1080 tttctttggg gaggagga tgctcgacgt gcaggatgtc accgtgcttt ggttacctgg tggcgtcact gcctatgttg acatcagcga agacggcata ctctgtatcg gagttgggtg gtactccgaa gaaggtatca acctggtgat ggagagagac tatggaaccg atgggaggct cagggaggtt cggtcgaaaa ctgaagtaaa gcgcaggtgg tatcaatcag ttccataa

Claims

1. The use of a substance that reduces the expression of a protein-coding gene or reduces the activity or content of said protein in at least one of the following: Application of D1' in improving corn kernel length and / or kernel weight; Application of D2' in the preparation of reagents to improve the length and / or weight of corn kernels; Application of D3' in the preparation of reagents for cultivating high-yield maize; Application of D4' in breeding maize kernel length and / or kernel weight traits; The protein in question is the protein whose amino acid sequence is SEQ ID No.

1. The substance that reduces the expression of the protein-coding gene or reduces the activity or content of the protein is a biological material, and the biological material is at least one of the following: B8) A nucleic acid molecule that inhibits or reduces the expression of the gene encoding the protein or inhibits or reduces the activity of the protein; the nucleic acid molecule is a DNA molecule that expresses gRNA targeting the gene encoding the protein. The target sequence of the gRNA is the nucleotides shown in positions 82-101 of SEQ ID No. 3, the nucleotides shown in positions 179-198 of SEQ ID No. 3, and / or the nucleotides shown in positions 259-278 of SEQ ID No. 3; B9) Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules described in B8); The gRNAs described in B10 and B8).

2. A method for increasing the length and / or weight of corn kernels, comprising increasing the length or weight of corn kernels by knocking out the gene encoding the protein described in claim 1 in corn.

3. The method according to claim 2, characterized in that, Knocking out the gene encoding the protein described in claim 1 in maize involves performing at least one of the following mutations on the maize DNA molecule whose coding sequence is shown in SEQ ID No. 2: F1) The DNA molecule in maize with the coding sequence shown in SEQ ID No. 2 was mutated to the gene Zm00001d025992 / +1 bp,-94 bp, the coding sequence of which is shown in SEQ ID No. 8; F2) The DNA molecule in maize with the coding sequence shown in SEQ ID No. 2 is mutated to the gene Zm00001d025992 / +1 bp,-93 bp, and the coding sequence of the coding strand of the Zm00001d025992 / +1 bp,-93 bp gene is shown in SEQ ID No.

9.

4. The application of the method according to claim 2 or 3 in the preparation of maize mutant plants and / or breeding of maize kernel length and / or kernel weight traits.

Images