Cas protein mutant, fusion protein and application thereof in gene editing

Abstract

The invention relates to the technical field of biology, in particular to a Cas protein mutant, a fusion protein and application of the Cas protein mutant and the fusion protein in gene editing. The research finds that the Cas12h protease complex has the capability of specifically cutting a non-target chain (NTS) in double-stranded DNA in vitro, so that the open loop of the DNA double-stranded DNA is triggered. Based on the characteristic, the invention further develops a gene silencing function of Cas12h in vivo, and successfully realizes a silencing effect on transcription and expression of a specific gene in escherichia coli. Meanwhile, an adenine base editor based on Cas12h fusion protein is further developed, and accurate base conversion from A-T to G-C on the DNA level is successfully realized in escherichia coli cells by finely regulating and controlling growth conditions of the base editor, optimizing peptide connector design and reasonably constructing a fusion protein structure.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to Cas protein mutants, fusion proteins and their applications in gene editing. Background Art

[0002] Clustered regularly interspaced short palindromic repeats (CRISPR) and its associated proteins (Cas) systems, found in most bacterial and archaeal species, confer adaptive immunity against invading phages and plasmids, profoundly transforming biological and biomedical sciences. In recent years, the CRISPR-Cas toolbox has garnered widespread attention for applications in analytical and diagnostic assay development, demonstrating its powerful capabilities as a molecular machine for recognizing and manipulating nucleic acids. In recent years, CRISPR-enabled detection technologies have played a key role in clinical diagnostics, biosensing, and bioimaging. With the continuous development of CRISPR / Cas systems, they have become one of the most commonly used novel gene editing technologies due to their advantages, including ease of design, robust operability, high editing activity, and low cost. In particular, the effector proteins Cas9, Cas12, and Cas13 (corresponding to types II, V, and VI, respectively) within the two classes of CRISPR-Cas systems have been widely used in the field of gene editing. Upon binding to nucleic acid targets, these Cas nucleases are activated, resulting in distinct target cleavage mechanisms.

[0003] Although Cas9 and the currently widely used Cas12a (also known as a subtype of Cas12b) are functionally similar, they have different evolutionary histories and mechanistic properties. Cas9 of Streptococcus pyogenes recognizes the 5'-NGG-3' PAM (Protospacer Adjacent Motif) located downstream of the protospacer (NTS), while the ortholog of Cas12a used for genome editing recognizes the 5'-TTTV-3' PAM located upstream of the protospacer (NTS). In addition, Cas9 and Cas12a use different DNA cleavage mechanisms: Cas9 utilizes the HNH and RuvC domains to cleave the target strand (TS) and non-target strand (NTS), respectively, while Cas12a uses a single RuvC nuclease domain to cleave both strands of the target DNA, generating a PAM-distal double-strand break (DSB) with a large 5' overhang. Although both initially cleave the target double-stranded DNA (dsDNA) at a single site, they can both catalyze target end trimming in vitro to produce heterogeneous cleavage products. It is worth noting that Cas12a also exhibits two different DNA cleavage modes: in addition to cleaving dsDNA targets in cis in a crRNA-guided manner, it also has sequence-independent DNase activity that can cleave non-target single-stranded DNA in trans. This trans-acting nuclease activity is triggered by hybridization of crRNA with complementary target DNA chains.

[0004] V-type CRISPR-Cas systems are distinguished by a single RNA-guided effector protein, Cas12, which contains a RuvC domain at its carboxyl terminus. Cas12 effectors vary significantly in size, ranging from less than 500 amino acids to more than 1300 amino acids. Although the effectors of subtypes VA (Cas12a) and VB (Cas12b) have been intensively studied, the yet-to-be-identified different domains and RuvC sequences within the Cas12 protein exhibit rich functional diversity. In recent years, the V-type CRISPR-Cas system has continued to expand, with the discovery of many new subtypes and the continuous refinement of the related molecular mechanisms of action. Notably, while most V-type effectors have been extensively studied, the characterization of some subtypes remains lacking. Cas12h, an effector of the VH-type system, was first discovered in the metagenome of hypersaline lake sediments several years ago; however, its function remains poorly understood.

[0005] Base editing (BE) is a CRISPR-based precision gene editing technology pioneered in 2016 by Professor David Liu of the Broad Institute. Compared to traditional CRISPR-Cas9 gene editing technology, base editing can precisely modify single bases without cutting the DNA double strand. Therefore, it is considered a safer gene editing method and has demonstrated potential in clinical treatment for human genetic diseases and cancer.

[0006] As a new generation of gene editing tools after CRISPR-Cas9, base editing has shown its promising therapeutic effects in clinical studies. However, current base editing technology still faces some challenges. For example, existing base editors are relatively large and cannot be delivered using a single adeno-associated virus (AAV) vector. In addition, the types of base editing that these editors can perform are also limited. Although the Prime Editing (PE) subsequently developed by David Liu's team can theoretically achieve conversion between all base types, in actual applications, its performance at different genomic sites is highly variable, and the editing efficiency is usually significantly lower than that of traditional base editors. Therefore, it is still crucial to develop more types of efficient base editors. Summary of the Invention

[0007] In view of this, the present invention provides Cas protein mutants, fusion proteins and their applications in gene editing.

[0008] Cas12h protein mutants, comprising at least one mutation site among S93R, Y96R, Q139R, A104R, Y111R, A109R, T334R, P425R, E201R, E409R, S209R, D661R, S678R, T681R, A624R, Q619R, G252R, S526R, and K529R, and the wild-type amino acid sequence has the amino acid sequence shown in SEQ ID NO.1.

[0009] In some embodiments, the mutation sites include any one or more of A104R, E201R, G252R, S526R, and D661R; the plurality is two, three, four, or five.

[0010] The present invention carries out the mutation of the above sites on the basis of wild-type Cas12h protein (sequence is shown in SEQ ID NO.1).It is found that the gene editing effect of the mutant of the five single sites of A104R, E201R, G252R, S526R, D661R is better than WT.Based on these five mutation sites, the present invention also carries out double site mutation, three site mutation, four site mutation or five site mutation, and the editing effect of these mutants obtained is better than WT, wherein, the best effect is double site mutant E201R / G252R.

[0011] In the present invention, the Cas12h protein involved does not include a mutant of D465A (amino acid sequence as shown in SEQ ID NO.2), in which the nucleotide sequence of the mutant is mutated to "GCT" by the "GAT" at position 1393-1395 in the wild-type Cas12h nucleotide sequence. The present invention has found that the 465th aspartic acid of the Cas12h protein is replaced by alanine without corresponding nuclease activity, but after being fused with the ABEmax protein, it still has base editing activity, but the editing effect is very low.

[0012] The present invention also provides a fusion protein comprising an ABEmax protein and a Cas12h protein;

[0013] The Cas12h protein includes a wild-type Cas12h protein and a protein mutant as described above in the present invention.

[0014] In the present invention, the ABEmax protein is ABEmax (7.1), which has the amino acid sequence shown in SEQ ID NO. 22; or a sequence in which one or more amino acids are substituted, deleted, added or modified in the amino acid sequence shown in SEQ ID NO. 22; or a sequence having at least 70% homology with the sequence described in any of the preceding items.

[0015] In the present invention, the connection order of ABEmax protein and Cas12h protein affects the editing effect of the fusion protein. When the connection order of the two proteins is ABEmax-Cas12h, the editing effect of the editor is better, and the editing effect activity of the connection order of Cas12h-ABEmax is particularly low.

[0016] In the fusion protein of the present invention, the ABEmax protein and the Cas12h protein are connected by a linker. The present invention has found that the linker length has an important influence on the editing effect. When the linker length of the ABE-Cas12h base editor is 16aa or 32aa, the editing effect is best. In some embodiments, the linker has an amino acid sequence as shown in any one of SEQ ID NO.23-25.

[0017] In some specific embodiments, the fusion protein of the present invention has an amino acid sequence as shown in any one of SEQ ID NOs. 16-21; or a sequence in which one or more amino acids are substituted, deleted, added or modified in the amino acid sequence as shown in SEQ ID NO. 22; or a sequence having at least 70% homology with the sequence as described in any of the preceding items.

[0018] In some specific embodiments, the N-terminus of the fusion protein further includes a 3×Flag tag, and the C-terminus further includes a His tag.

[0019] Furthermore, the length of the His tag is 6 to 10 amino acids, specifically 6 His (SEQ ID NO. 26), 8 His, or 10 His.

[0020] The present invention also provides a biomaterial comprising any one of the following:

[0021] (1) a nucleic acid encoding the mutant of the present invention as described above and / or encoding the fusion protein of the present invention as described above;

[0022] (2) an expression cassette containing the nucleic acid described in (1);

[0023] (3) A recombinant vector containing the nucleic acid described in (1) or the expression cassette described in (2);

[0024] (4) Transfect or transform the host with the recombinant vector (3), or the host with the nucleic acid (1) or the expression cassette (2) integrated into its genome.

[0025] The present invention does not specifically limit the type of recombinant vector. Any vector commonly used in the art for nucleic acid expression, storage, and / or delivery can be used, including plasmid vectors, lentiviral vectors, or viral vectors. In some embodiments, the vector is a plasmid vector, including a PET series vector.

[0026] The nucleic acid of the present invention includes any nucleic acid capable of encoding the mutant, which may be a wild-type sequence encoding the mutant or a codon-optimized sequence. In the present invention, the nucleic acid sequence is optimized according to the codon preference of Escherichia coli.

[0027] In some specific embodiments, the codon-optimized nucleic acid encoding the wild-type Cas12h protein has a sequence as shown in SEQ ID NO.32, or a sequence in which one or more nucleotides are substituted, deleted, added or modified in the sequence shown in SEQ ID NO.32; or a sequence having at least 70% homology with the sequence as described in any of the preceding items.

[0028] In some specific embodiments, the CAS12H protein mutant is CAS12H(A104R), and the nucleic acid encoding the mutant after codon optimization is: as shown in SEQ ID NO:32, the 310th to 313th bases "GCT" are mutated to "CGT".

[0029] In some specific embodiments, the CAS12H protein mutant is CAS12H(E201R), and the nucleic acid encoding the mutant after codon optimization is: the 601-603 bases "GAA" of the nucleotide sequence shown in SEQ ID NO: 32 are mutated to "CGA".

[0030] In some specific embodiments, the CAS12H protein mutant is CAS12H(G252R), and the nucleic acid encoding the mutant after codon optimization is: as shown in SEQ ID NO:32, the 754th to 756th bases "GGT" are mutated to "CGT".

[0031] In some specific embodiments, the CAS12H protein mutant is CAS12H(S526R), and the nucleic acid encoding the mutant after codon optimization is: as shown in SEQ ID NO:32, the bases "AGC" at positions 1576 to 1578 are mutated to "AGA".

[0032] In some specific embodiments, the CAS12H protein mutant is CAS12H(D661R), and the nucleic acid encoding the mutant after codon optimization is: as shown in SEQ ID NO:32, the 1981-1983 bases "GAT" are mutated to "CGT".

[0033] In the present invention, mutants comprising two, three, four or five mutation sites among A104R, E201R, G252R, S526R and D661R, such as double mutation: A104R / E201R, A104R / G252R, A104R / S526R, A104R / D661R, E201R / G252R, E201R / S526R, E201R / D661R, G252R / S526R, G252R / D661R, S526R / D661R; triple mutation: A104R / E201R / G252R, A104R / E201R / S526R, A104R / E201R / D661R, A104R / G252R / S 526R、A104R / G252R / D661R、A104R / S526R / D661R、E201R / G252R / S526R、E201R / S526R / D661R、G252R / S526R / D661R;Four protrusions:A104R / E201R / G252R / S526R、A10 4R / E201R / G252R / D661R, A104R / E201R / S526R / D661R, A104R / G252R / S526R / D661R, E201R / G252R / S526R / D661R; Five protrusions: A104R / E201R / G252R / S526R / D661R. In the nucleic acid sequences encoding the above mutants, the codons for the amino acids at each mutation site are the same as those for A104R, E201R, G252R, S526R, and D661R described above. Taking the E201R / G252R mutant as an example, its nucleic acid sequence is as follows: as shown in SEQ ID NO: 32, bases "GAA" at positions 601 to 603 are mutated to "CGA", and bases "GGT" at positions 754 to 756 are mutated to "CGT".

[0034] In some specific embodiments, the fusion protein is ABE-Cas12h-his (32aa linker), and the nucleic acid encoding the fusion protein after codon optimization is: having a sequence as shown in SEQ ID NO.33, or a sequence in which one or more nucleotides are replaced, deleted, added or modified in the sequence shown in SEQ ID NO.33; or having a sequence having at least 70% homology with the sequence as described in any of the preceding items.

[0035] The expression cassette of the present invention further comprises a promoter and / or a terminator. Preferably, the promoter comprises a T7 or PBAD promoter. Preferably, the terminator comprises but is not limited to a T7 terminator.

[0036] The present invention also provides the use of any of the following in preparing a gene editing system:

[0037] (1) a protein mutant or wild-type Cas12h protein as described above;

[0038] (2) the fusion protein of the present invention as described above;

[0039] (3) the biomaterial of the present invention;

[0040] The gene editing system is a base editor comprising a CRISPR-Cas system and adenosine deaminase.

[0041] The CRISPR-Cas system includes a wild-type Cas12h protein or a Cas12h protein mutant as described above, and crRNA.

[0042] The present invention also provides a composition for gene editing, also known as a gene editing system, or a base editor based on a CRISPR-Cas system, which includes Cas12h protein, adenosine deaminase and crRNA; or its encoding nucleic acid. In the composition of the present invention, Cas12h protein (including wild-type Cas12h protein or Cas12h protein mutant of the present invention) and adenosine deaminase can be fused and expressed or independently expressed before mixing. The present invention is preferably fused expression, that is, the Cas12h protein and adenosine deaminase exist in the form of a fusion protein, specifically a fusion protein as described above. In some preferred embodiments, the composition of the present invention (or base editor) includes a fusion protein and crRNA as described above, or includes a nucleic acid encoding the fusion protein and a nucleic acid encoding the crRNA.

[0043] In the above composition of the present invention, the crRNA includes:

[0044] A spacer segment complementary to the target nucleic acid,

[0045] And, a repeat segment that binds to a wild-type Cas12h nucleic acid or a nucleic acid encoding a mutant described in the present invention.

[0046] In some embodiments, the sequence of the repeat segment is selected from any one of the following (1) to (3):

[0047] (1) The nucleotide sequence shown in any one of SEQ ID NOs. 3-15;

[0048] (2) A nucleotide sequence having the same or similar function as (1) obtained by substituting, deleting, adding or modifying one or more nucleotides in the nucleotide sequence shown in (1);

[0049] (3) a nucleotide sequence having at least 70% homology to the nucleotide sequence shown in (1) or (2);

[0050] Preferably, the plurality is 2 to 10.

[0051] In the crRNA of the present invention, the length of the spacer segment complementary to the target nucleic acid is 10-30 nt, specifically 10 nt, 15 nt, 20 nt, 25 nt, or 30 nt.

[0052] The present invention also provides a complex for gene editing, including complex 1 or complex 2;

[0053] The complex 1 is a complex formed by Cas12h protein and crRNA;

[0054] The Cas12h protein is a wild-type Cas12h protein or a Cas12h protein mutant according to the present invention;

[0055] The compound 2 is: a complex formed by the fusion protein of the present invention and crRNA;

[0056] The crRNA is selected from the crRNA in the composition for gene editing as described above.

[0057] The present invention also provides the use of the composition for gene editing or the complex in preparing gene editing products.

[0058] The present invention also provides a gene editing method, which comprises transforming a recombinant vector into a cell;

[0059] The recombinant vector is the recombinant vector in the biomaterial of the present invention;

[0060] Alternatively, the CRISPR-Cas system, base editor, or complex of the present invention may be used to perform gene editing on cells, wherein the gene editing includes gene knockout, gene silencing, gene replacement, gene insertion, and the like.

[0061] The present invention achieves the goal of improving base editing efficiency and accuracy by carefully adjusting the temperature conditions of the base editor at specific growth stages and precisely controlling the time window of the editing process. In some embodiments, the base editing temperature is 15-40°C, preferably 25-37°C.

[0062] The present invention provides a novel CRISPR-Cas effector protein, i.e., Cas12h mutant. The protease complex has the ability to specifically cut the non-target strand (NTS) in double-stranded DNA in vitro, thereby triggering the opening of double-stranded DNA. Based on this characteristic, we further developed the gene silencing function of Cas12h in vivo, and successfully achieved the silencing effect of transcription and expression of specific genes in Escherichia coli. At the same time, the present invention also develops an adenine base editor based on Cas12h fusion protein, and by finely regulating the growth conditions of the base editor, optimizing the peptide connector design, and rationally constructing the fusion protein structure, it is successful to achieve the precise base conversion of AT to GC on the DNA level in Escherichia coli cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 Figure 1: Co-expression and identification of Cas12h and pre-crRNA in Escherichia coli. A: Schematic diagram of in vivo co-expression of Cas12h and pre-crRNA. B: Purification and identification of the Cas12h-crRNA complex by gel filtration chromatography. The complex was separated using a Superdex 200Increase 10 / 300 column, and the peak fractions were analyzed by SDS-PAGE and TBE-ureaPAGE to estimate the size of the protein and RNA components.

[0064] Figure 2 Figure 2A is a schematic diagram of pre-crRNA and the results of in vitro processing of pre-crRNA by Cas12h, where 2B is the in vitro processing of pre-crRNA by Cas12h. Denaturing gel shows that wild-type Cas12h (left) effectively processes pre-crRNA, while dCas12h (right) has no in vitro processing activity of pre-crRNA; M represents marker. 2C shows the effect of metal ions on the Cas12h processing of pre-crRNA.

[0065] Figure 3 3A is the ability of Cas12h to cleave dsDNA on supercoiled plasmid substrates; 3B is the processing of target DNA by Cas12h: Sanger sequencing results.

[0066] Figure 4Cas12h interferes with the expression of RFP protein in Example 5; A is the experimental process of Escherichia coli RFP fluorescence interference assay; B is: after serial dilution, the colony growth of FnCas12a / HiCas12h / dHiCas12h on plates containing kanamycin, chloramphenicol and no antibiotics; C is the CFU per milliliter of FnCas12a and Cas12h. D is the result of the Kan / Chl colony growth experiment corresponding to Figure B under red fluorescence imaging.

[0067] Figure 5 In Example 5, HiCas12h targeting the ori replication origin can inhibit DNA replication, wherein A: schematic diagram of HiCas12h binding site in vivo; B: comparison of colony growth after dilution of Cas12h / d Cas12h.

[0068] Figure 6 Figure 5 shows the gene silencing of RFP mediated by Cas12h in Example 5; wherein, A is a schematic diagram of the binding site of Cas12h in vivo; B: changes in the intracellular RFP fluorescence level when Cas12h / d Cas12h targets different locations.

[0069] Figure 7 Verification of the editing effect of the base editor constructed by Cas12h and adenosine deaminase in prokaryotic cells in Example 6; A is a schematic diagram of the Cas12h adenine base editor; B: Sanger sequencing results after successful editing of the target DNA by the Cas12h adenine base editor.

[0070] Figure 8 The structural optimization of the fusion protein and its editing effect in Example 7; A: Schematic diagram of the structural optimization of the Cas12h adenine base editor fusion protein. B: The result of the colony forming units (CFU) formed per milliliter of bacterial solution on the chloramphenicol plate after the fusion protein structure was optimized.

[0071] Figure 9 The effects of fusion protein structure and growth temperature on the editing performance of the editor in Example 8; A: Schematic diagram of the optimization of the fusion protein structure based on the Cas12h adenine base editor; B: Based on the T7_ABE_Cas12h-his base editor, the effect of temperature optimization on the editor performance is demonstrated, and the numerical value represents the CFU value of colony growth per milliliter of bacterial liquid on the chloramphenicol plate; C: The effect of different tags on the fusion protein on the base editor.

[0072] Figure 10 The effects of different single mutation sites on the editing effect of base editors.

[0073] Figure 11After multiple site mutations, the impact of different mutation sites on the editing effect of base editors. DETAILED DESCRIPTION

[0074] The present invention provides Cas protein mutants, fusion proteins and their applications in gene editing. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters for implementation. It should be noted in particular that all similar replacements and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0075] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0076] Compared with the currently commonly used base editing tools Cas9 and Cas12a effectors (about 1,300 amino acids in size), the effector Cas12h involved in the present invention is significantly smaller, containing only 870 amino acids. This feature makes Cas12h more conducive to delivery via AAV vectors. In addition, the Cas9 based on Streptococcus pyogenes gene editing recognizes the 5'-NGG-3'PAM (Protospacer Adjacent Motif) downstream of the original spacer adjacent sequence (NTS), while the Cas12a ortholog used for gene editing recognizes the 5'-TTTV-3'PAM upstream of the NTS. In contrast, the Cas12h involved in the present invention recognizes the 5'-RTR-3'PAM (R is A or G) downstream of the NTS. This PAM sequence has higher flexibility than 5'-NGG-3'PAM and 5'-TTTV-3'PAM, thereby greatly expanding the range of recognition sites for base editing PAM.

[0077] The present invention fills the gap in the function and application of the new protein Cas12h in the CRISPR-Cas system, especially for the development of the Cas12h adenine base editor, and expands the application of the CRISPR-Cas system in gene silencing. Specifically, the present invention develops a new type of CRISPR-Cas protein, namely the Cas12h mutant. The protease complex has the ability to specifically cut the non-target strand (NTS) in double-stranded DNA in vitro, thereby triggering the opening of the DNA double strand. Based on this characteristic, we further developed the gene silencing function of Cas12h in vivo, and successfully achieved the silencing effect on the transcription and expression of specific genes in Escherichia coli. At the same time, the present invention also develops an adenine base editing technology based on Cas12h fusion protein, which successfully achieves the precise base conversion of AT to GC on the DNA level in Escherichia coli and mammalian cells by finely regulating the growth conditions of the base editor, optimizing the peptide linker design and rationally constructing the fusion protein structure.

[0078] The present invention provides a novel VH-type CRISPR-Cas system, which comprises an effector protein Cas12h and crRNA; the Cas12h amino acid sequence is SEQ ID NO.1; the repeat segment of the crRNA comprises a nucleotide sequence shown in any one of SEQ ID NO.3-15 or a nucleotide sequence having 1 to 10 nucleotide substitutions, deletions and / or insertions compared with the nucleotide sequence.

[0079] The crRNA and the Cas12h can bind to form a stable complex; and the Cas12h can bind to the target nucleic acid through the guidance of the crRNA; an amino acid sequence having at least 70% sequence identity compared to the Cas12h amino acid sequence; the sequence of the crRNA repeat segment is as shown in any one of SEQ ID NO.3-15, or a nucleotide sequence having 1 to 10 nucleotide substitutions, deletions and / or insertions therein; the spacer segment of the crRNA comprises a length of 10-30 nt that hybridizes with the target nucleic acid; the Cas12h effector protein is Cas12h (HiCas12h) from the hypersaline lake sediment metagenome;

[0080] The Cas12h enzyme provided by the present invention exhibits the ability to precisely process the precursor CRISPR RNA (pre-crRNA) and successfully convert it into mature crRNA. This discovery proves that Cas12h has RNA enzyme activity. More importantly, the enzymatic reaction requires the catalytic action of metal ions to proceed smoothly; preferably, Cas12h relies on the metal ion Mg for pre-crRNA. 2+ 、Zn2+ and Mn 2+ .

[0081] The present invention provides a complex comprising the Cas12h according to claim 1 and crRNA, wherein the Cas12h binds to the crRNA after expression; the complex is an in vivo gene silencing tool, and through the guidance of crRNA, Cas12h can bind to the target nucleic acid in vivo and hinder the transcription and replication of the target nucleic acid;

[0082] The Cas12h comprises an amino acid sequence shown in any one of SEQ ID NO.1-2, an amino acid sequence having at least 70% sequence identity compared to the sequence; the crRNA comprises a spacer segment that hybridizes with the target nucleic acid and a repeat segment that binds to Cas12h, and the crRNA does not contain and does not bind to other non-coding RNAs; wherein the repeat segment of the crRNA comprises a nucleotide sequence shown in SEQ ID NO.3-15 or a nucleotide sequence having 1 to 10 nucleotide substitutions, deletions and / or insertions compared to the nucleotide sequence; preferably, the repeat segment of the crRNA comprises or is a nucleotide sequence shown in any one of SEQ ID NO.3-15; preferably, the spacer segment of the crRNA comprises a length of 10-30 nt that hybridizes with the target nucleic acid.

[0083] Cas12h hinders DNA replication in vivo. Specifically, the Cas12h provided by the present invention can bind to DNA in vivo, but does not have the ability to cut DNA in vivo. By targeting a specific DNA sequence, Cas12h can bind to DNA, thereby hindering the replication and transcription process of DNA.

[0084] The present invention provides a fusion protein comprising ABEmax (7.1) and Cas12h protein. The Cas12h protein comprises an amino acid sequence having at least 70% sequence identity compared to the amino acid sequence shown in SEQ ID NO.1-2; the ABE max (7.1) comprises an amino acid sequence having at least 70% sequence identity compared to the amino acid sequence shown in SEQ ID NO.22; and the fusion protein comprises or is the amino acid sequence shown in any one of SEQ ID NO.16-21.

[0085] Preferably, the fusion protein includes an adenosine deaminase domain, the adenosine deaminase domain is selected from SEQ ID NO.22, and the fusion protein comprises an adenosine deaminase domain, Cas12h, a linker or a combination thereof; the linker polypeptide contained therein links ABEmax (7.1) and Cas12h proteins, and the linker sequence is shown in SEQ ID NO.23-25.

[0086] A fusion protein, wherein the Cas12h is connected to the amino acid sequence of SEQ ID NO: 22 at its C-terminus and / or its N-terminus through SEQ ID NO: 23-25. The fusion protein comprises an adenosine deaminase domain, Cas12h, a linker, 3x Flag, His or a combination thereof; preferably, the Cas12h is connected to the amino acid sequence of SEQ ID NO: 12 at its C-terminus and / or its N-terminus through SEQ ID NO: 23-25.

[0087] The fusion protein of the present invention is regulated by different promoters. The promoters include T7 or PBAD promoters. Preferably, the promoter is T7 promoter.

[0088] In a preferred embodiment, the structure of the expression cassette comprising the fusion protein is selected from any one of the following:

[0089] PBAD-NH2-[Cas12h]-[16aa linker]-[ABE max7.1]-COOH;

[0090] PBAD-NH2-[Cas12h]-[32aa linker]-[ABE max7.1]-COOH;

[0091] PBAD-NH2-[Cas12h]-[64aa linker]-[ABE max7.1]-COOH;

[0092] PBAD-NH2-[ABE max7.1]-[16aa linker]-[Cas12h]-COOH;

[0093] PBAD-NH2-[ABE max7.1]-[32aa linker]-[Cas12h]-COOH;

[0094] PBAD-NH2-[ABE max7.1]-[64aa linker]-[Cas12h]-COOH;

[0095] T7-NH2-[ABE max7.1]-[16aa linker]-[Cas12h]-COOH;

[0096] T7-NH2-[ABE max7.1]-[32aa linker]-[Cas12h]-COOH;

[0097] T7-NH2-[ABE max7.1]-[64aa linker]-[Cas12h]-COOH;

[0098] T7-NH2-[ABE max7.1]-[16aa linker]-[Cas12h-His]-COOH;

[0099] T7-NH2-[ABE max7.1]-[32aa linker]-[Cas12h-His]-COOH;

[0100] T7-NH2-[ABE max7.1]-[64aa linker]-[Cas12h-His]-COOH;

[0101] T7-NH2-[Flag]-[ABE max7.1][16aa linker]-[Cas12h]-COOH;

[0102] T7-NH2-[Flag]-[ABE max7.1][32aa linker]-[Cas12h]-COOH;

[0103] T7-NH2-[Flag]-[ABE max7.1][64aa linker]-[Cas12h]-COOH;

[0104] T7-NH2-[Flag]-[ABE max7.1][16aa linker]-[Cas12h-His]-COOH;

[0105] T7-NH2-[Flag]-[ABE max7.1][32aa linker]-[Cas12h-His]-COOH;

[0106] T7-NH2-[Flag]-[ABE max7.1][64aa linker]-[Cas12h-His]-COOH.

[0107] In the above structure, [Flag] represents a 3×Flag tag sequence; His represents a His tag, whose sequence is 6×His.

[0108] The present invention provides a complex comprising the fusion protein and crRNA; the fusion protein binds to the crRNA after expression; preferably, the crRNA comprises a spacer segment hybridizing with the target nucleic acid and a repeat segment binding to Cas12h, and the crRNA does not contain and does not bind to other non-coding RNAs; preferably, the repeat segment of the crRNA comprises the nucleotide sequence shown in SEQ ID NO.3-15 or a nucleotide sequence having 1 to 10 nucleotide substitutions, deletions and / or insertions compared with the nucleotide sequence; preferably, the repeat segment of the crRNA comprises or is the nucleotide sequence shown in any one of SEQ ID NO.3-15; preferably, the fusion protein comprises SEQ ID NO.16-21; more preferably, the fusion protein comprises SEQ ID NO.19-21, using a T7 promoter, wherein the fusion protein comprises an adenosine deaminase domain, Cas12h, a linker, 3×Flag, His or a combination thereof.

[0109] The present invention provides a fusion protein comprising ABEmax (7.1) and a Cas12h mutant protein. The Cas12h mutant comprises mutations at the following sites: S93R, Y96R, Q139R, A104R, Y111R, A109R, T334R, P425R, E201R, E409R, S209R, D661R, S678R, T681R, A624R, Q619R, G252R, S526R, K529R. Preferably, the mutants of the five single-site mutants A104R, E201R, G252R, S526R, and D661R are all better than WT. Based on these five mutation sites, double, triple and multiple mutations were performed, such as double mutation: A104R / E201R, A104R / G252R, A104R / S526R, A104R / D661R, E201R / G252R, E201R / S526R, E201R / D661R, G252R / S526R, G252R / D661R, S526R / D661R; triple mutation: A104R / E201R / G252R, A104R / E201R / S526R, A104R / E201R / D661R, A104R / G252R / S526R, A104R / G252R / D661R, A104R / S526R / D661R, E201R / G252R / S526R, E201R / S526R / D661R, G252R / S526R / D661R; Four-protuberance: A104R / E201R / G252R / S526R, A104R / E201R / G252R / D661R, A104R / E201R / S526R / D661R, A104R / G252R / S526R / D661R, E201R / G252R / S526R / D661R; Five-protuberance: A104R / E201R / G252R / S526R / D661R. The results showed that the base editing effects of the double, triple, quadruple, and pentamutants obtained based on the five mutation sites were all better than those of the WT. Among them, the Cas12h fusion protein containing the double mutation E201R / G252R had the best base editing effect.

[0110] The present invention proposes a gene editing method for the growth temperature and editing time of an adenine base editor based on a Cas12h fusion protein. This method achieves the purpose of improving the efficiency and accuracy of base editing by carefully adjusting the temperature conditions of the editor at a specific growth stage and accurately controlling the time window of the editing process. The fusion protein provided by the present invention forms a base editor after being expressed in vivo and binding to crRNA, targeting a specific sequence, performing base editing on the specific sequence, and realizing accurate base conversion from AT to GC at the DNA level. The temperature of the base editing is 15 to 40°C; preferably, the temperature of the base editor reaction is 25 to 37°C.

[0111] The present invention provides a VH type CRISPR-Cas12h system. Experiments show that the protein has RNA enzyme binding activity and can cut pre-crRNA in vitro to form mature and stable crRNA. Cas12h forms a stable complex with crRNA, and the protease complex has the ability to specifically cut the non-target chain (NTS) in double-stranded DNA in vitro, thereby triggering the opening of the DNA double strand. Based on this characteristic, we further developed the gene silencing function of Cas12h in vivo, and successfully achieved the silencing effect on the transcription and expression of specific genes in Escherichia coli. In addition, the protein can be combined with the adenosine deaminase domain (ABE max (7.1)) to form a base editor. By finely regulating the growth conditions of the base editor, optimizing the peptide connector design, and rationally constructing the fusion protein structure, the precise base conversion of AT to GC at the DNA level was successfully achieved in Escherichia coli cells.

[0112] In the present invention, "including", "comprising", and "having" are used interchangeably to indicate the inclusiveness of the solution, meaning that the solution may contain other elements in addition to the listed elements. It should also be understood that the use of "including", "comprising", and "having" in this document also provides "consisting of" solutions.

[0113] In the present invention, "at least one" means one or more, and "plurality" means two or more. "At least one," "at least one item," or similar expressions refer to any combination of these items, including any combination of single or plural items.

[0114] In the present invention, when used herein, "and / or" includes the meanings of "and", "or" and "all or any other combinations of elements linked by the corresponding terms".

[0115] In the amino acid sequences and nucleotide sequences of the present invention, the at least 90% identity refers to sequences with at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, at least 99.5% identity, at least 99.6% identity, at least 99.7% identity, at least 99.8% identity, and at least 99.9% identity.

[0116] The sequence information involved in the present invention is as follows:

[0117] Table 1

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128] The present invention will be further described below in conjunction with the embodiments:

[0129] Example 1: Expression and purification of Cas12h protein and Cas12h-crRNA complex

[0130] The full-length Cas12h gene and CRISPR array were synthesized by SYNBIOB gene. To purify the Cas12h protein, the full-length wild-type (WT) Cas12h and its mutant genes were cloned into a modified pET22b vector with a C-terminal His6 tag using a one-step cloning kit. Cas12h and its mutants were overexpressed in Escherichia coli BL21 (DE3), and the strains were grown in LB supplemented with antibiotics. 0.1mM isopropyl-1-thio-β-d-galactopyranoside (IPTG) was used at 16°C with an OD of 0. 600The cells expressing Cas12h or Cas12h mutants were collected and lysed by ultrasound in a buffer consisting of 20mM Tris-HCl (pH 7.5), 1mNaCl and 10% (v / v) glycerol. After centrifugation, the supernatant was incubated with Ni Sepharose (GE Healthcare). The bound protein was eluted with a buffer containing 20mMTris-HCl (pH 7.5), 1M NaCl, 10% (v / v) glycerol and 300mM imidazole. The purified Cas12h protein was stored in a buffer containing 20mM Tris-HCl (pH 7.5), 1MNaCl, 10% (v / v) glycerol and 3mM dithiothreitol (DTT) and stored at -80°C.

[0131] To purify the Cas12h-crRNA complex, Cas12h (or its mutants) and 12h CRISPR array vector were co-expressed in Escherichia coli BL21 (DE3) at OD 600 When the pH value is 0.8, 0.1 mM IPTG is used to induce at 16 ° C for 14 hours. Cells containing expressed Cas12h (or its mutants) and corresponding crRNA are collected and lysed by ultrasound in a buffer containing 20 mM Tris-HCl (pH 7.5), 500 mM NaCl and 10% (v / v) glycerol. After centrifugation, the supernatant is incubated with Ni Sepharose (GE Healthcare). The bound protein is eluted with a buffer consisting of 20 mM Tris-HCl (pH 7.5), 300 mM NaCl, 10% (v / v) glycerol and 300 mM imidazole. The co-purified protein is further purified with a heparin column (GE Healthcare) and eluted with a buffer containing 20 mM Tris-HCl (pH 7.5), 300 mM NaCl and 10% (v / v) glycerol. Finally, additional purification was performed using size exclusion chromatography (Superdex 200, GE Healthcare) using a buffer containing 20 mM Tris-HCl (pH 7.5), 300 mM NaCl, 10% (v / v) glycerol, and 3 mM DTT. The Cas12h-crRNA complex was expressed and purified according to the above steps, and the SDS-PAGE electrophoresis results were consistent with expectations, and the TBE-ureaPAGE results were consistent with expectations.

[0132] The Cas12h protein sequence is as SEQ ID NO.1.

[0133] The sequence synthesized by the 12h CRISPR array is as follows:

[0134] 5'-TTAATACGACTCACTATAGGTGCTGGCCGCTCTCGCTAGAGGGAG GTCAGAGCACGCTGCAAACAGACCAAGCCTTGCCGTGAATGCCGCTGG TGCTGGCCGCTCTCGCTAGAGGGAGGTCAGAGCACGCTGCAAACAGAC CAAGCCTTGCCGTGAATGCCGCTGGTGCTGGCCGCTCT-3' (SEQ ID NO. 34).

[0135] Example 2: Cas12h cleavage of pre-crRNA

[0136] To verify the RNase activity of Cas12h, we used Figure 2 The pre-crRNA sequence shown in A was synthesized by Sangon Biotech (Shanghai) Co., Ltd. Cas12h was overexpressed in Escherichia coli and purified by affinity column chromatography. The pre-crRNA sequence is as follows (SEQ ID NO. 30):

[0137] 5'-FAM-GUGCUGGCCGCUCUCGCUAGAGGGAGGUCAGAGCACGCU GCAAACAGACCAAGCCUUGCCGUGAAUGCCGCUGGUGCUGGCCGCUC UC-3'

[0138] In a buffer system containing 20mM Tris-HCl (pH 7.5), 300mM NaCl, 10% glycerol, and 10mM MgCl2, pre-crRNA (concentration of 250nM) was mixed with Cas12h (concentration of 500nM) and incubated at 37°C for 0 to 90 minutes in a 10μl reaction system. After 90 minutes, the reaction was terminated by adding 8M urea and 0.5M EDTA, and the terminated sample was subjected to 20% urea polyacrylamide gel electrophoresis (running at 530V voltage for 1.5 hours), and finally placed under an imager for imaging and analyzed using gel imaging technology.

[0139] Urea polyacrylamide gel electrophoresis can be used for electrophoretic analysis of nucleic acids (especially RNA) and separation according to the molecular size of nucleic acids. Through urea polyacrylamide gel electrophoresis analysis, it can be clearly observed that pre-crRNA is effectively cut by Cas12h, which is manifested as a change in the length of the nucleic acid fragment labeled with FAM fluorescent dye at the 5' end ( Figure 2B left). The key active catalytic site of Cas12h was mutated, i.e. dCas12h (i.e. D465A mutant). After the mutation, the length of the nucleic acid fragment labeled with FAM fluorescent dye at the 5' end did not change ( Figure 2 (B, right) Experimental results show that Cas12h can effectively process pre-crRNA, but when its active site mutates, it loses this processing ability.

[0140] Example 3: Effect of metal ions on pre-crRNA cleavage

[0141] To verify the effect of metal ions on Cas12h RNase activity, we also used the pre-crRNA sequence shown in Figure 2A, which was synthesized by Sangon Biotech (Shanghai) Co., Ltd. Cas12h was overexpressed in Escherichia coli and purified by affinity column chromatography.

[0142] Pre-crRNA (250nM) and Cas12h (500nM) were added to a buffer solution (20mMTris-HCl (pH 7.5), 300mM NaCl, 10% glycerol), 10mM of different metal ions were added to the buffer solution, and the mixture was incubated at 37°C for 30 minutes. The reaction system was 10μl. After 30 minutes, 8M urea and 0.5M EDTA were added to terminate the reaction. The terminated sample was subjected to 20% urea polyacrylamide gel electrophoresis (running at 530V for 1.5 hours), and finally placed under an imager for imaging and analyzed using gel imaging technology. Figure 2 C results show that the reaction is in the presence of metal ions Mg 2+ Under the action of , a stable and single mature crRNA can be formed. 2+ , Ca 2+ 、Ni 2+ 、Co 2+ Metal ions such as Zn cannot effectively catalyze the reaction; 2+ and Mn 2+ Although it can promote the reaction to a certain extent, it is accompanied by the generation of non-specific bands. EDTA was used as a control. EDTA is a metal ion chelator that can prevent metal ions from participating in the reaction. The EDTA group did not cause Cas12h to process pre-crRNA, indicating that Cas12h processing of pre-crRNA requires the participation of metal ions and that enzyme activity depends on Mg. 2+ 、Zn 2+ and Mn 2+ Participate in catalysis.

[0143] Example 4: DNA cleavage performance of Cas12h-crRNA complex in vitro

[0144] The Cas12h-crRNA complex developed in this paper has the ability to precisely locate the target DNA. Guided by the crRNA spacer region, the Cas12h-crRNA complex locates to the target nucleic acid, causing double-stranded DNA looping (Fig. 3.A / BC). This finding strongly proves that Cas12h has DNA nickase activity.

[0145] In order to verify the DNA enzyme activity of Cas12h, that is, its processing efficiency on target DNA, we designed the following experimental process: Figure 3 As shown in A, the target DNA (SEQ ID NO.30) was inserted into the plasmid vector pUC19 using DNA primers. The resulting plasmid was transformed into Escherichia coli DH5α and purified using a plasmid extraction kit. The Cas12h-crRNA protein complex was obtained by overexpressing Cas12h and crRNA in Escherichia coli and then purifying it by affinity column chromatography. The target sequence was complementary to the spacer region sequence of crRNA.

[0146] The template vector (20 ng / μl) was incubated with the Cas12h-crRNA protein complex (0-100 nM) at 37 ° C for 30 minutes. The experiment was performed in a 0.2 ml PCR tube with a total reaction volume of 10 μl. The reaction buffer consisted of 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% (v / v) glycerol, 3 mM DTT, and 10 mM MgCl2. The reaction was terminated after 30 minutes by adding DNA loading buffer. The reaction samples were analyzed by 1.5% agarose gel electrophoresis and imaged using a gel imager.

[0147] The results showed that Cas12h can effectively process the target DNA on the plasmid ( Figure 3 A), processing the supercoiled plasmid DNA into an open circular plasmid. To further verify the accuracy of the processing results, we recovered the sample solution and performed Sanger sequencing. The sequencing results showed that the 17th nucleotide of the NTS sequence was processed ( Figure 3 B).

[0148] The above experimental results fully demonstrate the excellent performance of Cas12h developed in the present invention in DNA nickase activity, providing powerful tool support for subsequent gene editing and biological science research.

[0149] Example 5: Cas12h can inhibit gene expression in vivo but cannot cut dsDNA

[0150] The CRISPR-Cas12h system only exhibits nickase activity targeting dsDNA, but does not have the ability to cleave targeted dsDNA. Taking advantage of this feature, although Cas12h functions as a DNA nickase, it has the specific DNA targeting ability guided by crRNA, which can inhibit RNA transcription and thus silence gene expression.

[0151] The present invention provides a method for Cas12h to hinder DNA replication and RNA transcription in vivo. Specifically, the Cas12h provided by the present invention can bind to DNA in vivo, but does not have the ability to cut DNA. By targeting a specific DNA sequence, Cas12h can bind to DNA, thereby hindering the DNA replication process.

[0152] First, a plasmid carrying p15A_pBAD_Cas12h_crRNA (containing kanamycin gene) and pTarget-RFP (containing chloramphenicol resistance gene) was constructed and co-transfected into Escherichia coli BL21 (DE3). Subsequently, the cells were cultured on agar plates containing kanamycin and chloramphenicol to screen out strains that had successfully transferred the plasmid. After a period of cultivation, the strain was inoculated into 5 ml of LB medium containing kanamycin and chloramphenicol, and the culture was kept at 37 ° C overnight. Subsequently, 50 μl of the culture was transferred to 5 ml of antibiotic-free medium, and 20 mM L-ara was added to induce the expression of Cas12h, and the culture was continued at 37 ° C for 10 hours. After 10 hours of induction, the cells were serially diluted and stained on plates containing kanamycin, chloramphenicol and antibiotic-free plates, as shown in the schematic diagram. Figure 4 As shown in A.

[0153] 1. FnCas12a (Francisella novicida U112 Cas12a) nuclease and active mutant dCas12h variants are provided for reference. The results showed that the CRISPR-Cas12a system can significantly inhibit the growth of E. coli cells when the target DNA sequence is present in the chloramphenicol-resistant plasmid. The FnCas12a nuclease provides effective plasmid interference for the tested target in E. coli, resulting in nucleic acid cleavage and thus unable to grow on chloramphenicol-resistant plates ( Figure 4 B, C) and RFP cannot be expressed normally ( Figure 4 D). Compared with FnCas12a, plasmid interference was also observed in Cas12h. The target of Cas12h is located in the RFP gene. Cas12h can bind to the RFP gene in vivo, resulting in abnormal expression of fluorescent protein ( Figure 4 D), but by comparing the non-antibody plate and the Kan / Chl plate, it can be seen that although Cas12h affects the expression of RFP, it does not affect the growth of cells ( Figure 4(B, C) This indicates that Cas12h can bind to but not cut dsDNA in vivo, and that Cas12h inhibits RFP expression by binding to target DNA.

[0154] 2. In E. coli, the plasmids carrying p15A_pBAD_HiCas12h_crRNA (containing kanamycin gene) and pTarget-RFP (containing chloramphenicol resistance gene) were co-transfected into E. coli BL21 (DE3). HiCas12h_crRNA can target different positions ( Figure 4 A), other processes are the same Figure 4 As shown in Figure A. When the Cas12h target is located at ori, the number of E. coli grown decreases. ori is the replication initiation site of prokaryotic gene plasmids. Targeting ori will hinder plasmid replication and affect pTarget-RFP replication. When Cas12h targets the RFP gene or the NES (non-essential sequence) gene, cell growth is not affected, indicating that Cas12h mediates plasmid interference by hindering plasmid replication initiation or acting as an obstacle to the transcription of essential selection marker genes ( Figure 5 B).

[0155] 3. In E. coli, we constructed a system to express the Cas12h-crRNA / dCas12h-crRNA complex and targeted different locations of the RFP gene ( Figure 6 A). By evaluating changes in RFP fluorescence levels within cells, we can determine the inhibitory effect of Cas12h on the transcription process. The experimental results showed that when Cas12h targeted the promoter region or coding region of the RFP gene, the expression level of RFP decreased, while targeting the transcription terminator region had no significant effect on fluorescence. These results provide evidence that the CRISPR-Cas12h system silences gene expression by inhibiting mRNA transcription ( Figure 6 B).

[0156] Table 2 Target sequences on the RFP gene involved in Example 5

[0157]

[0158] Example 6: Verification of the editing effect of the base editor constructed by Cas12h and adenosine deaminase in prokaryotic cells

[0159] We conducted a chloramphenicol resistance recovery test on the Escherichia coli BL21 (DE3) strain, which carries two key plasmids: one is the plasmid encoding ABE_12h_crRNA, which also has an ampicillin resistance gene; the other is the p-target plasmid, which contains a prematurely terminated chloramphenicol resistance gene and a normally expressed streptomycin resistance gene. ABE_12h_crRNA and p-target were then co-transformed into Escherichia coli BL21 (DE3) and cultured on agar plates containing ampicillin and chloramphenicol to screen out strains that successfully transferred the two plasmids. After the transformation operation was completed, we picked a single colony from the transformation system and placed it in LB medium containing ampicillin and streptomycin, and cultured it overnight at 37°C. Next, we diluted the cells 100 times in LB medium and continued to culture until OD 600 The value reached 0.4. At this time, we added 0.2mM IPTG to induce the expression of the fusion protein and continued to culture the cells overnight at 30°C and 200rpm. To ensure the continued growth and editing activity of the cells, we diluted the bacterial solution at a ratio of 1:100 every 12 hours and replaced it with fresh culture medium containing ampicillin, streptomycin and 0.2mM IPTG. After 0-72 hours of culture, we diluted the cells 10 times in succession and inoculated them on culture plates without antibiotics and culture plates containing chloramphenicol, and incubated them at 37°C overnight. To evaluate the base editing activity in vivo, we calculated the number of cells per milliliter at OD 600 The CFU number at a value of about 1.5 was calculated and Sanger sequencing was performed. At the same time, we evaluated the editing efficiency by comparing the number of colonies grown on antibiotic-free culture plates with the number of colonies grown on chloramphenicol culture plates. Figure 7 As shown in A.

[0160] After performing chloramphenicol resistance recovery experiments at three different sites, sequencing results showed that all three sites exhibited editing activity (e.g. Figure 7 This result not only verifies the editing ability of ABE_12h_crRNA in E. coli BL21 (DE3) strain, but also provides strong support for our further exploration of the application of base editing technology.

[0161] ABE Target1:5'-ACCGTTGATATATCCTAATGG-3' (SEQ ID NO.48);

[0162] ABE Target2:5'-TCCCAATGGCATtGaAAAGAA-3' (SEQ ID NO.49);

[0163] ABE Target3:5'-AATGTACCTATAACtAGACCG-3' (SEQ ID NO.50);

[0164] Example 7: Optimization of linker length and fusion protein structure of Cas12h adenine base editor

[0165] We adopted a series of strategies to optimize the linker length and fusion protein structure of Cas12h adenine base editor. The experimental method is the same as that in Example 6. Target2 was selected as the target sequence for base editing. After 60 hours of induction, the OD 600 =1.0 on the plate containing chloramphenicol resistance. By adjusting the structural order of the fusion protein and screening linkers of different lengths, we have further optimized the base editor. The experimental results show that when the linker length of the ABE-Cas12h base editor is 16aa or 32aa, the editor exhibits better performance ( Figure 8 B).

[0166] The structure of the fusion protein is selected from the following:

[0167] PBAD-NH2-[Cas12h]-[16aalinker]-[ABE max7.1]-COOH;

[0168] PBAD-NH2-[Cas12h]-[32aalinker]-[ABE max7.1]-COOH;

[0169] PBAD-NH2-[Cas12h]-[64aalinker]-[ABE max7.1]-COOH;

[0170] PBAD-NH2-[ABE max7.1]-[16aa linker]-[Cas12h]-COOH;

[0171] PBAD-NH2-[ABE max7.1]-[32aa linker]-[Cas12h]-COOH;

[0172] PBAD-NH2-[ABE max7.1]-[64aa linker]-[Cas12h]-COOH;

[0173] Example 8: Optimization of fusion protein structure and growth temperature of Cas12h adenine base editor

[0174] We have also conducted detailed explorations in optimizing the fusion protein structure and growth temperature of the Cas12h adenine base editor. By adding a strong promoter T7 to the base editor and adding different tags to the fusion protein, we aim to improve the expression and stability of the fusion protein. At the same time, we also optimized the growth temperature and linker length of the base editor. Target2 was selected as the target sequence for base editing, and the experimental method was the same as Example 6. The experiment found that the editor worked best when the linker length was 16aa or 32aa. In addition, too high or too low a temperature is not conducive to base editing, and 30°C is a suitable temperature condition. It is worth noting that after adding the tag, the structure of the base editor fusion protein was stabilized, which is conducive to the smooth progress of base editing.

[0175] Example 9: Comparison of the editing efficiency of base editors prepared from different Cas12h protein mutants

[0176] In this example, the amino acid that Cas12h binds to crRNA is mutated into a positively charged arginine (R), which can significantly improve the editing efficiency of the base editor.

[0177] The present invention mutates the key amino acids that bind to Cas12h and crRNA, and mutates the negatively charged amino acids into positively charged arginine to improve the binding ability of Cas12h to crRNA.

[0178] Cas12h mutants contain mutations at any of the following sites: S93R, Y96R, Q139R, A104R, Y111R, A109R, T334R, P425R, E201R, E409R, S209R, D661R, S678R, T681R, A624R, Q619R, G252R, S526R, K529R.

[0179] The results showed that the editing effects of the five mutants, A104R, E201R, G252R, S526R, and D661R, were better than those of the wild-type Cas12h (WT). Based on these five sites, double, triple and multiple mutations were performed. For example, the double mutation sites are: A104R / E201R, A104R / G252R, A104R / S526R, A104R / D661R, E201R / G252R, E201R / S526R, E201R / D661R, G252R / S526R, G252R / D661R, S526R / D661R; the triple mutation sites are: A104R / E201R / G252R, A104R / E201R / S526R, A104R / E201R / D661R, A104R / G252R / S526R, A104R / G252R / D 661R, A104R / S526R / D661R, E201R / G252R / S526R, E201R / S526R / D661R, G252R / S526R / D661R; the four-knot sites are: A104R / E201R / G252R / S526R, A104R / E201R / G252R / D661R, A104R / E201R / S526R / D661R, A104R / G252R / S526R / D661R, E201R / G252R / S526R / D661R; the five-knot sites are: A104R / E201R / G252R / S526R / D661R. The final results showed that the base editing effect of Cas12h fusion protein containing the double mutation E201R / G252R was the best.

[0180] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A mutant of Cas12h protein, characterized in that It includes at least one mutation site among S93R, Y96R, Q139R, A104R, Y111R, A109R, T334R, P425R, E201R, E409R, S209R, D661R, S678R, T681R, A624R, Q619R, G252R, S526R, and K529R, and its wild-type amino acid sequence has the amino acid sequence shown in SEQ ID NO.1; Preferably, the mutant includes any one or more mutation sites among A104R, E201R, G252R, S526R, and D661R.

2. A fusion protein, characterized in that Including ABEmax protein and Cas12h protein; The Cas12h protein includes a wild-type Cas12h protein and a mutant according to claim 1; Preferably, the ABEmax protein has the amino acid sequence shown in SEQ ID NO.22; Preferably, the ABEmax protein and the Cas12h protein are connected by a linker; the linker has an amino acid sequence as shown in any one of SEQ ID NO.23-25. Preferably, the N-terminus of the fusion protein further includes a 3×Flag tag and the C-terminus further includes an H i s Label; Preferably, the length of the His tag is 6 to 10 amino acids.

3. The fusion protein according to claim 2, characterized in that It has any of the following amino acid sequences: An amino acid sequence as shown in any one of SEQ ID NOs. 16-21; or a sequence in which one or more amino acids are substituted, deleted, added or modified in the amino acid sequence shown in SEQ ID NO. 22; or a sequence having at least 70% homology with the sequence as described in any of the foregoing.

4. Biomaterial, characterized in that Include any of the following: (1) A nucleic acid encoding the mutant according to claim 1 and / or encoding the fusion protein according to any one of claims 2 to 3; (2) an expression cassette containing the nucleic acid described in (1); (3) A recombinant vector containing the nucleic acid described in (1) or the expression cassette described in (2); (4) Transfect or transform the host with the recombinant vector (3), or the host with the nucleic acid (1) or the expression cassette (2) integrated into its genome.

5. The biomaterial according to claim 4, characterized in that In the nucleic acid, The nucleic acid encoding the wild-type Cas12h protein has the sequence shown in SEQ ID NO.32; The nucleic acid encoding the mutant is: based on the sequence shown in SEQ ID NO.32, it includes at least one of the following base mutations: The bases GCT at positions 310 to 313 mutated to CGT, the bases GAA at positions 601 to 603 mutated to CGA, the bases "GGT" at positions 754 to 756 mutated to "CGT", the bases "AGC" at positions 1576 to 1578 mutated to AGA, and the bases GAT at positions 1981 to 1983 mutated to CGT; The nucleic acid encoding the fusion protein has the sequence shown in SEQ ID NO.

33.

6. Use of any of the following in the preparation of a gene editing system: (1) The protein mutant or wild-type Cas12h protein according to claim 1; (2) The fusion protein according to any one of claims 2 to 3; (3) The biomaterial according to any one of claims 4 to 5; The gene editing system is a base editor comprising a CRISPR-Cas system and adenosine deaminase.

7. A composition for gene editing, characterized in that include: (1) a wild-type Cas12h protein, a Cas12h protein mutant according to claim 1, or a fusion protein according to any one of claims 2 to 3, or a nucleic acid encoding any one of (1); and (2) crRNA or its encoding nucleic acid.

8. The composition according to claim 7, characterized in that The crRNA comprises: A spacer segment complementary to the target nucleic acid, And, a repeat segment that binds to a wild-type Cas12h nucleic acid or a nucleic acid in the biological material according to any one of claims 4 to 5.

9. The composition according to claim 8, characterized in that The sequence of the repeating segment is selected from any one of the following (1) to (3): (1) The nucleotide sequence shown in any one of SEQ ID NOs. 3-15; (2) A nucleotide sequence having the same or similar function as (1) obtained by substituting, deleting, adding or modifying one or more nucleotides in the nucleotide sequence shown in (1); (3) a nucleotide sequence having at least 70% homology to the nucleotide sequence shown in (1) or (2); Preferably, the plurality is 2 to 10. Preferably, the length of the spacer segment complementary to the target nucleic acid is 10-30 nt.

10. A complex for gene editing, characterized in that including complex 1 or complex 2; The complex 1 is a complex formed by Cas12h protein and crRNA; The Cas12h protein is a wild-type Cas12h protein or a protein mutant according to claim 1; The compound 2 is: a complex formed by the fusion protein according to any one of claims 2 to 3 and crRNA; The crRNA is the crRNA in the composition according to any one of claims 7 to 9.

11. Use of the composition according to claims 7 to 9 or the complex according to claim 10 in the preparation of a gene editing product.

12. A gene editing method comprising: transforming a recombinant vector into a cell; The recombinant vector is the recombinant vector in the biomaterial according to any one of claims 4 to 5; Or using the composition according to any one of claims 7 to 9 or the complex according to claim 10 to perform gene editing on cells.

Images