Application of low-concentration recombinant human periostin in preparation of medicine for treating intervertebral disc degeneration
By inhibiting inflammatory damage to intervertebral disc nucleus pulposus cells with low concentrations of recombinant human periostin, the shortcomings of low-concentration applications in existing technologies are resolved, achieving effective treatment of intervertebral disc degeneration, significantly reducing cell mortality and oxidative stress damage, promoting extracellular matrix synthesis, and maintaining intervertebral disc function.
Patent Information
- Application Number
- CN202510851336.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-24
- Publication Date
- 2025-09-23
AI Technical Summary
In the existing technology, the application of high-concentration recombinant human periostin in the treatment of intervertebral disc degeneration ignores the anti-inflammatory potential of low-concentration recombinant human periostin on intervertebral disc nucleus pulposus cells, and lacks functional verification data centered on flow cytometry, which leads to the aggravation of IDD progression.
Low concentrations of recombinant human periostin (100-200 ng/mL) are used to inhibit tumor necrosis factor-α-induced inflammatory damage to intervertebral disc nucleus pulposus cells, upregulate the expression of type II collagen and aggrecan, downregulate the expression of metalloproteinase 13, promote cell proliferation, and prepare a drug for the treatment of intervertebral disc degeneration.
Significantly reduce the cell death rate of intervertebral disc nucleus pulposus, reduce oxidative stress damage, promote extracellular matrix synthesis, maintain intervertebral disc tissue function, achieve targeted anti-inflammatory protection, and effectively delay the progression of IDD.
Smart Images

Figure CN120678891A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the application of low-concentration recombinant human periostin in the preparation of a drug for treating intervertebral disc degeneration. Background Art
[0002] The intervertebral disc is a critical buffering structure within the spinal motion unit. Intervertebral disc degeneration (IDD) is a major cause of low back pain and spinal dysfunction. The intervertebral disc is composed of the nucleus pulposus (NP), annulus fibrosus, and cartilage endplates. Nucleus pulposus cells (NP) maintain the biomechanical function of the disc by synthesizing extracellular matrix proteins such as type II collagen and aggrecan. Studies have shown that inflammatory factors such as tumor necrosis factor-α (TNF-α) play a key role in the pathological progression of IDD. TNF-α activates the nuclear factor κB (NF-κB) pathway, inducing excessive reactive oxygen species (ROS) production in NP cells, disrupting cellular redox homeostasis while inhibiting glutathione peroxidase 4 (GPX4) activity and exacerbating lipid peroxidation. TNF-α also upregulates matrix metalloproteinase 13 (MMP13) expression, accelerating collagen II and Aggrecan degradation, ultimately leading to nucleus pulposus matrix breakdown and tissue functional decline. Prior art anti-inflammatory interventions for IDD have largely focused on the use of high-concentration recombinant human periostin (rPOSTN), with published concentrations generally ≥1 μg / mL. However, the anti-inflammatory potential of low-concentration rPOSTN on NP cells has been overlooked, and functional validation data based on flow cytometry are lacking. Therefore, the development of low-concentration rPOSTN in vitro anti-inflammatory strategies is urgently needed to precisely protect NP cells and delay IDD progression. Summary of the Invention
[0003] The present invention aims to provide the use of low-concentration recombinant human periostin in the preparation of a drug for treating intervertebral disc degeneration. The low-concentration recombinant human periostin can significantly reduce TNF-α-induced intervertebral disc nucleus pulposus cell death rate, effectively alleviate oxidative stress damage, upregulate the expression of Collagen II and Aggrecan, while downregulating the expression of MMP 13, promoting cell proliferation, and treating intervertebral disc degeneration.
[0004] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:
[0005] Application of low-concentration recombinant human periostin in the preparation of drugs for the treatment of intervertebral disc degeneration.
[0006] Preferably, the concentration of recombinant human periostin in the drug is 100-200 ng / mL.
[0007] Preferably, the drug treats intervertebral disc degeneration by inhibiting inflammatory damage to intervertebral disc nucleus pulposus cells induced by tumor necrosis factor-α.
[0008] Preferably, the drug treats intervertebral disc degeneration by upregulating the expression of type II collagen and aggrecan, downregulating the expression of metalloproteinase 13, and promoting cell proliferation.
[0009] The present invention also provides a pharmaceutical composition comprising a therapeutically effective amount of the recombinant human periostin.
[0010] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
[0011] Preferably, the pharmaceutical composition is used to inhibit tumor necrosis factor-α-induced inflammatory damage to intervertebral disc nucleus pulposus cells and treat intervertebral disc degeneration.
[0012] The present invention also provides the use of POSTN gene as a drug target in the preparation of drugs for improving intervertebral disc degeneration.
[0013] Preferably, the expression product of the POSTN gene is the recombinant human periostin as claimed in claim 1, and the synthesis amount of the recombinant human periostin is regulated by regulating the expression of the POSTN gene.
[0014] Preferably, the inhibition of tumor necrosis factor-α-induced inflammatory damage to intervertebral disc nucleus pulposus cells is achieved by regulating POSTN gene expression, wherein the regulating POSTN gene expression is overexpressing the POSTN gene.
[0015] Compared with the prior art, the present invention has the following advantages and technical effects:
[0016] The present invention discloses the use of low-concentration recombinant human periostin in the preparation of drugs for treating intervertebral disc degeneration. Low-concentration recombinant human periostin is used to perform anti-inflammatory intervention on intervertebral disc nucleus pulposus cells. In the TNF-α-induced inflammatory model, the NP cell mortality rate can be reduced from 14.9% in the model group to 5.2% and 3.8% respectively, and the intracellular ROS level is significantly reduced, the accumulation of iron ions and the degree of lipid peroxidation are inhibited, and oxidative stress damage is effectively alleviated. Western blot verification shows that rPOSTN can upregulate the expression of CollagenII and Aggrecan by more than 3 times, while downregulating the expression of MMP 13, thereby promoting extracellular matrix synthesis, inhibiting matrix degradation, and maintaining intervertebral disc tissue function. The present invention uses low-dose rPOSTN to achieve targeted anti-inflammatory protection, effectively maintain NP cell matrix synthesis and vitality, and can be used as a potential molecular intervention method for conservative treatment of IDD.
[0017] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 The statistical results of cell death rates in each treatment group in Example 1 are shown in Table 1. Figure 1 A in the figure is the flow detection counts graph, Figure 1 B in the equation is PI + Rate statistics chart;
[0019] Figure 2 The statistical results of ROS levels in cells of each treatment group in Example 1 are as follows: Figure 2 A in the figure is the flow detection counts graph, Figure 2 The B in the code stands for ROS. + Rate statistics chart;
[0020] Figure 3 is the intracellular Fe 2+ Aggregation level, Figure 3 A in the figure is the flow detection counts graph, Figure 3 B in the figure is the statistical graph of the average fluorescence intensity;
[0021] Figure 4 This is the fluorescence image of cells in each treatment group after JC-1 staining in Example 1. Figure 4 A in the figure is the fluorescence image. Figure 4 B in the figure is a statistical graph of the fluorescence intensity ratio;
[0022] Figure 5 The expression results of matrix protein and degradation enzyme in each treatment group in Example 1;
[0023] Figure 6 The mortality rates of the overexpression control group (Con-OE group), the overexpression POSTN group (OE group), the knockdown control group (Con-SH group), and the knockdown POSTN group (SH-2 group) in Example 1 under the stimulation of the same concentration of TNF-α are shown in Table 1. Figure 6 A in the figure is the flow detection counts graph, Figure 6 B is the PI of Con-OE group and OE group + Rate value statistics chart, Figure 6 C in the figure represents the PI of Con-SH group and SH-2 group + Rate value statistics chart. DETAILED DESCRIPTION
[0024] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.
[0025] Unless otherwise defined, technical or scientific terms used in the present invention shall have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.
[0026] Source of test materials:
[0027] Recombinant human periostin (rPOSTN) was purchased from Ablome at concentrations ranging from 100 ng / mL to 200 ng / mL.
[0028] DMEM / F12 culture medium included 10% FBS and 1% double antibody.
[0029] The final concentration of TNF-α was 200 ng / mL.
[0030] Primary antibodies: Collagen II (1:1000), Aggrecan (1:1000), β-Actin (1:5000);
[0031] Secondary antibody: HRP-conjugated goat anti-rabbit / mouse (1:5000).
[0032] In the present invention, unless otherwise specified, other test materials and instruments and equipment are conventional test materials in this field and can be purchased through commercial channels.
[0033] Example 1
[0034] Cell sources and culture conditions:
[0035] Primary human NP cells were obtained from healthy donor intervertebral discs. After collagenase digestion and isolation, cell phenotype was confirmed using Collagen II and Aggrecan immunofluorescence (Collagen II). Cells were cultured in DMEM / F12 medium at 37°C in a 5% CO2 incubator for 24 hours. Cells were passaged to P3 and used in all experiments.
[0036] After the P3 cells adhered to the wall, they were seeded in 6-well plates (3×10 5 cells / well), and 24 hours later, the cells were divided into the following four groups; TNF-α and / or rPOSTN (100 ng / mL, 200 ng / mL) were added simultaneously according to the groups, and the cells were cultured at 37°C, 5% CO2 for 24 hours.
[0037] Trial groups:
[0038] (1) Control group: no TNF-α, rPOSTN 0 ng / mL.
[0039] (2) TNF-α model group: TNF-α 200 ng / mL, rPOSTN 0 ng / mL.
[0040] (3) rPOSTN 100 ng / mL intervention group: TNF-α 200 ng / mL + rPOSTN 100 ng / mL.
[0041] (4) rPOSTN 200 ng / mL intervention group: TNF-α 200 ng / mL + rPOSTN 200 ng / mL.
[0042] Main detection methods:
[0043] 1. Cell death rate (PI staining + flow cytometry).
[0044] The experimental protocol is as follows: PI staining: After the above-mentioned P3 cell treatment, the cells were washed twice with PBS; the cells were collected and resuspended in 500 μL PBS, PI staining solution (1 μg / mL) was added, and incubated in the dark for 10 min; red fluorescence was detected by flow cytometry at 540 mm, and ≥1×10 4 The FlowJo software counted the proportion of PI-positive cells. Figure 1 .
[0045] Depend on Figure 1 It can be seen that the rPOSTN 100 ng / mL and 200 ng / mL groups reduced the TNF-α-induced mortality rate from 14.9% in the model group to 5.2% and 3.8%, respectively.
[0046] 2. ROS levels (DCFH-DA staining + flow cytometry)
[0047] The experimental plan is as follows: After the above-mentioned P3 generation cells were treated, they were stained with 10 μM DCFH-DA for 30 min at 37°C in the dark; after washing twice, the cells were collected and flow cytometry was used to detect the green fluorescence intensity at 530 nm to quantify the relative ROS level. At least 1×10 4 The average fluorescence intensity of DCFH-DA was calculated using FlowJo software. Figure 2 .
[0048] Depend on Figure 2 It can be seen that compared with the TNF-α model group, the mean fluorescence intensity of ROS in the rPOSTN 100 ng / mL intervention group and the rPOSTN 200 ng / mL intervention group decreased by 33% and 51%, respectively.
[0049] 3. Intracellular Fe 2+ Level (FerroOrange staining + flow cytometry)
[0050] The experimental scheme is as follows: After the above P3 cell treatment, the cells were stained with 1 μM FerroOrange for 30 min at 37°C in the dark; after washing, the orange-red fluorescence was detected by flow cytometry at 543 nm to evaluate the Fe 2+ Accumulation. Collect at least 1×10 4 The FlowJo software counted the BODIPY-C11 positive rate. Figure 3 .
[0051] Depend on Figure 3 As shown in A, the iron ion aggregation level was alleviated after adding POSTN.
[0052] Depend on Figure 3 As shown in B, the rPOSTN 100ng / mL intervention group and the rPOSTN 200ng / mL intervention group had the highest Fe 2+ The positive ratio decreased by 8% compared with the TNF-α model group.
[0053] 4. JC-1 Staining
[0054] The experimental plan is as follows: After the above P3 cells are treated, they are stained with 1 μM JC-1 for 30 minutes at 37°C in the dark; after washing, the fluorescence intensity is observed and photographed using a confocal microscope, and the red and green fluorescence intensities are quantified and counted. Figure 4 .
[0055] Depend on Figure 4 It can be seen that TNF-α causes imbalance of mitochondrial membrane potential.
[0056] 5. Matrix Protein and Degradation Enzyme Expression (Western Blot)
[0057] The experimental plan is as follows:
[0058] (1) Protein extraction: RIPA lysis followed by centrifugation at 12,000 × g for 15 min;
[0059] (2) Electrophoresis transfer: After treatment, collect cell lysate for quantification; load 30 μg protein; perform 10% SDS-PAGE electrophoresis and transfer to PVDF membrane;
[0060] (3) Antibody incubation: primary antibody at 4°C overnight; secondary antibody at room temperature for 1 hour;
[0061] (4) ECL development, ImageJ normalization of β-Actin and quantitative analysis. Figure 5 .
[0062] Depend on Figure 5 It can be seen that the expression of Collagen II and Aggrecan in the rPOSTN group was upregulated by 3 times.
[0063] 6. POSTN gene overexpression (POSTN OE), the experimental plan is as follows: a lentiviral vector (pLenti-CMV-POSTN) is used to construct the POSTN overexpression lentiviral nucleotide sequence shown in SEQ ID NO.1; primary human NP cells are infected and screened to obtain a stable overexpression cell line.
[0064] SEQ ID NO.1:
[0065]
[0066] POSTN gene knockdown (POSTN ShRNA), the experimental plan is as follows: the shRNA (Sh-2) nucleotide sequence targeting POSTN mRNA is designed as shown in SEQ ID NO.2, and it is cloned into the Lv-ShPOSTN vector; human primary NP cells are infected with lentivirus to obtain a stable knockdown cell line.
[0067] SEQ ID NO.2: CAGCGCCTCCTTAAATTAATT
[0068] The experimental plan is as follows:
[0069] Overexpression control group (Con-OE group), overexpression group (OE group), knockdown control group (Con-SH group), and knockdown group (SH-2 group) of POSTN were stimulated with different concentrations of TNF-α (0, 100, 200, and 400 ng / mL) for 24 h. After treatment, the cells were washed twice with PBS. The cells were collected and resuspended in 500 μL PBS, and PI staining solution (1 μg / mL) was added. The cells were incubated in the dark for 10 min. Red fluorescence was detected by flow cytometry at 540 mm. ≥1×10 4 The tube without PI dye was used as the negative tube to determine the PI+ fluorescence intensity range, and the FlowJo software was used to calculate the proportion of PI-positive cells. Figure 6 .
[0070] Depend on Figure 6 It can be seen that the mortality rate of the OE group was significantly lower than that of the Con-OE group, indicating that overexpression of POSTN can enhance the inflammatory resistance of nucleus pulposus cells. The mortality rate of the SH-2 group was significantly higher than that of the Con-SH group, indicating that knocking down POSTN would increase the mortality rate of cells under inflammatory stimulation, which is consistent with the results of the overexpression group.
[0071] It is further explained that since POSTN is a paracrine protein, cells are not only affected by endogenous transcription and translation of POSTN protein, but also by paracrine POSTN of surrounding cells. Therefore, in the present invention, lentiviral knockdown overexpression is used to simulate the increase or decrease of endogenous POSTN translation, and exogenous rPOSTN is used to simulate the effect of exogenous POSTN on cells under the paracrine effect, which together verify the protective effect of POSTN on nucleus pulposus cells under inflammatory stimulation, that is, low concentration of POSTN has the effect of protecting intervertebral disc cells.
[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. Application of low-concentration recombinant human periostin in the preparation of drugs for the treatment of intervertebral disc degeneration.
2. The application according to claim 1, characterized in that The application concentration of the recombinant human periostin in the medicine is 100-200 ng / mL.
3. The application according to claim 1, characterized in that The drug treats intervertebral disc degeneration by inhibiting inflammatory damage of intervertebral disc nucleus pulposus cells induced by tumor necrosis factor-α.
4. The application according to claim 1, characterized in that The drug treats intervertebral disc degeneration by upregulating the expression of type II collagen and aggrecan, downregulating the expression of metalloproteinase 13, and promoting cell proliferation.
5. A pharmaceutical composition, characterized in that The invention comprises a therapeutically effective amount of the recombinant human periostin according to claim 1.
6. The pharmaceutical composition according to claim 4, characterized in that The pharmaceutical composition further includes a pharmaceutically acceptable carrier.
7. The pharmaceutical composition according to claim 4, characterized in that The pharmaceutical composition is used for inhibiting inflammatory damage of intervertebral disc nucleus pulposus cells induced by tumor necrosis factor-α and treating intervertebral disc degeneration.
8. Application of POSTN gene as a drug target in the preparation of drugs to improve intervertebral disc degeneration.
9. The use according to claim 1 or 8, characterized in that: The expression product of the POSTN gene is the recombinant human periostin according to claim 1, and the synthesis amount of the recombinant human periostin is regulated by regulating the expression of the POSTN gene.
10. The use according to claim 8, characterized in that: The inhibition of tumor necrosis factor-α-induced inflammatory damage to intervertebral disc nucleus pulposus cells is achieved by regulating POSTN gene expression, wherein the regulation of POSTN gene expression is overexpression of POSTN gene.