Application of CRM1-PROM2 signal axis inhibitor in preparation of gastric cancer cell ferroptosis inducer sensitizer, anti-gastric cancer drug and predictive marker

Abstract

The invention belongs to the technical field of biological medicine, and discloses application of a CRM1-PROM2 signal axis inhibitor in preparation of a gastric cancer cell ferroptosis inducer sensitizer, an anti-gastric cancer drug and a predictive marker. In the application provided by the invention, the CRM1-PROM2 signal axis is destroyed or inhibited by the CRM1-PROM2 signal axis inhibitor, so that the level of PROM2 in gastric cancer cytoplasm can be reduced, and then downstream KEAP1 / NRF2, FPN iron ion efflux and other ferroptosis resistance related signal axes are interfered, so that the ferroptosis sensitivity of gastric cancer cells is improved, and the treatment effect of the ferroptosis inducer on gastric cancer is enhanced; and the inhibitor shows certain targeting property in the aspect of enhancing the treatment effect of the ferroptosis inducer on the gastric cancer, and has important significance in realizing accurate diagnosis and treatment of the gastric cancer.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to the use of a CRM1-PROM2 signaling axis inhibitor in the preparation of a gastric cancer cell ferroptosis inducer sensitizer, an anti-gastric cancer drug, and a predictive marker. Background Art

[0002] Gastric cancer is one of the most lethal malignancies worldwide. Surgical resection remains the cornerstone of gastric cancer treatment, but it is often associated with poor prognosis and high recurrence rates. The pathogenesis of gastric cancer is complex and multifactorial, and the molecular mechanisms of its development and progression have not yet been fully elucidated. Therefore, analyzing the molecular characteristics of gastric cancer and identifying specific therapeutic targets are crucial for achieving precise diagnosis and treatment of gastric cancer.

[0003] Ferroptosis refers to an iron-dependent regulated cell death (RCD) pattern of death with unique morphological and biochemical characteristics. It primarily involves iron-dependent phospholipid peroxidation and is meticulously regulated by multiple signaling pathways, including redox homeostasis, iron metabolism, mitochondrial function, amino acid metabolism, lipid metabolism, glucose metabolism, and disease-related pathways. Notably, drug-resistant tumor cells, particularly those in the mesenchymal state and with a high propensity for metastasis, exhibit increased sensitivity to ferroptosis. Therefore, inducing or inhibiting ferroptosis could serve as a therapeutic target for precision diagnosis and treatment of gastric cancer. For example, the ferroptosis activator erastin competitively binds to CDO1, limiting glutathione (GSH) synthesis and inducing ferroptosis. The anti-angiogenic targeted drug apatinib, which induces lipid peroxidation by downregulating GPX4 expression in gastric cancer, is a potential candidate for gastric cancer treatment. However, these ferroptosis inducers, when used in gastric cancer treatment, suffer from limitations such as insufficient targeting and inherent resistance mechanisms, resulting in suboptimal therapeutic efficacy.

[0004] Therefore, exploring the potential mechanism of ferroptosis in gastric cancer cells and discovering ferroptosis-related targets are of great significance for the diagnosis and treatment of gastric cancer. Summary of the Invention

[0005] After extensive and in-depth research and a large number of experiments, the inventors of the present invention creatively discovered that although ferroptosis inducers such as RSL3 and Erastin can inhibit cell proliferation and induce cell ferroptosis when acting on gastric cancer cells, they also increase the expression of PROM2 and promote its nuclear-cytoplasmic transport, causing a significant increase in the level of PROM2 in gastric cancer cells, thereby activating the expression of antioxidant-related genes and iron ion efflux-related genes, reducing the sensitivity of gastric cancer cells to ferroptosis inducers, leading to the emergence of drug resistance problems.

[0006] Therefore, the inventors conducted further in-depth research and creatively discovered that PROM2 protein and CRM1 protein specifically show a highly correlated upregulated expression trend in gastric cancer tissues, and CRM1 protein can specifically bind to PROM2 protein and mediate the nucleocytoplasmic translocation of PROM2 protein. By destroying or inhibiting the CRM1-PROM2 signaling axis that realizes the nucleocytoplasmic translocation of PROM2, the level of PROM2 in the cytoplasm is reduced, the cellular oxidation level is increased, and iron efflux is reduced, thereby delaying or preventing the occurrence of ferroptosis resistance, thereby enhancing the sensitivity of gastric cancer cells to ferroptosis inducers.

[0007] The CRM1 protein-mediated PROM2 nuclear-cytoplasmic translocation is highly correlated with the sensitivity of gastric cancer cells to ferroptosis inducers. By disrupting or inhibiting the CRM1-PROM2 signaling axis, the sensitivity of gastric cancer cells to ferroptosis inducers can be increased. In this case, the CRM1-PROM2 signaling axis and ferroptosis inducers are used for combined treatment of gastric cancer. The two can play a synergistic role to enhance the therapeutic effect on gastric cancer; or by detecting the expression levels of related proteins in the CRM1-PROM2 signaling axis, the ferroptosis sensitivity of gastric cancer cells can be assessed to predict the therapeutic effect of ferroptosis inducers on gastric cancer. Based on this, the technical solution of the present invention is obtained.

[0008] In a first aspect, the present invention provides the use of a CRM1-PROM2 signaling axis inhibitor in the preparation of a sensitizer for ferroptosis inducers in gastric cancer cells.

[0009] Specifically, compared with adjacent normal tissues, gastric cancer tissues have significantly co-expressed CRM1 protein and PROM2 protein. The destruction or inhibition of the CRM1-PROM2 signaling axis by the CRM1-PROM2 signaling axis inhibitor can reduce the level of PROM2 in the cytoplasm of gastric cancer cells, thereby interfering with iron death resistance-related signaling axes such as KEAP1 / NRF2 and FPN iron ion efflux, thereby increasing the iron death sensitivity of gastric cancer cells and enhancing the therapeutic effect of iron death inducers on gastric cancer. The inhibitor also shows a certain degree of targeting in enhancing the therapeutic effect of iron death inducers on gastric cancer.

[0010] In the present invention, the CRM1-PROM2 signaling axis inhibitor refers to a class of substances that can inhibit CRM1 expression, inhibit CRM1 activity, inhibit PROM2 expression, inhibit PROM2 activity, hinder the binding process of CRM1 and PROM2, or destroy the structure of the CRM1-PROM2 protein complex. Specific examples include but are not limited to: one or more of: CRM1 expression inhibitors, CRM1 inhibitors, PROM2 expression inhibitors, PROM2 inhibitors and CRM1-PROM2 protein complex dissociation agents.

[0011] Specifically, the CRM1 expression inhibitor refers to a class of compounds that can inhibit the expression of CRM1; the CRM1 inhibitor refers to a class of compounds that can destroy the structure of CRM1 and inactivate it; the PROM2 expression inhibitor refers to a class of compounds that can inhibit the expression of PROM2; the PROM2 inhibitor refers to a class of compounds that can destroy the structure of PROM2 and inactivate it.

[0012] In some specific embodiments, the CRM1-PROM2 signaling axis inhibitor is preferably shRNA CRM1, and the shRNA CRM1 inhibits CRM1 expression by targeting and binding to the mRNA transcribed from the XPO1 (CRM1) gene, and the nucleotide sequence of the shRNA CRM1 is specifically shown in SEQ ID NO: 3 and / or SEQ ID NO: 4. In this case, the CRM1-PROM2 signaling axis inhibitor can knock down or knock out the expression of CRM1 to disrupt the CRM1-PROM2 signaling axis in gastric cancer cells, block PROM2 nuclear and cytoplasmic transport, and ultimately increase the sensitivity of gastric cancer cells to ferroptosis inducers.

[0013] In some specific embodiments, the CRM1-PROM2 signaling axis inhibitor is preferably a CRM1 inhibitor, and specific examples of the CRM1 inhibitor include, but are not limited to, one or more of Leptomycin B, CRM1-IN-2, KPT-276, KPT-251, and KPT-185. In this case, the CRM1-PROM2 signaling axis inhibitor can inhibit the function of CRM1, preventing the binding between CRM1 and PROM2, thereby disrupting the CRM1-PROM2 signaling axis in gastric cancer cells, blocking PROM2 nuclear-cytoplasmic translocation, and ultimately increasing the sensitivity of gastric cancer cells to ferroptosis-inducing agents.

[0014] In some specific embodiments, the CRM1-PROM2 signaling axis inhibitor is preferably shRNA PROM2, and the shRNA PROM2 inhibits PROM2 expression by targeting and binding to the mRNA transcribed from the PROM2 gene, and the nucleotide sequence of the shRNA PROM2 is specifically shown in SEQ ID NO: 1 and / or SEQ ID NO: 2. In this case, the CRM1-PROM2 signaling axis inhibitor can knock down or knock out the expression of PROM2 to disrupt the CRM1-PROM2 signaling axis in gastric cancer cells, increase the ferroptosis sensitivity of gastric cancer cells, and synergistically enhance the gastric cancer treatment effect of ferroptosis inducers.

[0015] In a second aspect, the present invention provides an anti-tumor drug comprising a CRM1-PROM2 signaling axis inhibitor and a ferroptosis inducer.

[0016] Specifically, CRM1-PROM2 signaling axis inhibitors enhance the ferroptosis sensitivity of gastric cancer cells by targetedly interfering with the abnormally upregulated co-expression of PROM2 and CRM1 in gastric cancer cells, and synergistically cooperate to enhance the therapeutic effect of ferroptosis inducers on gastric cancer.

[0017] In the present invention, the CRM1-PROM2 signaling axis inhibitor is the above-mentioned CRM1-PROM2 signaling axis inhibitor.

[0018] In the present invention, the ferroptosis inducer refers to a class of compounds that can induce ferroptosis in cells, and specific examples include but are not limited to: one or more of type I inducers, type II inducers, type III inducers and type IV inducers.

[0019] Specifically, the type I inducer refers to a class of compounds that can inhibit the cystine / glutamate antiporter (systemxc-) to reduce the uptake of cystine; the type II inducer refers to a class of compounds that can inhibit glutathione peroxidase 4 to induce ferroptosis; the type III inducer refers to a class of compounds that can consume coenzyme Q10 to promote ferroptosis; the type IV inducer refers to a class of compounds that can enhance ferroptosis sensitivity through iron overload or other pathways.

[0020] In some specific embodiments, the ferroptosis inducer is preferably RSL3 and / or Erastin. In this case, the CRM1-PROM2 signaling axis inhibitor exhibits excellent activity in increasing the sensitivity of gastric cancer cells to ferroptosis induced by RSL3 and Erastin, and the two can better cooperate with each other to provide the anti-gastric cancer drug with a better therapeutic effect.

[0021] In a third aspect, the present invention provides the use of the CRM1-PROM2 signaling axis as a predictive marker for ferroptosis sensitivity of gastric cancer cells for non-diagnostic purposes.

[0022] Specifically, when gastric cancer cells are treated with ferroptosis inducers, the significant co-expression of intracellular CRM1-PROM2 signaling axis-related proteins is significantly correlated with the activation of metabolic activities related to ferroptosis resistance, such as antioxidant and iron metabolism. By detecting CRM1-PROM2 signaling axis-related proteins, the sensitivity of gastric cancer cells to ferroptosis inducers can be predicted.

[0023] In a fourth aspect, the present invention provides a predictive marker for ferroptosis sensitivity of gastric cancer cells, which specifically includes: XPO1 (CRM1) gene, its mRNA and expressed protein, and antibodies thereto; PROM2 gene, its mRNA and expressed protein, and antibodies thereto; and / or, CRM1-PROM2 protein complex and antibodies thereto.

[0024] Specifically, in this predictive marker: based on the expression level of the XPO1 gene, by detecting the mRNA and / or CRM1 protein expressed thereby, or by using an antibody that can specifically bind to the mRNA encoding the CRM1 protein and / or the CRM1 protein as a detection substance, the tolerance and / or sensitivity of gastric cancer tissue to ferroptosis inducers can be judged; based on the expression level of the PROM2 gene, by detecting the mRNA and / or PROM2 protein expressed thereby, or by using an antibody that can specifically bind to the mRNA encoding the PROM2 protein and / or the PROM2 protein as a detection substance, the tolerance and / or sensitivity of gastric cancer tissue to ferroptosis inducers can be judged; based on the presence level of the CRM1-PROM2 protein complex, by detecting the CRM1-PROM2 protein complex or an antibody that can specifically bind to the CRM1-PROM2 protein complex as a detection substance, the tolerance and / or sensitivity of gastric cancer tissue to ferroptosis inducers can be judged. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a cell morphology image of gastric cancer cell SGC7901 after treatment with the ferroptosis inducers RSL3 and Erastin for 24 hours as provided in Example 1 of the present invention (scale: 100 μm);

[0026] Figure 2 This is a cell morphology image of gastric cancer cell MGC803 after treatment with the ferroptosis inducers RSL3 and Erastin provided in Example 1 of the present invention for 24 hours (scale: 100 μm);

[0027] Figure 3 This is a morphological image of ferroptosis in gastric cancer cells after treatment with the ferroptosis inducer RSL3 provided in Example 1 of the present invention for 24 hours (scale is 2 μm);

[0028] Figure 4 This is a graph showing the experimental results of a CKK-8 cell viability test on gastric cancer cell SGC7901 after the gastric cancer cell SGC7901 was treated with the ferroptosis inducer RSL3 for 24 hours as provided in Example 1 of the present invention;

[0029] Figure 5This is a graph showing the experimental results of a CKK-8 cell viability test on gastric cancer cell SGC7901 cells after treatment with the ferroptosis inducer Erastin for 24 hours as provided in Example 1 of the present invention;

[0030] Figure 6 This is a graph showing the experimental results of a CKK-8 cell viability test on gastric cancer cells SGC7901 after treating gastric cancer cells MGC803 with the ferroptosis inducer RSL3 for 24 hours as provided in Example 1 of the present invention;

[0031] Figure 7 This is a graph showing the experimental results of the CKK-8 cell viability test of gastric cancer cells SGC7901 after treating gastric cancer cells MGC803 with the ferroptosis inducer Erastin for 24 hours as provided in Example 1 of the present invention;

[0032] Figure 8 This is a graph showing the experimental results of a cell proliferation test on gastric cancer cell SGC7901 after treatment with the ferroptosis inducers RSL3 and Erastin for 6 hours as provided in Example 1 of the present invention (scale: 2 μm);

[0033] Figure 9 This is a graph showing the experimental results of a cell proliferation test on gastric cancer cells MGC803 after treatment with the ferroptosis inducers RSL3 and Erastin for 6 hours as provided in Example 1 of the present invention (scale: 2 μm);

[0034] Figure 10 This is a graph showing the experimental results of a cell proliferation test on gastric cancer cell SGC7901 after treatment with the ferroptosis inducer RSL3 for 6 hours (the percentage of EdU-positive cells) provided in Example 1 of the present invention;

[0035] Figure 11 This is a graph showing the experimental results of a cell proliferation test on gastric cancer cell SGC7901 after treatment with the ferroptosis inducer Erastin for 6 hours (the percentage of EdU-positive cells) provided in Example 1 of the present invention;

[0036] Figure 12 This is a graph showing the experimental results of a cell proliferation test on gastric cancer cells MGC803 after treatment with the ferroptosis inducer RSL3 for 6 hours (the percentage of EdU-positive cells) provided in Example 1 of the present invention;

[0037] Figure 13This is a graph showing the experimental results of a cell proliferation test on gastric cancer cells MGC803 (percentage of EdU-positive cells) after treatment with the ferroptosis inducer Erastin for 6 hours, as provided in Example 1 of the present invention;

[0038] Figure 14 This is a graph showing the experimental results of the change in PROM2 protein expression level in gastric cancer cell SGC7901 over culture time after the gastric cancer cell SGC7901 was treated with the ferroptosis inducer RSL3 provided in Example 1 of the present invention;

[0039] Figure 15 This is a graph showing the experimental results of the change in PROM2 protein expression level in gastric cancer cell BGC823 over culture time after the gastric cancer cell BGC823 was treated with the ferroptosis inducer RSL3 provided in Example 1 of the present invention;

[0040] Figure 16 This is a graph showing the experimental results of the change in PROM2 protein expression level in gastric cancer cell SGC7901 with the dose of RSL3 after the gastric cancer cell SGC7901 was treated with the ferroptosis inducer RSL3 provided in Example 1 of the present invention;

[0041] Figure 17 This is a graph showing the experimental results of the change in PROM2 protein expression level in gastric cancer cell BGC823 with the dose of RSL3 after the gastric cancer cell BGC823 was treated with the ferroptosis inducer RSL3 provided in Example 1 of the present invention;

[0042] Figure 18 Figure 1 of the experimental results of the level and localization of PROM2 protein in gastric cancer cell SGC7901 after treatment of gastric cancer cell SGC7901 with the ferroptosis inducer RSL3 provided in Example 1 of the present invention (scale bar is 100 μm);

[0043] Figure 19 Figure 2 shows the experimental results of the level and localization of PROM2 protein in gastric cancer cell SGC7901 cells after treatment with the ferroptosis inducer RSL3 provided in Example 1 of the present invention;

[0044] Figure 20 Figure 1 of the experimental results of the level and localization of PROM2 protein in gastric cancer cell BGC823 cells after treatment with the ferroptosis inducer RSL3 provided in Example 1 of the present invention (scale bar is 100 μm);

[0045] Figure 21Figure 2 shows the experimental results of the level and localization of PROM2 protein in gastric cancer cell BGC823 cells after treatment with the ferroptosis inducer RSL3 provided in Example 1 of the present invention;

[0046] Figure 22 Figure 1 of the experimental results of the level and localization of PROM2 protein in gastric cancer cells MGC803 after treatment with the ferroptosis inducer RSL3 provided in Example 1 of the present invention (scale bar: 100 μm);

[0047] Figure 23 Figure 2 shows the experimental results of the level and localization of PROM2 protein in gastric cancer cells MGC803 after treatment with the ferroptosis inducer RSL3 provided in Example 1 of the present invention;

[0048] Figure 24 Cell status diagram of shCtrl cells and shPROM2 cells after treatment with the ferroptosis inducer RSL3 provided in Example 1 of the present invention (scale is 100 μm)

[0049] Figure 25 This is a graph showing the experimental results of the cell activity of shCtrl cells and shPROM2 cells after they were treated with the ferroptosis inducer RSL3 provided in Example 1 of the present invention;

[0050] Figure 26 This is a graph showing the experimental results of GSH levels in shCtrl cells and shPROM2 cells after they were treated with the ferroptosis inducer RSL3 provided in Example 1 of the present invention;

[0051] Figure 27 After the shCtrl cells and shPROM2 cells were treated with the ferroptosis inducer RSL3 provided in Example 1 of the present invention, the Fe 2+ Horizontal experimental result graph;

[0052] Figure 28 After treating shCtrl cells and shPROM2 cells with the ferroptosis inducer RSL3 provided in Example 1 of the present invention, the structure of mitochondria in the cells was observed by electron microscopy;

[0053] Figure 29 This is a graph showing the experimental results of the relative expression level of PROM2 protein in 75 gastric cancer tissue chips provided in Example 2 of the present invention;

[0054] Figure 30 This is a graph showing the experimental results of the correlation between the relative expression level of PROM2 protein and gastric cancer stages in 75 gastric cancer tissue chips provided in Example 2 of the present invention;

[0055] Figure 31 This is a graph showing the differential expression of CRM1 / XPO1 in normal samples and STAD primary tumor samples provided in Example 2 of the present invention;

[0056] Figure 32 This is a graph showing the experimental results of the relative expression levels of PROM2 protein in 14 groups of matched tumor / normal tissue samples provided in Example 2 of the present invention (N: normal tissue sample, T: tumor tissue sample);

[0057] Figure 33 This is a graph showing the experimental results of the relative expression levels of the CRM1 protein in 14 groups of matched tumor / normal tissue samples provided in Example 2 of the present invention (N: normal tissue samples, T: tumor tissue samples);

[0058] Figure 34 This is a graph showing the correlation between the expression of PROM2 protein and CRM1 protein in 14 groups of matched tumor / normal tissue samples provided in Example 2 of the present invention;

[0059] Figure 35 This is a graph showing the experimental results of the changes in the expression levels of KEAP1 and NRF2 proteins along with the expression levels of PROM2 protein in gastric cancer cells provided in Example 2 of the present invention;

[0060] Figure 36 This is one of the Co-IP experimental results provided in Example 3 of the present invention for verifying the interaction between PROM2 protein and CRM1 protein;

[0061] Figure 37 Figure 2 is the Co-IP experimental result for verifying the interaction between PROM2 protein and CRM1 protein provided in Example 3 of the present invention;

[0062] Figure 38 The 3D structural model of the PROM2-CRM1 interaction complex predicted by AlphaFold3 provided in Example 3 of the present invention;

[0063] Figure 39 Detailed diagram of the key sites of the PROM2-CRM1 interaction complex predicted by AlphaFold3 provided in Example 3 of the present invention;

[0064] Figure 40Figure 1 of the experimental results showing the level and localization of PROM2 protein in gastric cancer cell SGC7901 cells after treatment with the ferroptosis inducer RSL3 alone or in combination with the CRM1 protein inhibitor LMB provided in Example 3 of the present invention (scale bar: 100 μm);

[0065] Figure 41 Figure 2 shows the experimental results of the levels and localization of PROM2 protein in gastric cancer cells SGC7901 after treatment with the ferroptosis inducer RSL3 alone or in combination with the CRM1 protein inhibitor LMB, as provided in Example 3 of the present invention (scale bar: 100 μm);

[0066] Figure 42 Figure 3 shows the experimental results of the presence and localization of PROM2 protein in shCtrl cells after treatment with the ferroptosis inducer RSL3 provided in Example 3 of the present invention (scale is 100 μm)

[0067] Figure 43 Figure 3 shows the experimental results of the presence and localization of PROM2 protein in shCRM1 cells after treatment with the ferroptosis inducer RSL3 in Example 3 of the present invention (scale: 100 μm)

[0068] Figure 44 Provides a Co-IP experimental result diagram for verifying the correlation between RSL3 and the binding between PROM2 protein and CRM1 protein in Example 3 of the present invention;

[0069] Figure 45 Provides a Co-IP experimental result diagram for verifying the correlation between LMB and PROM2 protein-CRM1 protein binding in Example 3 of the present invention;

[0070] Figure 46 This is a graph showing the experimental results of the relative levels of ROS in shCtrl cells and shCRM1 cells after they were treated with the ferroptosis inducer RSL3 as provided in Example 3 of the present invention;

[0071] Figure 47 After the shCtrl cells and shCRM1 cells were treated with the ferroptosis inducer RSL3 provided in Example 3 of the present invention, the Fe 2+ Experimental results of concentration;

[0072] Figure 48This is one of the results of the experiment showing that knocking down PROM2 can enhance the ferroptosis sensitivity of gastric cancer tissues provided in Example 4 of the present invention (changes in tumor volume with drug administration time);

[0073] Figure 49 Figure 2 (tumor photo) shows the results of an experiment showing that knocking down PROM2 can enhance the ferroptosis sensitivity of gastric cancer tissues as provided in Example 4 of the present invention;

[0074] Figure 50 Figure 3 (tumor mass) shows the results of an experiment showing that knocking down PROM2 can enhance the ferroptosis sensitivity of gastric cancer tissues as provided in Example 4 of the present invention;

[0075] Figure 51 This is one of the results of the experiment on enhancing the ferroptosis sensitivity of gastric cancer tissue by knocking down CRM1 provided in Example 4 of the present invention (a graph showing the change of tumor volume with drug administration time);

[0076] Figure 52 Figure 2 (tumor photo) shows the results of an experiment showing that knocking down CRM1 can enhance the ferroptosis sensitivity of gastric cancer tissues as provided in Example 4 of the present invention;

[0077] Figure 53 Figure 3 (tumor mass) shows the results of the experiment showing that knocking down CRM1 can enhance the ferroptosis sensitivity of gastric cancer tissues as provided in Example 4 of the present invention.

[0078] Note: *p<0.05, **p<0.01, ***p<0.001 DETAILED DESCRIPTION

[0079] The embodiments of the present invention are described in detail below. The examples of the embodiments are intended to explain the present invention and are not to be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this area or according to the product specifications. Reagents or instruments used that do not specify the manufacturer are all conventional products that can be obtained commercially.

[0080] It should be noted that the steps, reagents and conditions not mentioned in the experiments described in the following examples are all prior art and can be carried out by referring to existing published patent documents or non-patent documents.

[0081] Example 1

[0082] This example is used to illustrate the correlation between the PROM2 protein level in gastric cancer cells and ferroptosis-induced gastric cancer cell ferroptosis by ferroptosis inducers, specifically including:

[0083] 1. Ferroptosis inducers induce cellular ferroptosis and increase the expression of PROM2 protein

[0084] (1) Gastric cancer cells SGC7901 and MGC803 were inoculated at a seeding volume of 500 cells / well into RPMI-1640 medium (purchased from Gibco) containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The cells were cultured at 37°C, 5% CO2, and saturated humidity until the cells adhered to the wall. Then, different concentrations of ferroptosis inducers RSL3 and Erastin were added and the culture was continued for 24 h. The cell morphology was observed under a microscope, and the cell viability was detected using a CCK-8 kit (purchased from Biyuntian Biotechnology) according to the instructions. The reagents and conditions used in each group during the test were kept consistent. The results are shown in Figure 2. Figures 1 to 7 shown.

[0085] Depend on Figure 1 and 2 As shown in the results 4 to 7, the ferroptosis inducers RSL3 and Erastin showed dose-dependent growth inhibition on gastric cancer cells SGC7901 and MGC803. Figure 3 The results shown in the figure show that after treatment with the ferroptosis inducer RSL3, the mitochondria of gastric cancer cells SGC7901 and MGC803 were condensed, the outer membrane was ruptured, the cristae collapsed, and the abundance of lysosomes increased, showing a characteristic ferroptosis morphology.

[0086] (2) Gastric cancer cells SGC7901 and MGC803 were inoculated at a seeding volume of 500 cells / well into RPMI-1640 medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The cells were cultured at 37°C, 5% CO2, and saturated humidity until the cells adhered to the wall. 8 μM RSL3 and 15 μM Erastin were then added, respectively, and the culture was continued for 6 h. Cell proliferation was evaluated using a cell proliferation detection kit (purchased from Guangzhou Ruibo Biotechnology), and an equal volume of DMSO was used as a blank control. The reagents and conditions used in each group remained consistent during the test. The results are shown in Figure 2. Figures 8 to 13 shown.

[0087] Depend on Figures 8 to 13 The results shown show that compared with the blank control group, the synthesis of intracellular DNA was significantly reduced after the gastric cancer cells SGC7901 and MGC803 were treated with ferroptosis inducers RSL3 and Erastin, and RSL3 and Erastin inhibited the proliferation of tumor cells.

[0088] (3) Gastric cancer cells SGC7901 and BGC823 were inoculated at a density of 500 cells / well into RPMI-1640 medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The cells were cultured at 37°C, 5% CO2, and saturated humidity until the cells adhered to the wall. 8 μM RSL3 was then added and cultured. During the culture process, samples were taken and the cell pellets were collected by centrifugation. The cells were washed twice with PBS buffer (pH = 7.4) precooled to 4°C and resuspended in an appropriate amount of cell lysis buffer. After incubation on ice for 10 minutes, NP-40 was added at a final concentration of 0.5% (v / v). The cells were centrifuged at 15,000 g for 15 minutes. The supernatant was collected for Western blot analysis. The reagents and conditions used in each group remained consistent. The results are shown in Figure 2. Figure 14 and 15 shown.

[0089] The cell lysis buffer includes: 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10 mM NaF, 20 mM β-glycerophosphate, 1 mM sodium orthovanadate, 1 mM PMSF, 10 μg / mL leupeptin, 2 μg / mL aprotinin, 1% Triton X-100 and 1 mM EDTA.

[0090] (4) Gastric cancer cells SGC7901 and BGC823 were inoculated at a seeding volume of 500 cells / well into RPMI-1640 medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The cells were cultured at 37°C, 5% CO2, and saturated humidity until the cells adhered to the wall. Then, different concentrations of RSL3 were added and the culture was continued for 6 hours. The cell pellets were collected by centrifugation and washed twice with PBS buffer (pH = 7.4) precooled to 4°C. The cells were resuspended in an appropriate amount of cell lysis buffer and incubated on ice for 10 minutes. NP-40 was added at a final concentration of 0.5% (v / v). The cells were centrifuged at 15,000 g for 15 minutes. The supernatant was collected for Western blot analysis. The reagents and conditions used in each group remained consistent during the test. The results are shown in Figure 2. Figure 16 and 17 shown.

[0091] Depend on Figures 14-17 The results shown in the figure show that treatment of gastric cancer cells with the ferroptosis inducer RSL3 induced an increase in PROM2 protein expression in tumor cells, and this induction effect was time-dependent and dose-dependent.

[0092] 2. Ferroptosis inducers promote the nuclear-cytoplasmic transport of PROM2 protein

[0093] Gastric cancer cells SGC7901 and BGC823 were inoculated at a density of 500 cells / well in RPMI-1640 medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The cells were cultured at 37°C, 5% CO2, and saturated humidity until the cells adhered to the wall. 8 μM RSL3 was then added and cultured for 6 h. The culture medium was removed and the cells were rinsed three times with PBS solution. The cells were fixed with 4% paraformaldehyde at room temperature for 15 min, rinsed three times with PBS solution, and then incubated with 0.1% TritonX-100 at room temperature for 10 min. The cells were then blocked with 5% BSA at room temperature for 30 min. The gastric cancer cells blocked with BSA were incubated with PROM2 antibody at 4°C overnight. The cells were then rinsed three times with PBS solution and fluorescently labeled secondary antibody (purchased from Santa Clara, CA) was added dropwise. Cruz) at room temperature in the dark for 10 minutes, then DAPI staining solution was added and incubated at room temperature in the dark for 10 minutes, the slides were sealed and observed, and the relative expression level of PROM2 protein was calculated based on the staining intensity. An equal volume of DMSO was used as a blank control, and the reagents and conditions used in each group during the test were kept consistent. The results are shown in Figure 2. Figures 18-23 shown.

[0094] Depend on Figures 18-23 The results shown in the figure show that when gastric cancer cells are treated with the ferroptosis inducer RSL3, the level of PROM2 in the cytoplasm is significantly increased. RSL3 can induce the upregulation of PROM2 protein expression in tumor cells and promote its nuclear-cytoplasmic translocation, resulting in a synchronous upward trend in the PROM2 levels in the cell nucleus and cytoplasm.

[0095] 3. Knockdown of PROM2 promotes ferroptosis-induced ferroptosis in gastric cancer cells

[0096] (1) References [1] In the provided method, gastric cancer cell line SGC7901 is used to construct shCtrl cells and shPROM2 cells, and the nucleotide sequence of the shRNA CPROM2 used is shown in SEQ ID NO: 1;

[0097] shCtrl cells and shPROM2 cells were inoculated at a density of 500 cells / well in RPMI-1640 medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The cells were cultured at 37°C, 5% CO2, and saturated humidity until they adhered to the wall. After treatment with 8 μM RSL3 for 6 h, the cell morphology was observed under a microscope. The cell activity, GSH, and Fe expression were detected using CCK-8 kit, GSH detection kit (purchased from Tongren Chemical), and iron colorimetric assay kit (purchased from Abcam) according to the instructions. 2+ The test results were as follows: Figures 24-28 shown.

[0098] [1]Hou JJ, Wang L, Zhao JB, Zhuo HQ, Cheng J, Chen PMID:WOS:000681470300013.

[0099] Depend on Figures 24-28 The results show that knockdown of PROM2 expression can cooperate with RSL3 to deplete intracellular glutathione and increase Fe 2+ concentration and induced mitochondrial membrane rupture, achieving a better ferroptosis induction effect on gastric cancer cells.

[0100] Example 2

[0101] This example is used to illustrate the expression of the CRM1-PROM2 signaling axis in gastric cancer, specifically including:

[0102] (1) An immunochromatographic kit (purchased from Shanghai Youningwei Biotechnology) was used to stain and dewax 75 gastric cancer tissue chips (including gastric cancer and adjacent normal tissue samples) provided by Shanghai Aotoduo Biotechnology Co., Ltd. according to the instructions. Then, an antigen repair instrument was used to repair the gastric cancer tissue chips according to the instructions. After completion, the chips were placed in distilled water and cooled at room temperature for 20 minutes. PROM2 antibody (purchased from Abcam) was used to incubate the antigen-repaired gastric cancer tissue chips at 4°C overnight. After rinsing with PBS solution three times, fluorescently labeled secondary antibodies were added and incubated at room temperature for 10 minutes. The chips were then stained and sealed. An Aperio scanner (Aperio XT, Leica) was used to capture chip images. The relative expression level of PROM2 protein was calculated based on the staining intensity. The reagents and conditions used in the immunohistochemical staining of each gastric cancer tissue chip were consistent. The results are shown in Figure 2. Figure 29 and 30 shown.

[0103] Depend on Figure 29 and 30 The results shown show that the expression of PROM2 protein in gastric cancer tissue is significantly higher than that in adjacent normal tissue; and the expression level of PROM2 protein gradually increases with the development of gastric cancer, that is, the expression of PROM2 protein is highly correlated with the development of gastric cancer.

[0104] (2) The UALCAN database was used to analyze the expression differences of the XPO1 gene (encoding CRM1) in normal samples and primary gastric adenocarcinoma tumor samples. Figure 31 shown.

[0105] Depend on Figure 31 The results shown show that the expression level of XPO1 gene in primary tumor samples of gastric adenocarcinoma is higher than that in normal samples, which means that CRM1 protein expression is highly correlated with gastric cancer.

[0106] (3) Using TRIzol TM Plus RNA purification kit (purchased from Thermo Fisher Scientific) was used to extract total RNA from 14 matched tumor / normal tissue samples according to the instructions to obtain RNA samples. RNA-Seq was performed on the RNA samples to calculate the relative expression levels of PROM2 protein and CRM1 protein in tumor tissues. The results are shown in Figure 2. Figures 32-34 shown.

[0107] Depend on Figures 32-34The results shown show that among the 14 matched tumor / normal tissue samples, PROM2 expression was upregulated in 12 tumor tissue samples, accounting for 85.7%; CRM1 expression was upregulated in 9 tumor tissue samples, accounting for 64.3%. CRM1 and PROM2 were significantly co-expressed in gastric cancer tissues and showed a strong positive correlation.

[0108] (4) Gastric cancer cells SGC7901 and BCG823 were inoculated at a seeding volume of 500 cells / well into RPMI-1640 medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The cells were cultured overnight at 37°C, 5% CO2, and saturated humidity. The cell pellets were collected by centrifugation and washed twice with PBS buffer (pH = 7.4) precooled to 4°C. The cells were resuspended in an appropriate amount of cell lysis buffer and incubated on ice for 10 minutes. NP-40 was added at a final concentration of 0.5% (v / v). The cells were centrifuged at 15,000 g for 15 minutes, and the supernatant was collected for Western blot analysis. The reagents and conditions used in each group remained consistent during the test. The results are shown in Figure 2. Figure 35 shown.

[0109] Depend on Figure 35 The results shown in the figure show that the upregulation of PROM2 protein expression in gastric cancer cells increases the expression level of NRF2 protein, and the KEAP1 protein level also changes. The significant co-expression of CRM1-PROM2 in gastric cancer cells can affect its downstream KEAP1-NRF2 signaling axis, thereby affecting the cell ferroptosis process.

[0110] Example 3

[0111] This example is used to illustrate the correlation between the CRM1-PROM2 signaling axis and ferroptosis-induced gastric cancer cell ferroptosis, specifically including:

[0112] 1. CRM1 protein mediates the nucleocytoplasmic transport of PROM2 protein

[0113] (1) 293T cells were seeded at a volume of 500 cells / well in RPMI-1640 medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The cells were cultured at 37°C, 5% CO2, and saturated humidity until the cells adhered to the wall. The plasmids expressing Flag-PROM2, Flag-CRM1, and HA-PROM2 were loaded into the Turbofect reagent (purchased from Invitrogen) according to the instructions. The cells were transfected into 293T cells and cultured for 48 h. The cell pellets were collected by centrifugation and washed twice with PBS buffer (pH = 7.4) pre-cooled to 4°C. The cells were resuspended in an appropriate amount of cell lysis buffer and incubated on ice for 10 min. NP-40 was added at a final concentration of 0.5% (v / v). The cells were centrifuged at 15,000 g for 15 min, and the supernatant was collected. The supernatant was used for co-immunoprecipitation (Co-IP) experiments. 100 μL of Ran GTP was added to each experimental group to facilitate interaction analysis. The reagents and conditions used in the test were consistent for each group. The results are shown in Figure 2. Figure 36 and 37 shown.

[0114] Depend on Figure 36 and 37 It can be seen that there is an interaction between PROM2 protein and CRM1 protein, that is, PROM2 is a new interacting protein of CRM1.

[0115] (2) AlphaFold3 was used to predict the potential binding interface between PROM2 protein and CRM1 protein. The results are as follows Figure 38 and 39 shown.

[0116] Depend on Figure 38 and 39 The results show that the three-dimensional conformations of PROM2 protein and CRM1 protein are highly complementary, and amino acid residues such as 531K and 752R in PROM2 protein interact with amino acid residues such as 568K and 14L in CRM1 protein to achieve the binding of the two and stabilize the structure of the resulting complex.

[0117] (3) Gastric cancer cells SGC7901 were seeded in RPMI-1640 medium containing 10% fetal bovine serum, 100 U / mL penicillin and 100 μg / mL streptomycin at a seeding volume of 500 cells / well. Myc-PROM2 plasmid was transfected into gastric cancer cells SGC7901 using Turbofect reagent according to the instructions. The cells were cultured at 37°C, 5% CO2 and saturated humidity until the cells adhered to the wall. Gastric cancer cells SGC7901 were treated with 8 μM RSL3 alone or 8 μM RSL3 and 100 nM leptomycin B (LMB) and cultured for 6 h. The culture medium was removed and the cells were rinsed 3 times with PBS solution. The cells were fixed with 4% paraformaldehyde at room temperature for 15 min, rinsed 3 times with PBS solution, and then incubated with 0.1% Triton X-100 at room temperature for 10 min. The cells were blocked with 5% BSA at room temperature for 30 min. Myc tag antibody (purchased from Santa Clara, CA) was taken. Cruz) were used to incubate gastric cancer cells blocked with BSA at 4°C overnight; then, after rinsing with PBS solution three times, fluorescently labeled secondary antibodies (purchased from Santa Cruz) were added dropwise and incubated at room temperature in the dark for 10 minutes. DAPI staining solution was then added and incubated at room temperature in the dark for 10 minutes. The slides were sealed and observed. The relative expression level of PROM2 protein was calculated based on the staining intensity. An equal volume of DMSO was used as a blank control. The reagents and conditions used in each experimental group remained consistent during the test. The results are shown in the figure. Figure 40 and 41 shown.

[0118] Depend on Figure 40 and 41 The results shown in the figure show that treatment of gastric cancer cell SGC7901 with RSL3 alone or in combination with RSL3 and LMB increased the level of PROM2 protein in gastric cancer cell SGC7901; in addition, compared with RSL3 treatment alone, the level of PROM2 protein in the cell nucleus of gastric cancer cell SGC7901 treated with RSL3 and LMB combined was significantly increased, while the level of ROM2 protein in the cytoplasm was decreased, and the nuclear-cytoplasmic transport of PROM2 protein was inhibited with the inhibition of CRM1 protein, that is, CRM1 protein plays an important role in RSL3-induced PROM2 nuclear-cytoplasmic transport in gastric cancer cells.

[0119] (4) References [2] In the provided method, gastric cancer cell line SGC7901 is used to construct shCtrl cells and shCRM1 cells, and the nucleotide sequence of the shRNA CRM1 used is shown in SEQ ID NO: 3;

[0120] shCtrl cells and shCRM1 cells were inoculated at a density of 500 cells / well in RPMI-1640 medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The cells were cultured at 37°C, 5% CO2, and saturated humidity until they adhered to the wall. 8 μM RSL3 was used for each treatment for 6 h. The culture medium was removed and the cells were rinsed three times with PBS solution. The cells were fixed with 4% paraformaldehyde at room temperature for 15 min, rinsed three times with PBS solution, and then incubated with 0.1% Triton X-100 at room temperature for 10 min. The cells were then blocked with 5% BSA at room temperature for 30 min. PROM2 antibody and CRM1 antibody (purchased from Santa Cruz) were used. Biotechnologies) were used to incubate gastric cancer cells blocked with BSA at 4°C overnight; then, after rinsing with PBS solution three times, the corresponding fluorescently labeled secondary antibody was added dropwise and incubated at room temperature in the dark for 10 minutes. DAPI staining solution was added and incubated at room temperature in the dark for 10 minutes. The slides were sealed and observed. The relative expression level of PROM2 protein was calculated based on the staining intensity. An equal volume of DMSO was used as a blank control. The reagents and conditions used in each experimental group during the test were consistent. The results are shown in the figure. Figure 42 and 43 shown.

[0121] [2]Hou JJ, Jiang SH, Zhao JB, Zhu D, Zhao XM, Cai JC, et al. PMID:WOS:000414415000079.

[0122] Depend on Figure 42 and 43 The results shown in the figure show that compared with shCtrl cells, in the shCRM1 cells obtained by further knocking down CRM1 in gastric cancer cell SGC7901, the knockdown of CRM1 led to the blockade of PROM2 nucleocytoplasmic translocation, while PROM2 protein accumulated in the cell nucleus in large quantities, further indicating that CRM1 protein plays an important role in RSL3-induced PROM2 nucleocytoplasmic translocation in gastric cancer cells.

[0123] 2. Correlation between the CRM1-PROM2 signaling axis and ferroptosis-induced cell ferroptosis

[0124] (1) 293T cells were seeded at a volume of 500 cells / well in RPMI-1640 medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin. The cells were cultured at 37°C, 5% CO2, and saturated humidity until the cells adhered to the wall. The plasmid vector expressing Flag-PROM2 was transfected into the 293T cells using Turbofect reagent according to the instructions. The cells were cultured for 48 h. The cell pellet was collected by centrifugation and washed with PBS buffer (pH 7.0) pre-cooled to 4°C. =7.4) After washing the cells twice, they were resuspended in an appropriate amount of buffer A and incubated on ice for 10 minutes. NP-40 was then added to a final concentration of 0.5% (v / v). The cells were centrifuged at 15,000 g for 15 minutes, and the supernatant was collected. The supernatant was used for co-immunoprecipitation (Co-IP) experiments. In the Co-IP experiments of the RSL3 group, 4 μM RSL3 was also added, and in the Co-IP experiments of the LMB group, 50 nM LMB was also added. 100 μL of Ran GTP was added to each experimental group to facilitate interaction analysis. The reagents and conditions used in the experiments were consistent for each experimental group. The results are shown in FIG. Figure 44 and 45 shown.

[0125] Depend on Figure 44 and 45 The results shown show that RSL3 can enhance the binding between CRM1 protein and PROM2 protein, while LMB can disrupt the binding between CRM1 protein and PROM2 protein.

[0126] (2) References [2] The method provided herein comprises the following steps: taking gastric cancer cell SGC7901 to construct shCtrl cells and shCRM1 cells; taking shCtrl cells and shCRM1 cells at a seeding volume of 500 cells / well and inoculating them into RPMI-1640 medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin, and culturing them at 37°C, 5% CO2, and saturated humidity until the cells adhere to the wall, and treating them with 8 μM RSL3 for 6 hours, and then using a ROS detection kit (purchased from Tongren Chemical) and an iron colorimetric assay kit according to the instructions for ROS and Fe 2+ The test results were as follows: Figure 46 and 47 shown.

[0127] Depend on Figure 46 and 47The results shown in the figure show that knockdown of CRM1 in gastric cancer cell SGC7901 not only disrupts the nucleocytoplasmic translocation of PROM2 protein, but also enhances the sensitivity of gastric cancer cells to RSL3-induced ferroptosis by upregulating intracellular ROS levels and promoting iron release.

[0128] comprehensive Figures 36-47 The results shown in the figure show that ferroptosis inducers such as RSL3 can induce the upregulation of PROM2 protein expression and the increase of its nuclear and cytoplasmic transport. The nuclear and cytoplasmic transport of PROM2 protein induced by ferroptosis inducers such as RSL3 is regulated by CRM1 protein, and the inhibition or destruction of the CRM1-PROM2 signaling axis can increase the ferroptosis sensitivity of gastric cancer cells.

[0129] Example 4

[0130] This example is used to illustrate a strategy for enhancing the ferroptosis sensitivity of gastric cancer cells based on the CRM1-PROM2 signaling axis, specifically including:

[0131] 1. Knockdown of PROM2 enhances ferroptosis sensitivity in gastric cancer tissues

[0132] (1) References [1] According to the provided method, gastric cancer cell SGC7901 was used to construct shCtrl cells and shPROM2 cells.

[0133] (2) Six-week-old nude mice (provided by the Experimental Animal Center of Xiamen University) were used as experimental subjects. After one week of adaptive feeding on a standard diet, mice were treated with shCtrl cells or shPROM2 cells according to the registered research protocol (approved by the Institutional Medical Ethics Committee of Zhongshan Hospital Affiliated to Xiamen University, protocol number xmzsyyky-2020-060). After continuing to feed on a standard diet for one week, the mice were dosed according to the following groups:

[0134] Control group I (shCtrl cell model, N=6): Mice were injected with DMSO at a dose of 10 mg / kg every 72 h and fed a standard diet during the administration period;

[0135] Control group II (shCtrl cell model, N=6): RSL3 was injected into mice at a dose of 10 mg / kg every 72 h, and a standard diet was provided during the administration period;

[0136] Experimental group I (shPROM2 cell model, N=6): Mice were injected with DMSO at a dose of 10 mg / kg every 72 h and maintained on a standard diet during the administration period.

[0137] Experimental group II (shPROM2 cell model, N=6): RSL3 was injected into mice at a dose of 10 mg / kg every 72 h, and a standard diet was maintained during the administration period;

[0138] (3) The tumor volume of mice was measured on the 10th, 13th, 16th, 19th, and 22nd day after administration (tumor volume = minimum diameter × maximum diameter). 2 ×0.5), and the average value was taken; and after the administration, the mice were killed by dislocation of the neck, and the tumor tissues were removed and weighed. Figures 48-50 shown.

[0139] Depend on Figures 48-50 The results show that compared with the control group I, the tumor volume and mass of mice in experimental group I were significantly reduced, indicating that knocking down PROM2 to inhibit the CRM1-PROM2 signaling axis in gastric cancer cells can inhibit the growth of xenograft tumors in mice. Compared with the control group II, the tumor volume and mass of mice in experimental group I were significantly reduced, indicating that knocking down PROM2 to inhibit the CRM1-PROM2 signaling axis in gastric cancer cells can significantly enhance the sensitivity of xenograft tumors in mice to the ferroptosis inducer RSL3, thereby more effectively controlling tumor growth.

[0140] 2. Knockdown of CRM1 enhances the ferroptosis sensitivity of gastric cancer cells

[0141] (1) References [2] According to the provided method, gastric cancer cell line SGC7901 was used to construct shCtrl cells and shCRM1 cells;

[0142] (2) Six-week-old nude mice (provided by the Experimental Animal Center of Xiamen University) were used as experimental subjects. After one week of adaptive feeding on a standard diet, mice were treated with shCtrl cells or shCRM1 cells according to the registered research protocol (approved by the Institutional Medical Ethics Committee of Zhongshan Hospital Affiliated to Xiamen University, protocol number xmzsyyky-2020-060). After continuing to feed on a standard diet for one week, the mice were dosed according to the following groups:

[0143] Control group I (shCtrl cell model, N=5): Mice were injected with DMSO at a dose of 10 mg / kg every 72 h and fed a standard diet during the administration period;

[0144] Control group II (shCtrl cell model, N=5): RSL3 was injected into mice at a dose of 10 mg / kg every 72 h, and a standard diet was provided during the administration period;

[0145] Experimental group (shCRM1 cell model, N=5): RSL3 was injected into mice at a dose of 10 mg / kg every 72 h, and a standard diet was provided during the administration period;

[0146] (3) The tumor volume of mice was measured on days 10, 13, 16, 19, and 22 of drug administration, and the average value was taken. After the end of drug administration, the mice were killed by cervical dislocation, and the tumor tissues were removed and weighed. The results are as follows: Figures 51-53 shown.

[0147] Depend on Figures 51-53 The results shown show that compared with the control groups I and II, the tumor volume and mass of mice in the experimental group were significantly reduced, indicating that knocking down CRM1 to inhibit the CRM1-PROM2 signaling axis in gastric cancer cells can significantly enhance the sensitivity of xenograft tumors in mice to the ferroptosis inducer RSL3, thereby more effectively controlling tumor growth.

[0148] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and purpose of the present invention.

[0149] The sequences involved in the present invention are shown in Table 1:

[0150] Table 1.

[0151] name SEQ ID NO: sequence shRNA PROM2-I 1 GCAGGCCGTGGCACAGCAATT shRNA PROM2-II 2 GGACAGTCCTGCAGCTCAACG shRNA CRM1-I 3 CCTGCTTTCAAGGAACATTTA shRNA CRM1-II 4 TGTGGTGAATTGCTTATACCA

Claims

1. Application of CRM1-PROM2 signaling axis inhibitors in the preparation of sensitizers for ferroptosis inducers in gastric cancer cells.

2. The use according to claim 1, characterized in that The CRM1-PROM2 signaling axis inhibitor includes one or more of a CRM1 expression inhibitor, a CRM1 inhibitor, a PROM2 expression inhibitor, a PROM2 inhibitor, and a CRM1-PROM2 protein complex dissociating agent.

3. The use according to claim 1, characterized in that The CRM1-PROM2 signaling axis inhibitor is shRNACRM1, and the nucleotide sequence of the shRNA CRM1 is shown in SEQ ID NO: 3 and / or SEQ ID NO:

4.

4. The use according to claim 1, characterized in that The CRM1 inhibitor is selected from one or more of Leptomycin B, CRM1-IN-2, KPT-276, KPT-251 and KPT-185.

5. The use according to claim 1, characterized in that The CRM1-PROM2 signaling axis inhibitor is shRNAPROM2, and the nucleotide sequence of the shRNAPROM2 is shown in SEQ ID NO: 1 and / or SEQ ID NO:

2.

6. An anti-gastric cancer drug, characterized in that: The anti-gastric cancer drug includes a CRM1-PROM2 signaling axis inhibitor and a ferroptosis inducer.

7. The anti-gastric cancer drug according to claim 6, characterized in that The CRM1-PROM2 signaling axis inhibitor is the CRM1-PROM2 signaling axis inhibitor according to any one of claims 2 to 5.

8. The anti-gastric cancer drug according to claim 6, characterized in that The ferroptosis inducer is RSL3 and / or Erastin.

9. Application of the CRM1-PROM2 signaling axis as a predictive marker for sensitivity of gastric cancer cells to ferroptosis inducers for non-diagnostic purposes.

10. A predictive marker for the sensitivity of gastric cancer cells to ferroptosis inducers, characterized in that: The predictive markers include: XPO1 gene, its mRNA and expressed protein, and its antibodies; PROM2 gene, its mRNA and expressed protein, and its antibodies; and / or, CRM1-PROM2 protein complex and antibodies thereto.

Images