Application of leucine-enriched repetitive membrane protein-15 in preparation of drugs for resisting pyroptosis of cardiac muscle

Abstract

The invention relates to the field of biological medicine, and discloses application of leucine-enriched repetitive membrane protein-15 in preparation of drugs for resisting pyroptosis of cardiac muscle. The leucine-enriched repetitive membrane protein-15 has the effect of inhibiting pyroptosis of myocardial cells for the first time, especially can reduce pyroptosis of myocardial cells after acute myocardial infarction, and provides a new intervention target for promoting recovery of heart functions after acute myocardial infarction treatment. The invention provides a new medicine and a treatment scheme for clinical treatment, and has important significance in improving the clinical treatment effect of myocardial infarction diseases and improving the life quality of patients.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to application of leucine-rich repeat membrane protein-15 in the preparation of anti-myocardial pyroptosis drugs. Background Art

[0002] When an acute myocardial infarction occurs, the myocardial tissue below the blocked blood vessel lacks blood supply, causing ischemic death, impaired cardiac function, and even malignant arrhythmias, heart rupture, and other conditions that can lead to death. Although percutaneous coronary intervention can significantly reduce mortality after acute myocardial infarction, cardiomyocyte death persists after myocardial infarction, ultimately leading to scar repair and reduced cardiac function, placing a significant burden on patients and their families.

[0003] Cardiovascular disease is the leading cause of death in both urban and rural populations, with myocardial infarction being one of the leading causes of cardiovascular death. Therefore, inhibiting myocardial cell death after myocardial infarction is crucial for promoting myocardial repair and preserving cardiac function. However, there are currently no effective drugs to inhibit myocardial cell death after myocardial infarction. Therefore, developing drugs to treat myocardial cell death after myocardial infarction has significant social and economic benefits and promising applications.

[0004] Leucine-rich repeat protein-15 (LRRC15) is an important member of the leucine-rich repeat family (LRRs). It is a type I transmembrane protein with approximately 500-550 amino acids involved in protein interactions outside the cell, 20-25 amino acids in the transmembrane region, and 50-100 amino acids involved in intracellular signal transduction. It is named because the extracellular part contains 15 leucine-rich repeat segments and plays an important role in tumor cell invasion, migration, and stem cell differentiation. In tumor tissues, LRRC15 + Tumor stromal fibroblasts (CAFs) can suppress CD8 + T cell immune responses promote tumor growth, and eliminating LRRC15+ CAFs enhances tumor immunotherapy (CN115943165A). Intravenous administration of the LRRC15 monoclonal antibody ABBV-085 significantly improves survival in osteosarcoma and undifferentiated pleomorphic sarcoma, achieving partial remission in some patients. However, the role of LRRC15 in the heart has not yet been reported.

[0005] Pyroptosis is one of the important ways of cell death. The molecular signaling pathways that cause pyroptosis include: (1) Activating Cleaved caspase1 / 11 to cleave GSDMD in the Gasdermins family, causing the N-terminus of GSDMD (NT-GSDMD) to form a gap in the cell membrane, causing cell pyroptosis; (2) Activating Cleaved caspase3 to cleave GSDME in the Gasdermins family, causing the N-terminus of GSDME (NT-GSDME) to form a gap in the cell membrane, causing cell pyroptosis. Studies have found that myocardial cell pyroptosis can be induced after myocardial infarction, and inhibiting myocardial pyroptosis can partially restore cardiac function. However, no drugs that inhibit cell pyroptosis have been found to be used in the clinical treatment of myocardial infarction. Therefore, studying drugs to inhibit the above pathways and reduce myocardial pyroptosis to treat acute myocardial infarction has great application prospects. Summary of the Invention

[0006] To address the above technical issues, the present invention provides the use of leucine-rich repeat membrane protein-15 in the preparation of an anti-myocardial pyroptosis drug. This invention, for the first time, discovered that leucine-rich repeat membrane protein-15 can inhibit cardiomyocyte pyroptosis, particularly reducing cardiomyocyte pyroptosis after acute myocardial infarction. This provides a new intervention target for promoting cardiac function recovery after acute myocardial infarction.

[0007] The specific technical solutions of the present invention are: In a first aspect, the present invention provides a use of leucine-rich repeat-containing membrane protein 15 (LRRC15) in the preparation of an anti-myocardial pyroptosis drug.

[0008] This study first discovered that leucine-rich repeat protein-15 can inhibit cardiomyocyte pyroptosis. Specifically, using an in vitro cardiomyocyte hypoxia model and an in vivo myocardial infarction model, the study found that overexpressing LRRC15 can inhibit cardiomyocyte pyroptosis and promote cardiac function recovery after myocardial infarction.

[0009] Furthermore, the myocardial pyroptosis is myocardial pyroptosis produced after myocardial infarction.

[0010] In a second aspect, the present invention provides the use of leucine-rich repeat membrane protein-15 in the preparation of a drug for treating myocardial infarction.

[0011] The present invention found that leucine-rich repeat membrane protein-15 can reduce cardiomyocyte pyroptosis after acute myocardial infarction, and can therefore be used to treat myocardial infarction, which provides a new intervention target for promoting the recovery of cardiac function after acute myocardial infarction.

[0012] Furthermore, the myocardial infarction is acute myocardial infarction.

[0013] Furthermore, the drug includes leucine-rich repeat membrane protein-15, and a pharmaceutically acceptable carrier and / or excipient.

[0014] Furthermore, the drug is a pharmaceutical preparation that is administered by injection, oral administration, nasal mucosa, lungs, rectum, oral mucosa or skin; further, the injection includes intramyocardial injection, intradermal injection, subcutaneous injection, intramuscular injection and intravenous injection.

[0015] In a third aspect, the present invention provides the use of an adenovirus and / or adeno-associated virus that overexpresses leucine-rich repeat membrane protein-15 in the preparation of an anti-myocardial pyroptosis drug.

[0016] In a fourth aspect, the present invention provides the use of an adenovirus and / or adeno-associated virus that overexpresses leucine-rich repeat-containing membrane protein-15 in the preparation of a drug for treating myocardial infarction.

[0017] By inserting the leucine-rich repeat membrane protein-15 gene sequence into a viral vector and transfecting it, overexpression of leucine-rich repeat membrane protein-15 in cardiomyocytes can be achieved, thereby having the effect of preventing myocardial pyroptosis or treating myocardial infarction.

[0018] Furthermore, the adenovirus and / or adeno-associated virus overexpressing leucine-rich repeat membrane protein-15 is a viral vector into which a leucine-rich repeat membrane protein-15 gene sequence is inserted.

[0019] In a fifth aspect, the present invention provides the use of the leucine-rich repeat membrane protein-15 gene as a target in screening anti-myocardial pyroptosis drugs or myocardial infarction therapeutic drugs.

[0020] Since the present invention discovered that the leucine-rich repeat membrane protein-15 gene is highly correlated with myocardial pyroptosis and myocardial infarction, it can be used as a target alone or in combination with other related targets to screen for drugs that can overexpress the leucine-rich repeat membrane protein-15 gene, thereby serving as anti-myocardial pyroptosis drugs and myocardial infarction therapeutic drugs.

[0021] In a sixth aspect, the present invention provides a method for inhibiting cardiomyocyte pyroptosis under in vitro conditions, comprising: adding leucine-rich repeat membrane protein-15 and / or an adenovirus overexpressing leucine-rich repeat membrane protein-15 to the in vitro cardiomyocyte culture system, and inhibiting in vitro cardiomyocyte pyroptosis by inhibiting the cleaved caspase3 / GSDME pathway.

[0022] The present invention discovered that by directly administering leucine-rich repeat-15 or an adenovirus overexpressing leucine-rich repeat-15 to cardiomyocytes in vitro, the leucine-rich repeat-15 content in cardiomyocytes can be increased, thereby inhibiting cardiomyocyte pyroptosis in vitro by inhibiting the cleaved caspase3 / GSDME pathway. Therefore, leucine-rich repeat-15 or an adenovirus overexpressing leucine-rich repeat-15 can be used as a tool drug for scientific research.

[0023] Furthermore, leucine-rich repeat membrane protein-15, adenovirus overexpressing leucine-rich repeat membrane protein-15, and adeno-associated virus can serve as inhibitors of the cleaved caspase3 / GSDME pathway.

[0024] In the seventh aspect, the present invention provides the use of the leucine-rich repeat membrane protein-15 gene in constructing a myocardial pyroptosis model: knocking out or knocking down the leucine-rich repeat membrane protein-15 gene in myocardial cells in vitro or in vivo, activating the cleaved caspase3 / GSDME pathway, and thus obtaining a myocardial pyroptosis model.

[0025] By reducing the expression of the leucine-rich repeat membrane protein-15 gene in cardiomyocytes, the cleavedcaspase3 / GSDME pathway can be activated, thereby obtaining a myocardial pyroptosis model.

[0026] In an eighth aspect, the present invention provides a method for constructing an in vitro model of myocardial pyroptosis, comprising: knocking out or knocking down the leucine-rich repeat membrane protein-15 gene of in vitro myocardial cells, culturing the in vitro myocardial cells, and promoting myocardial cell pyroptosis by activating the cleaved caspase3 / GSDME pathway, thereby obtaining an in vitro model of myocardial pyroptosis.

[0027] Compared with the prior art, the present invention has the following beneficial effects: This study, published in Nature Communications, demonstrates for the first time that leucine-rich repeat membrane protein-15 (LRR-15) inhibits cardiomyocyte pyroptosis, particularly in patients after acute myocardial infarction (AMI). This provides a novel intervention target for promoting cardiac function recovery after AMI. This discovery provides new drugs and treatment options for clinical treatment, significantly enhancing the efficacy of AMI treatments and improving patient quality of life. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Figure 1 shows the results of sytox staining of dead cells in neonatal mouse cardiomyocytes after overexpressing LRRC15 adenovirus in a hypoxic and serum-deprived model. A is a light microscopic image of neonatal mouse cardiomyocytes, with red representing dead cells. B is a statistical graph of cells in each group.

[0029] Figure 2 Figure 5 shows the results of western blot analysis of protein expression in neonatal mouse cardiomyocytes after overexpressing LRRC15 adenovirus and inducing cardiomyocyte pyroptosis under the hypoxia-serum deprivation model; AB shows the expression and statistical graphs of cardiomyocyte pyroptosis proteins (cleaved caspase3, GSDME, and NT-GSDME) in neonatal mouse cardiomyocytes under hypoxia-serum deprivation conditions; CD shows the expression of pyroptosis proteins in neonatal mouse cardiomyocytes after overexpressing LRRC15 and inducing cardiomyocyte pyroptosis under hypoxia-serum deprivation conditions.

[0030] Figure 3 4-week-old mice were injected with adeno-associated virus 9 overexpressing LRRC15 (AAV9-LRRC15) through the tail vein. OE ) and its control virus (AAV9-LRRC15 OENC ), a myocardial infarction model was established, and three days later, cardiac function of the mice was statistically analyzed using echocardiography; A is a Doppler ultrasound image of the mouse heart, and the white arrows represent the size of the mouse heart cavity; B is a statistical graph of the mouse cardiac function (EF, FS, LVIDd, LVIDs).

[0031] Figure 4 4-week-old mice were injected with adeno-associated virus 9 overexpressing LRRC15 (AAV9-LRRC15) through the tail vein. OE ) and its control virus (AAV9-LRRC15 OENC ), myocardial infarction model was established, and samples were collected 3 days later and TTC staining was performed to observe the results of myocardial infarction area in mice; A is a general picture of the heart after myocardial infarction in mice, white is the myocardial infarction area, red is the non-myocardial infarction area, and B is a statistical chart of myocardial infarction area in mice.

[0032] Figure 5 In order to knock down LRRC15 by transfecting neonatal rat cardiomyocytes with siLRRC15, the expression of cardiomyocyte pyroptosis proteins (cleaved caspase3, GSDME, and NT-GSDME) and their statistical graphs were detected by western blot after 48 hours of in vitro culture.

[0033] Figure 6 Results of siLRRC15 transfection in neonatal mouse cardiomyocytes after 48 hours of culture followed by sytox staining for dead cells. A is a light microscopic image of neonatal mouse cardiomyocytes, with red representing dead cells. B is a statistical graph of cells in each group.

[0034] Figure 7The results of cardiac function statistics of full-gene LRRC15 knockout mice (LRRC15 KO) and their wild-type control mice of the same week age were obtained by echocardiography; A is a Doppler ultrasound image of the mouse heart, with the white arrows representing the size of the mouse heart chamber; B is a statistical graph of the mouse heart function (EF, FS, LVIDd, LVIDs). DETAILED DESCRIPTION

[0035] The present invention will be further described below in conjunction with examples. The terms used in the examples of the present invention are intended to describe specific embodiments rather than to limit the scope of the present invention. Without departing from the spirit and scope of the inventive concept, variations and advantages that can be imagined by those skilled in the art are included in the present invention, and the scope of protection of the present invention is defined by the appended claims and any equivalents thereof.

[0036] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and biological materials described are commercially available unless otherwise specified.

[0037] Overall embodiment In a first aspect, the present invention provides a use of leucine-rich repeat membrane protein-15 in the preparation of an anti-myocardial pyroptosis drug.

[0038] Furthermore, the myocardial pyroptosis is myocardial pyroptosis produced after myocardial infarction.

[0039] In a second aspect, the present invention provides a use of leucine-rich repeat membrane protein-15 in the preparation of a drug for treating myocardial infarction. Furthermore, the myocardial infarction is acute myocardial infarction.

[0040] Furthermore, the drug comprises leucine-rich repeat membrane protein-15 and a pharmaceutically acceptable carrier and / or excipient. Still further, the drug is a pharmaceutical preparation for administration by injection, oral administration, nasal mucosa, lung, rectum, oral mucosa, or skin; and further, the injection comprises intramyocardial injection, intradermal injection, subcutaneous injection, intramuscular injection, and intravenous injection.

[0041] In a third aspect, the present invention provides the use of an adenovirus and / or adeno-associated virus that overexpresses leucine-rich repeat membrane protein-15 in the preparation of an anti-myocardial pyroptosis drug.

[0042] In a fourth aspect, the present invention provides the use of an adenovirus and / or adeno-associated virus that overexpresses leucine-rich repeat-containing membrane protein-15 in the preparation of a drug for treating myocardial infarction.

[0043] Furthermore, the adenovirus and / or adeno-associated virus overexpressing leucine-rich repeat membrane protein-15 is a viral vector into which a leucine-rich repeat membrane protein-15 gene sequence is inserted.

[0044] In a fifth aspect, the present invention provides the use of the leucine-rich repeat membrane protein-15 gene as a target in screening anti-myocardial pyroptosis drugs or myocardial infarction therapeutic drugs.

[0045] In a sixth aspect, the present invention provides a method for inhibiting cardiomyocyte pyroptosis under in vitro conditions, comprising: adding leucine-rich repeat membrane protein-15 and / or an adenovirus overexpressing leucine-rich repeat membrane protein-15 to the in vitro cardiomyocyte culture system, and inhibiting in vitro cardiomyocyte pyroptosis by inhibiting the cleaved caspase3 / GSDME pathway.

[0046] Furthermore, leucine-rich repeat membrane protein-15, adenovirus overexpressing leucine-rich repeat membrane protein-15, and adeno-associated virus can serve as inhibitors of the cleaved caspase3 / GSDME pathway.

[0047] In the seventh aspect, the present invention provides the use of the leucine-rich repeat membrane protein-15 gene in constructing a myocardial pyroptosis model: knocking out or knocking down the leucine-rich repeat membrane protein-15 gene in myocardial cells in vitro or in vivo, activating the cleaved caspase3 / GSDME pathway, and thus obtaining a myocardial pyroptosis model.

[0048] In an eighth aspect, the present invention provides a method for constructing an in vitro model of myocardial pyroptosis, comprising: knocking out or knocking down the leucine-rich repeat membrane protein-15 gene of in vitro myocardial cells, culturing the in vitro myocardial cells, and promoting myocardial cell pyroptosis by activating the cleaved caspase3 / GSDME pathway, thereby obtaining an in vitro model of myocardial pyroptosis. Specific embodiments Example 1: LRRC15 overexpression adenovirus (AD-LRRC15 OE ) and its control virus (AD-LRRC15 OENC ) Adenovirus packaging was performed using the AdMax adenovirus packaging system developed by Professor Frank L. Graham. HEK293 cells were co-transfected with an adenovirus shuttle plasmid carrying the LRRC15 gene and a helper packaging plasmid that lacked most of the adenovirus genome (E1 / E3 deletion). Using the Cre-loxP recombinase cleavage system, non-replicating recombinant adenovirus carrying the exogenous gene was generated. The steps are as follows: (1) Construction and amplification of recombinant plasmid: The vector plasmid GV314 was selected, and the element sequence was CMV-MCS-3FLAG-SV40-EGFP. The vector was cut by restriction endonuclease and fused with the DNA fragment of LRRC15 to construct the recombinant plasmid. The LRRC15 amplification primers were: P1: AGGTCGACTCTAGAGGATCCCGCCACCATGCCCGTGAAACATTATCTC; P2:TCCTTGTAGTCCATACCGGTGCACTCATTGGGAGCCTTCATCTG.

[0050] The recombinant plasmid was transformed into competent cells for amplification and extraction.

[0051] (2) Adenovirus amplification: a. Overexpression adenovirus packaging: The recombinant plasmid expressing LRRC15 and the auxiliary packaging plasmid pBHG lox ΔE1,3 Cre (Microbix, Canada, sequence download website: http: / / www.microbix.com / Plasmid-Sequences / pBHGloxdeltaE13Cre.zip) were co-transfected into HEK293 cells. When microscopic observation showed cytopathic effect (CPE) of the HEK293 cells and 50% cell detachment, the cells were harvested by low-speed centrifugation and resuspended in 2 ml of DMEM. The cells were frozen and thawed three times at -70°C / 37°C, shaken, and centrifuged at 7000 g for 5 min at 4°C. The viral supernatant was collected to obtain the first round of packaging virus stock. The obtained cell supernatant was added to more HEK293 cell culture medium to infect the cells. The cells were harvested by low-speed centrifugation again and resuspended in 10 ml of DMEM. The cells were frozen and thawed three times at -70°C / 37°C, shaken, and centrifuged at 7000 g for 5 min at 4°C. min to obtain the virus stock solution.

[0052] b. Overexpression adenovirus control virus packaging: The control plasmid expressing the LRRC15 recombinant plasmid and the auxiliary packaging plasmid pBHG lox ΔE1, 3 Cre (Microbix, Canada, sequence download website: http: / / www.microbix.com / Plasmid-Sequences / pBHGloxdeltaE13Cre.zip) were co-transfected into HEK293 cells. When microscopic observation showed cytopathic effect (CPE) of the HEK293 cells and 50% cell detachment, the cells were collected by low-speed centrifugation and resuspended in 2 ml of DMEM. The cells were frozen and thawed three times at -70°C / 37°C and shaken three times. The supernatant was collected by centrifugation at 7000 g for 5 min at 4°C to obtain the first round of packaging virus stock. The obtained cell supernatant was added to more HEK293 cell culture medium to infect the cells. The cells were collected by low-speed centrifugation again and resuspended in 10 ml of DMEM. The cells were frozen and thawed three times at -70°C / 37°C and shaken three times. The virus stock solution was obtained by centrifugation at 7000 g for 5 min.

[0053] (3) Adenovirus purification: Purification was performed using the Adeno-X™ Virus Purification Kit (BD Biosciences). (a) Remove the BD Adeno-X purification device and filter 10 ml of the crude viral extract through a 0.45 μm filter. Store the filtrate in a collection flask. (b) Add 4 μl of 25 U / μl Benzonase to the viral filtrate and mix thoroughly. Incubate at 37°C for 30 min, then add 10 ml of 1× dilution buffer and mix thoroughly. (c) Assemble the filtration apparatus. After purging all air from the filter and cannula with sterile PBS, insert the cannula into the collection flask containing the viral filtrate. Pull the syringe outward at a rate of 5 ml / min to allow the viral filtrate to flow through the filter. (d) Wash the filter device with 1× Wash Buffer; (e) Elute the adenovirus using a 5 ml BD Luer-Lok syringe: draw 3 ml of 1× Elution Buffer into the syringe; connect the syringe to the notch of the filter and push 1 ml of Elution Buffer through the filter into a 5 ml sterile centrifuge tube; incubate the filter at room temperature for 5 min and push the remaining Elution Buffer through the filter to collect the remaining adenovirus.

[0054] Example 2: LRRC15 overexpression adeno-associated virus (AAV9-LRRC15 OE) and its control virus (AAV9-LRRC15 OENC ) The GeneCare AAV Helper-Free System is used, which consists of three plasmids: viral vector, pAAV-RC vector, and pHelper vector. The steps are as follows: (1) Construction and amplification of recombinant plasmid: The vector plasmid GV571 was selected, and the element sequence was cTNTp-MCS-3Flag-T2A-EGFP. The vector was cut by restriction endonuclease and fused with the DNA fragment of LRRC15 to construct the recombinant plasmid. The LRRC15 amplification primers were: P1: AGGTCGACTCTAGAGGATCCCGCCACCATGCCCGTGAAACATTATCTC; P2:TCCTTGTAGTCCATACCGGTGCACTCATTGGGAGCCTTCATCTG.

[0055] The recombinant plasmid was transformed into competent cells for amplification and extraction.

[0056] (2) Amplification of adeno-associated virus: a. Packaging of adeno-associated virus overexpressing LRRC15: Co-transfect the recombinant plasmid expressing LRRC15, pHelper (carrying adenovirus-derived genes), and pAAV-RC (carrying AAV replication and capsid genes) into AAV-293 cells (providing the trans-acting factors required for AAV replication and packaging). The adeno-associated virus was collected using the same procedure as for adenovirus collection.

[0057] b. Packaging of control virus of adeno-associated virus overexpressing LRRC15: Co-transfect the control plasmid expressing LRRC15 recombinant plasmid, pHelper (carrying adenovirus-derived genes), and pAAV-RC (carrying AAV replication and capsid genes) into AAV-293 cells (providing the trans-acting factors required for AAV replication and packaging). The operation of collecting adeno-associated virus is the same as the adenovirus collection step.

[0058] (3) Purification of adeno-associated virus: (a) Add solid CsCl to the virus concentrate until the density reaches 1.41 g / ml (refractive index 1.372), approximately 6.5 g CsCl per 10 ml of virus solution. Shake to dissolve. CsCl dissolves by absorbing heat and producing a cold sensation. (b) Add the sample to an ultracentrifuge tube and fill the remaining space of the tube with the pre-prepared 1.41 g / ml CsCl solution; (c) Centrifuge at 175,000 g for 24 hours to form a density gradient. Collect samples of different densities step by step and titer them. Collect the fractions enriched with AAV particles. (d) Repeat the above process once; (e) The obtained virus stock solution was concentrated using an Amicon-15 ultrafiltration device, and glycerol was added to make the concentration of the virus 5%.

[0059] Example 3: LRRC15 reduces cardiomyocyte cell death in neonatal rats.

[0060] Primary cardiomyocytes from suckling mice were isolated and cultured in high-glucose DMEM medium containing 10% fetal bovine serum. OENC (Control virus of adenovirus overexpressing LRRC15, prepared in Example 1) Adenovirus and AD-LRRC15 OE After culturing adenovirus (prepared in Example 1) for 48 hours, the medium was replaced with serum-free medium containing 10 nM SYTOX GREEN dye and cultured in a hypoxic incubator with an oxygen concentration of 0.5% for 12 hours. The hypoxic cells were removed and photographed using a fluorescence microscope.

[0061] Figure 1 Figure 1 shows the results of sytox staining for dead cells in neonatal mouse cardiomyocytes induced by overexpressing LRRC15 adenovirus under a hypoxia-serum deprivation (HD) model. A shows a light microscopic image of neonatal mouse cardiomyocytes, with red representing dead cells. B shows a statistical plot of cells in each group, showing the percentage of red fluorescent cells relative to the total number of cells in the field of view. In the HD model, the LRRC15 adenovirus-overexpressing group showed significantly less cardiomyocyte death than the LRRC15 adenovirus-overexpressing control group, indicating that LRRC15 reduces cardiomyocyte death in neonatal mice.

[0062] Example 4: LRRC15 reduces myocardial pyroptosis by inhibiting the cleaved caspase3 / GSDME pathway.

[0063] Primary cardiomyocytes of suckling mice were isolated and evenly plated in 12-well plates. They were cultured in high-glucose DMEM medium containing 10% fetal bovine serum and transfected with AD-LRRC15. OENC (Control virus of adenovirus overexpressing LRRC15, prepared in Example 1) Adenovirus and AD-LRRC15 OEAfter 48 hours of culture, adenovirus (prepared in Example 1) was replaced with serum-free medium. Cultured in a 0.5% hypoxic incubator for 48 hours, the culture supernatant was discarded, the cells were gently rinsed twice with PBS, and 100 μl / well of RIPA cell lysis buffer containing protease and phosphatase inhibitors was added. The cells were incubated on ice for 5 minutes. Protein was scraped with a cell scraper into a 1.5 ml EP tube. The cells were then lysed on ice for 15 minutes and centrifuged at 12,000 g for 30 minutes at 4°C. 90 μl of the supernatant was transferred to a new EP tube for protein concentration determination using the BCA assay. After protein concentration determination, the proteins were diluted to the same concentration using SDS-PAGE loading buffer. The proteins were then boiled in a 98°C metal bath for 10 minutes. Western blotting and transfer to a membrane were then performed. After transfer, the membrane was blocked with PBST solution containing 5% skim milk for 1 hour. Primary antibodies against cleaved caspase 3 (CST, 9661s) and GSDME (abcam, ab215191) were then prepared in primary antibody diluent at a volume ratio of 1:1000. The membrane was incubated overnight at 4°C and washed four times with PBST for 7 minutes each. The prepared HRP-conjugated secondary antibody was then added. The membrane was incubated at room temperature for 1 hour. The membrane was washed four times with PBST for 7 minutes each. The bands were then developed and imaged using ECL developer. The actin internal control was incubated with an HRP-conjugated antibody (1:55,000 dilution) at room temperature for 1 hour. The membrane was washed four times with PBST for 7 minutes each. The bands were then developed and imaged using developer. Grayscale values ​​were calculated using Bio-Rad Image Lab Software 6.1.

[0064] Figure 2 After overexpressing LRRC15 adenovirus in neonatal rat cardiomyocytes, cardiomyocyte pyroptosis was induced under the hypoxia and serum deprivation model. The protein expression was detected by western blot. Figure 2 Figures AB show the expression and statistical graphs of pyroptotic proteins (cleaved caspase3, GSDME, and NT-GSDME) in neonatal mouse cardiomyocytes under hypoxia and serum deprivation. Figures CD show the expression of pyroptotic proteins in neonatal mouse cardiomyocytes after hypoxia and serum deprivation induced myocardial pyroptosis by overexpressing LRRC15. It can be seen that in the HD model, cleaved caspase3 and NT-GSDME levels were significantly increased, indicating that cardiomyocytes undergo cleaved caspase3 / GSDME-mediated pyroptosis. However, after overexpressing LRRC15, cleaved caspase3 and NT-GSDME levels were significantly reduced compared to the control group, indicating that LRRC15 reduces myocardial pyroptosis by inhibiting the cleaved caspase3 / GSDME pathway.

[0065] Example 5: Overexpression of LRRC15 improves the recovery of cardiac function after myocardial infarction.

[0066] Four-week-old male C57 mice were injected with AAV9-LRRC15 prepared with normal saline via the tail vein. OENC AAV (control virus overexpressing LRRC15 adeno-associated virus, prepared in Example 2) and AAV9-LRRC15 OE Adeno-associated virus (prepared in Example 2) (1*10 ^12 After 4 weeks, mice were anesthetized with 2% pentobarbital and intubated. The skin of the chest was cut open, and the muscles were bluntly dissected. The heart was exposed using a chest brace. 7-0 silk suture was then used to ligate the left anterior descending coronary artery until the apex of the heart blanched and the electrocardiogram showed ST-segment elevation. This was considered a successful myocardial infarction model. The rib cage and skin were then sutured. The mice were then maintained for 3 days. Doppler echocardiograms were obtained using a mouse echocardiogram. EF, FS, LVIDd, and LVIDs were calculated and statistically analyzed.

[0067] Figure 3 4-week-old mice were injected with adeno-associated virus 9 overexpressing LRRC15 (AAV9-LRRC15) through the tail vein. OE ) and its control virus (AAV9-LRRC15 OENC ), myocardial infarction model was established, and cardiac function of mice was analyzed by echocardiography 3 days later. Figure 3 In the figure, A is a Doppler ultrasound image of the mouse heart, the white arrow represents the size of the mouse heart cavity, and B is a statistical graph of the mouse heart function (EF, FS, LVIDd, LVIDs). OENC The cardiac function of mice in the AAV9-LRRC15 group was significantly reduced. OE The cardiac function of mice in the LRRC15 group was higher than that in the first two groups, indicating that LRRC15 can improve the recovery of cardiac function after myocardial infarction.

[0068] Example 6: Overexpression of LRRC15 reduces myocardial infarction area after myocardial infarction.

[0069] Four-week-old male C57 mice were injected with AAV9-LRRC15 prepared with normal saline via the tail vein. OENC AAV (control virus overexpressing LRRC15 adeno-associated virus, prepared in Example 2) and AAV9-LRRC15 OE Adeno-associated virus (prepared in Example 2) (1*10 ^12Four weeks later, mice were anesthetized with 2% pentobarbital and intubated. The skin of the chest area was cut open, and the muscles were bluntly dissected. The heart was exposed using a chest brace. The left anterior descending coronary artery was ligated with 7-0 silk suture until the apex of the heart blanched and the electrocardiogram showed ST-segment elevation. This was considered a successful myocardial infarction model. The rib cage and skin were then sutured. The mice were then maintained for 3 days. After echocardiography, the mice were anesthetized and sacrificed. The chest cavity was opened and the heart was perfused with PBS. Using a mouse heart sectioning mold, 1 mm thick transverse sections were cut. The heart sections were immersed in 2% red tetrazolium solution and incubated in a dark water bath at 37°C for 30 minutes, gently shaking the container every 5 minutes to ensure thorough staining. The heart sections were then removed, fixed in 4% formaldehyde, and photographed using a stereomicroscope. White indicates the infarcted area, red indicates the non-infarcted area, and the percentage of the white area relative to the total area was calculated.

[0070] Figure 4 4-week-old mice were injected with adeno-associated virus 9 overexpressing LRRC15 (AAV9-LRRC15) through the tail vein. OE ) and its control virus (AAV9-LRRC15 OENC ), myocardial infarction model was established, samples were collected 3 days later, TTC staining was performed, and the results of myocardial infarction area of ​​mice were observed. Figure 4 In the figure, A is a general picture of the heart after myocardial infarction in mice, with white representing the myocardial infarction area and red representing the non-myocardial infarction area, and B is a statistical chart of the myocardial infarction area in mice. OENC The infarct size of mice in the AAV9-LRRC15 and NS groups was significant. OE The infarct size in the control group was significantly reduced, indicating that overexpression of LRRC15 can significantly reduce the infarct size after myocardial infarction.

[0071] Example 7: Knockdown of LRRC15 activates the cleaved caspase3 / GSDME pathway and promotes myocardial pyroptosis.

[0072] Primary cardiomyocytes from suckling mice were isolated and evenly plated in 12-well plates. Cultured in high-glucose DMEM supplemented with 10% fetal bovine serum, the cells were transfected with siRNA to knock down LRRC15 and control siRNA NC (siLRRC15 and siLRRC15NC). After 48 hours of culture, the supernatant was discarded, the cells were gently rinsed twice with PBS, and 100 μl / well of RIPA cell lysis buffer containing protease and phosphatase inhibitors was added. The cells were incubated on ice for 5 minutes. Protein was then scraped with a cell scraper into a 1.5 ml EP tube and lysed on ice for 15 minutes. After centrifugation at 12,000 g for 30 minutes at 4°C, 90 μl of the supernatant was transferred to a new EP tube for protein concentration determination by BCA assay. After protein concentration determination, the proteins were diluted to the same concentration using SDS-PAGE loading buffer. The proteins were then boiled in a 98°C metal bath for 10 minutes. Western blotting and transfer to a membrane were then performed. After transfer, the membrane was blocked with PBST containing 5% skim milk for 1 hour. Primary antibodies against cleaved caspase 3 (CST, 9661s) and GSDME (abcam, ab215191) were then prepared in primary antibody diluent at a 1:1000 volume ratio. The membrane was incubated overnight at 4°C and washed four times with PBST for 7 minutes each. The prepared HRP-conjugated secondary antibody was then added. The membrane was incubated at room temperature for 1 hour. The membrane was washed four times with PBST for 7 minutes each. The bands were then developed and imaged using ECL developer. The actin internal control was incubated with an HRP-conjugated antibody (1:55,000 dilution) at room temperature for 1 hour. The membrane was washed four times with PBST for 7 minutes each. The bands were then developed and imaged using developer. Grayscale values ​​were calculated using Bio-Rad Image Lab Software 6.1.

[0073] Figure 5 Neonatal rat cardiomyocytes were transfected with siLRRC15 to knock down LRRC15. Western blot analysis and statistical analysis of pyroptosis proteins (cleaved caspase 3, GSDME, and NT-GSDME) were performed after 48 hours of in vitro culture. The expression of cleaved caspase 3 and NT-GSDME in siLRRC15-transfected cardiomyocytes was significantly elevated compared to the siLRRC15 NC group, indicating that cleaved caspase / GSDME-mediated pyroptosis occurs in cardiomyocytes after LRRC15 knockdown.

[0074] Example 8: Knockdown of LRRC15 causes cardiomyocyte death Primary cardiomyocytes from suckling mice were isolated and cultured in high-glucose DMEM medium containing 10% fetal bovine serum. They were then transfected with siRNA knockdown LRRC15 and its control siRNA NC (siLRRC15 and siLRRC15 NC). After 48 hours of culture, the culture medium was replaced with serum-free medium containing 10 nM SYTOX GREEN dye and cultured for 12 hours. The cells were then photographed using a fluorescence microscope.

[0075] Figure 6 The results of dead cell staining using sytox were shown in the figure below: Cardiomyocytes of neonatal mice were transfected with siLRRC15 and cultured for 48 hours. Figure 6 In Figure 2, A is a light microscopic image of neonatal mouse cardiomyocytes; red represents dead cells. B is a statistical chart of cells in each group. Cardiomyocytes transfected with siLRRC15 showed significantly more cell death than those in the siLRRC15 NC group, suggesting cell death after LRRC15 knockdown.

[0076] Example 9: Cardiac function is inhibited in mice with full gene knockout of LRRC15 Methods: LRRC15 knockout mice (LRRC15 KO) were bred using Crespr-Cas9 technology. After 12 months of breeding, cardiac Doppler echocardiograms were collected using a mouse echocardiogram machine. EF, FS, LVIDd, and LVIDs of the mice were calculated and statistically analyzed.

[0077] Figure 7 Cardiac function was assessed using echocardiography in LRRC15 knockout mice (LRRC15 KO) and their wild-type control mice of the same age. Figure 7 In the figure, A is a Doppler ultrasound image of the mouse heart, with white arrows representing the size of the mouse heart chamber. B is a statistical graph of mouse cardiac function (EF, FS, LVIDd, LVIDs). It was found that the cardiac function of the LRRC15 KO group was significantly reduced compared with the WT group, indicating that LRRC15 knockdown significantly reduces the cardiac function of mice.

Claims

1. Application of leucine-rich repeat membrane protein-15 in the preparation of anti-myocardial pyroptosis drugs.

2. The use according to claim 1, characterized in that: The drug comprises leucine-rich repeat membrane protein-15 and a pharmaceutically acceptable carrier and / or excipient.

3. Application of leucine-rich repeat membrane protein-15 in the preparation of drugs for the treatment of myocardial infarction.

4. The use according to claim 3, characterized in that: The drug comprises leucine-rich repeat membrane protein-15 and a pharmaceutically acceptable carrier and / or excipient.

5. Use of adenovirus and / or adeno-associated virus overexpressing leucine-rich repeat membrane protein-15 in the preparation of anti-myocardial pyroptosis drugs.

6. Use of adenovirus and / or adeno-associated virus overexpressing leucine-rich repeat membrane protein-15 in the preparation of drugs for the treatment of myocardial infarction.

7. Application of the leucine-rich repeat membrane protein-15 gene as a target in screening anti-myocardial pyroptosis drugs or myocardial infarction therapeutic drugs.

8. A method for inhibiting cardiomyocyte pyroptosis in vitro, characterized by: Adding leucine-rich repeat membrane protein-15 and / or adenovirus overexpressing leucine-rich repeat membrane protein-15 to the in vitro cardiomyocyte culture system inhibits in vitro cardiomyocyte pyroptosis.

9. Use of the leucine-rich repeat membrane protein-15 gene in constructing a myocardial pyroptosis model, characterized by: Knocking out or knocking down the leucine-rich repeat membrane protein-15 gene in cardiomyocytes in vitro or in vivo can generate a myocardial pyroptosis model.

10. A method for constructing an in vitro model of myocardial pyroptosis, characterized by: The leucine-rich repeat membrane protein-15 gene of in vitro cardiomyocytes was knocked out or knocked down, and the in vitro cardiomyocytes were cultured to promote cardiomyocyte pyroptosis, thereby obtaining an in vitro model of myocardial pyroptosis.

Images