Marker, probe set, kit and detection method for thyroid cancer related gene detection
By developing a 37-gene detection probe set and kit related to thyroid cancer, the accuracy problem of early detection of thyroid cancer has been solved, and the simultaneous detection of multiple gene mutations has been achieved, supporting individualized management and genetic counseling.
Patent Information
- Application Number
- CN202510794392.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-13
- Publication Date
- 2025-09-23
AI Technical Summary
Existing technologies make it difficult to accurately determine whether thyroid cancer is benign or malignant, especially since the BRAF gene is less mutated in follicular thyroid cancer, making early detection of thyroid cancer difficult.
Develop a 37-gene detection probe set and kit related to thyroid cancer, which can simultaneously detect somatic gene SNVs/Indels variations, germline SNPs/Indels variations, SV variations, and CNV variations. By designing probe sets and primers that specifically amplify 37 gene exons and hotspot introns, combined with high-throughput sequencing and bioinformatics analysis, the detection accuracy is improved.
It improves the accuracy of thyroid cancer detection, guides individualized testing and management, supports genetic counseling, and can detect multiple gene mutations and fusion variations to meet the risk assessment of hereditary tumors.
Smart Images

Figure BDA0005449298570000081 
Figure BDA0005449298570000091
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene detection technology, and in particular to markers, probe sets, kits and detection methods for thyroid cancer-related gene detection. Background Art
[0002] Thyroid cancer is a malignant tumor originating from the thyroid follicular epithelium or parafollicular epithelial cells and is the most common malignant tumor of the head and neck.
[0003] Thyroid cancer is divided into differentiated thyroid cancer (DTC), medullary thyroid cancer (MTC), and anaplastic thyroid cancer (ATC). DTC is further divided into papillary thyroid cancer (PTC) and follicular thyroid cancer (FTC). Each type of thyroid cancer varies in its degree of malignancy, leading to significantly different treatments and prognoses. DTC is the most common clinically, accounting for approximately 90% of cases. While the prognosis is generally good, some patients may develop local organ invasion, cervical lymph node metastasis, or distant organ metastasis in the early stages of thyroid cancer, severely impacting their quality of life and survival. Poorly differentiated thyroid cancer (PDTC) is generally considered to arise from DTC, with biological behavior intermediate between DTC and ATC. While papillary thyroid microcarcinoma (PTMC) generally has a good prognosis, 15%–20% of patients experience recurrence, cervical lymph node metastasis, or distant organ metastasis, which can be life-threatening.
[0004] Research has found that mutations in multiple genes are crucial for the development, metastasis, and prognosis of thyroid cancer. For example, the BRAF gene has been the most extensively studied in thyroid FNA cytopathology. The BRAF mutation rate in PTC can reach 80%, and the mutation rate is even higher in Asian populations. Thyroid nodules with BRAF mutations have a 99.8% risk of malignancy. Studies have shown that BRAF mutations occur in 15% to 39% of Bethesda class I and III nodules. Literature reports indicate that patients with BRAF gene mutations are prone to iodine resistance and require significantly higher radioactive iodine doses than patients with wild-type BRAF gene mutations. BARF gene mutations are closely associated with iodine resistance in recurrent thyroid cancer. BARF gene mutations primarily downregulate iodine metabolism-related genes such as NIS, TSHR, SLC26A4, TPO, and TG. Thyroid nodules can be tested for certain thyroid cancer molecular markers, such as BRAF mutations, RAS mutations, and RET / PTC rearrangements, in biopsy specimens, helping to improve the diagnostic accuracy. Preoperative testing for BRAF mutation status also aids in the diagnosis and clinical prognosis of PTC, facilitating the development of personalized treatment plans. Therefore, the BRAF gene is a very important tumor marker for PTC (papillary thyroid carcinoma).
[0005] However, the BRAF gene is rarely mutated in FTC (follicular thyroid carcinoma) and rarely mutated in benign nodules. FNA (fine needle aspiration biopsy) cannot determine whether the substance is benign or malignant, which greatly increases the difficulty of accurately determining the diagnosis of all thyroid cancers.
[0006] Therefore, there is an urgent need to further research and develop relevant gene markers, probe sets and detection methods for thyroid cancer to facilitate the early detection and diagnosis of all thyroid cancers. Summary of the Invention
[0007] In view of this, the purpose of the present invention is to develop markers, probe groups, kits and detection methods for thyroid cancer-related gene detection, provide detection probe groups for 37 genes related to thyroid cancer, provide detection kits for 37 genes related to thyroid cancer, provide detection methods for 37 genes related to thyroid cancer, and at the same time provide some new markers related to thyroid cancer, which can simultaneously detect somatic gene SNVs / Indels variations, germline SNPs / Indels variations, SV variations, and CNV variations, so as to improve detection accuracy, guide detection decisions and conduct genetic counseling, and provide strong support for individualized detection and management of thyroid cancer patients.
[0008] The present invention provides markers for thyroid cancer-related gene detection, including: 37 gene exons and hotspot introns. The gene list of the 37 gene exons and hotspot introns is as follows:
[0009] AKT1, ALK, APC, AXIN1, BRAF, CCDC6, CTNNB1, EGFR, EIF1AX, GNAS, HRAS, KIT, KRAS, MET, MTOR, NCOA4, NF1, NKX2-1, NRAS, NT RK1, NTRK2, NTRK3, PAX8, PIK3CA, PPARG, PTCH1, PTEN, RET, TERT, TP53, TSHR, CDC73, DICER1, IDH1, MEN1, CDKN1B, PRKAR1A.
[0010] The present invention also provides a probe set for detecting thyroid cancer-related genes, the probe set being used to specifically amplify at least one of the gene markers according to claim 1, the probe set comprising probes having nucleotide sequences of SEQ ID NO.01 to SEQ ID NO.70;
[0011] The probe set further comprises a primer, the nucleotide sequence of which is:
[0012] 5′-bio-GACTACATGGGACAT-3;
[0013] 5′-GGAACCTACGACGTA-3′.
[0014] Specifically, the method for preparing the probe group includes the following steps:
[0015] Obtain the mutation regions of 37 gene exons and hotspot introns from the UCSC or NCBI database and extend them 50 bp before and after. ; The gene list of the 37 gene exons and hotspot introns is as follows:
[0016] AKT1, ALK, APC, AXIN1, BRAF, CCDC6, CTNNB1, EGFR, EIF1AX, GNAS, HRAS, KIT, KRAS, MET, MTOR, NCOA4, NF1, NKX2-1, NRAS, NT RK1, NTRK2, NTRK3, PAX8, PIK3CA, PPARG, PTCH1, PTEN, RET, TERT, TP53, TSHR, CDC73, DICER1, IDH1, MEN1, CDKN1B, PRKAR1A;
[0017] The reference genome version hg19 was used to extract the reference sequence of each mutation region, and the sequence of the repeated region was removed. The repeated sequence was analyzed using RepeatMask software; starting from the first base, a 120bp or 78bp sequence was intercepted as a probe, and then moved back n bases again, and another 120bp or 78bp sequence was intercepted until the last 120bp or 78bp ; Each region has different n values depending on the GC content of the exon. The higher or lower the GC content, the smaller n is, and the denser the probe design is, which improves the uniformity of capture. The synthetic probe sequence SEQ ID is designed;
[0018] The probe density was adjusted according to the GC content. The calculation formula of the probe density is as follows:
[0019] Dgc = a+a*10*|gc-0.5|
[0020] Where Dgc represents the probe density at a certain GC content; a represents the probe density when the GC content is 50%, which is 20; gc represents the GC content;
[0021] After completing the design and synthesis of the probe sequence, all probes are mixed in equal proportions, and a portion of the mixed probes is used for PCR amplification and biotin labeling. The primer sequences are 5'-bio-GACTACATGGGACAT-3' and 5'-GGAACCTACGACGTA-3' (preferably, sequences matching the primers are added at both ends during the synthesis of the probe sequence);
[0022] The PCR amplification products were purified using commercial purification reagents and then bound using MyOne streptavidin magnetic beads;
[0023] Add NaOH solution for treatment and use 100°C formamide liquid for washing to separate the probe from the magnetic beads;
[0024] Finally, the biotin-labeled probe group was obtained by ethanol precipitation.
[0025] Preferably, the probe group is prepared according to the method of patent CN202011284834.1.
[0026] The present invention also provides a kit for detecting thyroid cancer-related genes, using the probe set described above, comprising:
[0027] Enrichment blocking agent: Use commercial blocking agents, including IDT TS Blocker Mix, BLG Universal Blocker-ILL, Any of the Universal Blocking Oligos;
[0028] Hybridization buffer: an aqueous solution containing 1.25 M NaCl, 0.125 M sodium citrate, 0.1 g / 100 mL BSA, and 7% (v / v) Tween 20;
[0029] Library binding buffer: 10 mM Tris-HCl buffer, pH 7.5, containing 1 M NaCl and 1 mM EDTA;
[0030] Wash buffer 1 : Sodium citrate buffer containing 0.1% (m / v) SDS. Sodium citrate buffer is an aqueous solution containing 175g / L NaCl and 88g / L trisodium citrate; pH 7.4;
[0031] Wash buffer 2 : Sodium citrate buffer diluent containing 0.1% (m / v) SDS. The sodium citrate buffer diluent is a mixture of 1 part sodium citrate buffer and 9 parts water;
[0032] PCR amplification enzyme mix : KAPAHiFi HotStartReadyMix (Roche, KK2601);
[0033] PCR amplification primers: Consists of the following upstream primer and downstream primer sequences:
[0034] AATGATACGGCGACCACCGAG;
[0035] CAAGCAGAAGACGGCATACGA.
[0036] The present invention also provides a method for detecting thyroid cancer-related genes, using the above-described kit for detecting thyroid cancer-related genes, comprising the following steps:
[0037] S1. Nucleic acid preparation, including tissue nucleic acid preparation, blood nucleic acid preparation, and fine needle aspiration nucleic acid preparation. Tissue nucleic acid preparation includes: genomic DNA extraction from paraffin blocks or paraffin sections: 10 μm thick paraffin blocks or 8-10 paraffin sections are taken, and genomic DNA is extracted according to the instructions of the GeneRead DNA FFPE Kit (Qiagen, 180134), followed by Qubit detection of concentration.
[0038] Extraction of genomic DNA from fresh tissue: 25 mg of fresh tissue was used to extract genomic DNA according to the instructions of the universal column-based genomic DNA extraction kit (Kangwei, CWY004), and the concentration was detected by Qubit.
[0039] The blood nucleic acid preparation comprises: taking 300 μL of fresh blood, extracting blood genomic DNA according to the instructions of the magnetic bead nucleic acid extraction kit (Makino, MG0169), and then detecting the concentration by Qubit;
[0040] The fine needle aspiration cell nucleic acid preparation includes: taking 500 μL of fine needle aspiration cells preserved in cell preservation solution, centrifuging at 2000 g for 10 minutes, removing the supernatant, extracting cell genomic DNA according to the instructions of a universal column-based genome extraction kit (Kangwei, CW2298S), and detecting the concentration using Qubit;
[0041] S2. Prelibrary preparation, including:
[0042] Fragmentation: Genomic DNA was fragmented into 150 bp-250 bp using Covaris M220 ultrasound;
[0043] Prelibrary preparation: Prelibrary preparation was performed according to the instructions of the Rapid Max DNALib Prep Kit for Illumina (abclonal, RK20217) and the Unique Dual Index for Illumina (abclonal, RK21626). The basic process for prelibrary preparation is as follows: 50 μL of fragmented genomic DNA was subjected to end repair and 3'A-tailing, adapter ligation, library amplification, and purification to complete library preparation; library fragment size quality control was performed by Qubit detection and agarose gel electrophoresis;
[0044] S3. Preparation of thyroid cancer-related gene targeted library: 500 ng prelibrary, 12 μL blocking agent, 5 μL thyroid-related gene detection probe, 35 μL hybridization buffer, and enzyme-free water were mixed to a total volume of 100 μL and then placed in a PCR amplification instrument for reaction. The reaction procedure was: 95°C for 7 min, 65°C for 12-16 h.
[0045] Place 50 μL of streptavidin magnetic beads (preferably commercial) on a magnetic stand, remove the magnetic bead storage solution, and rinse 2-3 times with binding buffer;
[0046] Keep the hybridization product on the PCR amplification instrument, add the rinsed magnetic bead suspension, pipette and mix, and place it in room temperature for 1 hour;
[0047] Place on a magnetic stand and discard the liquid, add 500 μL of wash buffer 1, and rotate on a rotary mixer for 15 minutes. During this time, preheat wash buffer 2 at 65°C.
[0048] Place on a magnetic stand and discard the liquid, add 500 μL of wash buffer 2, and incubate at 65°C on a thermostat for 10 min;
[0049] Place on a magnetic stand to discard the liquid, and repeat washing three times with wash buffer 2;
[0050] Discard the liquid and aspirate it clean. Add 22 μL of enzyme-free water, pipette and mix thoroughly, and transfer to a PCR tube containing amplification mixture (25 μL amplification enzyme mix and 5 μL amplification primers). Mix thoroughly and place in the PCR reaction program. The reaction program is as follows:
[0051] 98℃30sec; 98℃30sec, 65℃30sec, 72℃30sec, 12 cycles; 72℃5min, 4℃∞.
[0052] The PCR amplification product was taken, 50 μL of magnetic beads were added, and purification was performed according to the instructions of the magnetic bead DNA purification and recovery kit (Makino, MG0021);
[0053] The purified product was quality checked using qubit reagent, and the concentration was qualified if it was greater than 1.5;
[0054] S4. High-throughput sequencing: The methylation-targeted enrichment library was subjected to high-throughput sequencing on the Illumina NovaSeq6000 or NextSeqCN500 second-generation sequencing platform to obtain raw sequencing data;
[0055] S5. Bioinformatics analysis includes the following steps:
[0056] (1) Perform quality control on the raw data obtained by sequencing to obtain high-quality clean data;
[0057] (2) Compare the Clean data with the human reference genome sequence to obtain the Bam file;
[0058] (3) Detect and annotate SNV / InDel based on Bam files to obtain all mutation information;
[0059] (4) Somatic SNVs / Indels mutation detection: Use the Mutect2 module in the GATK software (e.g., https: / / gatk.broadinstitute.org / hc / en-us) to perform somatic mutation detection on paired samples (tissue and blood) to obtain SNVs / Indels mutation information; the results of Mutect2 are annotated by simultaneously linking multiple databases (e.g., dbSNP, 1000g, ESP6500, HGMD, OMIM, etc.) using the software ANNOVAR. The annotated data are filtered and the final results are output;
[0060] (5) Germline SNPs / Indels mutation detection: Use the haplotyper module of the GATK software to perform germline mutation detection on normal samples to obtain germline SNPs / Indels variation information. Use the software ANNOVAR to simultaneously link multiple databases (such as dbSNP, 1000g, ESP6500, HGMD, OMIM, etc.) to annotate and filter the above-obtained variants and complete the result output;
[0061] (6) SV variation detection: SV detection was performed on the samples using delly software;
[0062] (7) CNV variation detection: CNV detection was performed on samples using CNVkit software, and copy number changes were detected based on the depth distribution of reads mapped to the reference genome.
[0063] S6. Detection data quality control: Using the described kit and detection method for high-throughput sequencing, the kit achieved an average depth of over 1000x in the target region and over 98% coverage of the target region, with good coverage that meets the requirements for gene mutation, copy number variation, fusion of multiple variation types, and assessment of hereditary tumor risk.
[0064] Preferably, the present invention can also be used for the detection of thyroid cancer-related gene mutations or fusions.
[0065] With the informed consent of the subjects, 60 sets of test samples were collected, including fine needle aspirates, paraffin sections, fresh tissues, blood samples, and blood samples from the subjects' parents. The test samples were tested and analyzed according to the method of Example 2.
[0066] Under the conditions that meet quality control requirements, various types of variation, including target gene mutations, copy number variations, and fusions, were analyzed, and three germline mutations, RET p.M918T, RET p.K1060N, and DICER1 p.D1320RfsX18; 12 systemic mutations, including DICER1 p.E1813D, NRAS p.Q61R, DICER1 p.D1709G, and DICER1 p.D1810H / p.C152WfsX19; and nine fusion mutations, including NCOA4-RET, CCDC6-RET, IRF2BP2-NTRK1, and SQSTM1-NTRK1, were detected.
[0067] Compared with the prior art, the present invention has the following beneficial effects:
[0068] The present invention provides markers, probe groups, kits and detection methods for thyroid cancer-related gene detection, provides a detection probe group for 37 genes related to thyroid cancer, provides a detection kit for 37 genes related to thyroid cancer, provides a detection method for 37 genes related to thyroid cancer, and also provides some new markers related to thyroid cancer, which can simultaneously detect somatic gene SNVs / Indels variations, germline SNPs / Indels variations, SV variations, and CNV variations, which is conducive to improving detection accuracy, guiding detection decisions and conducting genetic counseling, and providing strong support for individualized detection and management of thyroid cancer patients. DETAILED DESCRIPTION
[0069] The exemplary embodiments are described in detail herein. The embodiments described in the following exemplary embodiments do not represent all embodiments consistent with the present disclosure. Instead, they are merely examples of devices and products consistent with some aspects of the present disclosure as detailed in the appended claims.
[0070] The terms used in this disclosure are for the purpose of describing specific embodiments only and are not intended to limit the disclosure. As used in this disclosure and the appended claims, the singular forms "a," "an," "the," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It should also be understood that the term "and / or" as used herein refers to and encompasses any and all possible combinations of one or more of the associated listed items.
[0071] It should be understood that although the terms first, second, third, etc. may be used in this disclosure to describe various information, such information should not be limited to these terms. These terms are only used to distinguish information of the same type from each other. For example, without departing from the scope of this disclosure, first information may also be referred to as second information, and similarly, second information may also be referred to as first information. Depending on the context, the word "if" as used herein may be interpreted as "at the time of" or "when" or "in response to determining."
[0072] The embodiments of the present invention are described in further detail below.
[0073] Example 1
[0074] Design and preparation of probe sets and kits for thyroid cancer-related gene detection:
[0075] The probe and kit were prepared according to the method of patent CN202011284834.1;
[0076] 1. Probe design and preparation: Thyroid cancer-related genes were collected based on literature, guidelines, consensus, and databases. The gene list is as follows:
[0077] AKT1, ALK, APC, AXIN1, BRAF, CCDC6, CTNNB1, EGFR, EIF1AX, GNAS, HRAS, KIT, KRAS, MET, MTOR, NCOA4, NF1, NKX2-1, NRAS, NT RK1, NTRK2, NTRK3, PAX8, PIK3CA, PPARG, PTCH1, PTEN, RET, TERT, TP53, TSHR, CDC73, DICER1, IDH1, MEN1, CDKN1B, PRKAR1A;
[0078] The mutation regions of 37 gene exons and hotspot introns were obtained from the UCSC or NCBI database and extended 50 bp before and after. The gene list of the 37 gene exons and hotspot introns is as follows:
[0079] AKT1, ALK, APC, AXIN1, BRAF, CCDC6, CTNNB1, EGFR, EIF1AX, GNAS, HRAS, KIT, KRAS, MET, MTOR, NCOA4, NF1, NKX2-1, NRAS, NT RK1, NTRK2, NTRK3, PAX8, PIK3CA, PPARG, PTCH1, PTEN, RET, TERT, TP53, TSHR, CDC73, DICER1, IDH1, MEN1, CDKN1B, PRKAR1A;
[0080] The reference genome version hg19 was used to extract the reference sequence of each mutation region, and the sequence of the repeated region was removed. The repeated sequence was analyzed using RepeatMask software; 120bp of sequence was intercepted from the first base as a probe, and then moved back n bases and intercepted another 120bp of sequence until the last 120bp ; Each region has different n values depending on the GC content of the exon. The higher or lower the GC content, the smaller n is, and the denser the probe design is, which improves the uniformity of capture. The synthetic probe sequence SEQ ID is designed;
[0081] The probe density was adjusted according to the GC content. The calculation formula of the probe density is as follows:
[0082] Dgc = a+a*10*|gc-0.5|
[0083] Where Dgc represents the probe density at a certain GC content; a represents the probe density when the GC content is 50%, which is 20; gc represents the GC content;
[0084] After completing the design and synthesis of the probe sequence, all probes were mixed in equal proportions. A portion of the mixed probes was used for PCR amplification and biotin-labeled. The primer sequences were 5'-bio-GACTACATGGGACAT-3' and 5'-GGAACCTACGACGTA-3' (sequences matching the primers were added at both ends during the synthesis of the probe sequence);
[0085] The PCR amplification products were purified using commercial purification reagents and then bound using MyOne streptavidin magnetic beads;
[0086] Add NaOH solution for treatment and use 100°C formamide liquid for washing to separate the probe from the magnetic beads;
[0087] Finally, the biotin-labeled probe group was obtained by ethanol precipitation.
[0088] 2. Preparation of kits for thyroid cancer-related gene detection
[0089] Enrichment blocking agent: commercial blocking agent IDT TS Blocker Mix was used;
[0090] Thyroid cancer-related gene detection probe: prepared by synthesis of probe sequence;
[0091] Hybridization buffer: an aqueous solution containing 1.25 M NaCl, 0.125 M sodium citrate, 0.1 g / 100 mL BSA and 7% (v / v) Tween 20.
[0092] Library binding buffer: 10 mM Tris-HCl buffer, pH 7.5, containing 1 M NaCl and 1 mM EDTA.
[0093] Wash buffer 1 : Sodium citrate buffer containing 0.1% (m / v) SDS. Sodium citrate buffer is an aqueous solution containing 175g / L NaCl and 88g / L trisodium citrate; pH value is 7.4.
[0094] Wash buffer 2 : Sodium citrate buffer diluent containing 0.1% (m / v) SDS. Sodium citrate buffer diluent is a mixture of 1 part sodium citrate buffer and 9 parts water.
[0095] PCR amplification enzyme mix : KAPA HiFi HotStartReadyMix (Roche, KK2601).
[0096] PCR amplification primers: Consists of the following upstream primer and downstream primer sequences:
[0097] AATGATACGGCGACCACCGAG;
[0098] CAAGCAGAAGACGGCATACGA.
[0099] Example 2
[0100] Thyroid cancer-related gene testing:
[0101] 1 . Nucleic acid preparation: including tissue nucleic acid preparation, blood nucleic acid preparation, and fine needle aspiration cell nucleic acid preparation;
[0102] Tissue nucleic acid preparation includes: Genomic DNA extraction from paraffin blocks or sections: Take a 10 μm thick paraffin block or 8-10 paraffin sections and extract genomic DNA according to the GeneRead DNA FFPE Kit instructions, and then use Qubit to detect the concentration;
[0103] Extraction of genomic DNA from fresh tissue: Take 25 mg of fresh tissue and extract genomic DNA according to the instructions of the universal column-based genomic extraction kit. Then, use Qubit to detect the concentration.
[0104] Blood nucleic acid preparation includes: taking 300 μL of fresh blood, extracting blood genomic DNA according to the instructions of the magnetic bead nucleic acid extraction kit, and then detecting the concentration by Qubit;
[0105] Fine needle aspiration nucleic acid preparation includes: taking 500 μL of fine needle aspirated cells preserved in cell preservation solution, centrifuging at 2000 g for 10 minutes, removing the supernatant, and extracting genomic DNA from the cells according to the instructions of a universal column-based genomic extraction kit, and detecting the concentration using Qubit;
[0106] 2. Preliminary library preparation, including:
[0107] Fragmentation: Genomic DNA was fragmented into 150 bp-250 bp fragments using Covaris M220 ultrasonication.
[0108] Prelibrary preparation: Prelibrary preparation was performed according to the instructions of the Rapid Max DNALib Prep Kit for Illumina (abclonal, RK20217) and the Unique Dual Index for Illumina (abclonal, RK21626). The basic process for prelibrary preparation is as follows: 50 μL of fragmented genomic DNA was subjected to end repair and 3'A-tailing, adapter ligation, library amplification, and purification to complete library preparation; library fragment size quality control was performed by Qubit detection and agarose gel electrophoresis;
[0109] 3. Preparation of thyroid cancer-related gene targeted library: 500 ng prelibrary, 12 μL blocking agent, 5 μL thyroid-related gene detection probe, 35 μL hybridization buffer, enzyme-free water, a total volume of 100 μL, mixed evenly and placed in a PCR amplification instrument for reaction. The reaction procedure is: 95°C for 7 minutes, 65°C for 12-16 hours;
[0110] At the end of the assay, 50 μL of streptavidin magnetic beads (commercial) were placed on a magnetic stand to remove the magnetic bead storage solution and rinsed 2-3 times with binding buffer.
[0111] Keep the hybridization product on the PCR amplification instrument, add the rinsed magnetic bead suspension, pipette to mix, and place it at room temperature for 1 hour with rotation mixing.
[0112] Place the plate on a magnetic stand and discard the liquid. Add 500 μL of wash buffer 1 and rotate on a rotary mixer for 15 min. During this period, preheat the wash buffer 2 at 65°C.
[0113] Place on a magnetic stand and discard the liquid, add 500 μL of washing buffer 2, and incubate at 65°C on a thermostat for 10 min.
[0114] Place on a magnetic stand and discard the liquid, then wash three times with wash buffer 2.
[0115] Discard the liquid and aspirate it clean. Add 22 μL of enzyme-free water, mix thoroughly, and transfer to a PCR tube containing amplification mixture (25 μL amplification enzyme mix and 5 μL amplification primers). Mix thoroughly and then place in the PCR program for reaction. The reaction program is as follows:
[0116] 98℃30sec; 98℃30sec, 65℃30sec, 72℃30sec, 12 cycles; 72℃5min, 4℃∞.
[0117] The PCR amplification product was taken, added with 50 μL of magnetic beads, and purified according to the instructions of the magnetic bead DNA purification and recovery kit (Makino, MG0021).
[0118] The purified product was quality checked using qubit reagent, and the product was qualified if its concentration was greater than 1.5.
[0119] 4. High-throughput sequencing: The methylation-targeted enrichment library was subjected to high-throughput sequencing on the Illumina NovaSeq6000 second-generation sequencing platform to obtain raw sequencing data.
[0120] 5. Bioinformatics Analysis:
[0121] (1) Perform quality control on the raw data obtained by sequencing to obtain high-quality clean data;
[0122] (2) Compare the Clean data with the human reference genome sequence to obtain the Bam file;
[0123] (3) Detect and annotate SNV / InDel based on Bam files to obtain all mutation information;
[0124] (4) Somatic SNVs / Indels mutation detection: Somatic mutation detection was performed on paired samples (tissue and blood) using the Mutect2 module in the GATK software (https: / / gatk.broadinstitute.org / hc / en-us) to obtain SNVs / Indels mutation information. The results of Mutect2 were annotated by simultaneously linking multiple databases (dbSNP, 1000g, ESP6500, HGMD, OMIM) using the ANNOVAR software. The annotated data were filtered and the final results were output.
[0125] (5) Germline SNPs / Indels mutation detection: The haplotyper module of GATK was used to detect germline mutations in normal samples and obtain germline SNPs / Indels variation information. ANNOVAR was used to simultaneously link multiple databases (such as dbSNP, 1000g, ESP6500, HGMD, OMIM, etc.) to annotate the obtained variants and filter the results to output.
[0126] (6) SV variation detection: SV detection was performed on the samples using delly software;
[0127] (7) CNV variation detection: CNV kit software is used to detect CNVs in samples, and changes in copy number are detected based on the depth distribution of reads mapped to the reference genome.
[0128] 6. Detection Data Quality Control: High-throughput sequencing using the described kit showed an average depth of over 1000x in the target region and over 98% coverage of the target region, demonstrating excellent coverage that can detect multiple types of mutations, including gene mutations, copy number variations, and fusions, as well as assess the risk of hereditary tumors.
[0129] The results of the quality control of the detection data of this embodiment are shown in Table 1:
[0130] Table 1
[0131]
[0132]
[0133] Example 3
[0134] Detection of thyroid cancer-related gene mutations or fusions:
[0135] With the informed consent of the subjects, 60 sets of test samples were collected, including fine needle aspirates, paraffin sections, fresh tissues, blood samples, and blood samples from the subjects' parents. The test samples were tested and analyzed according to the method of Example 2.
[0136] Under the conditions of meeting quality control, various types of variation, including target gene mutations, copy number variations, and fusions, were analyzed, and three germline mutations, RET p.M918T, RET p.K1060N, and DICER1 p.D1320RfsX18; 12 systemic mutations, including DICER1p.E1813D, NRAS p.Q61R, DICER1 p.D1709G, and DICER1 p.D1810H / p.C152WfsX19; and 9 fusion mutations, including NCOA4-RET, CCDC6-RET, IRF2BP2-NTRK1, and SQSTM1-NTRK1, were detected.
[0137] Thus far, the technical solutions of the present invention have been described in conjunction with preferred embodiments. However, it will be readily understood by those skilled in the art that the scope of protection of the present invention is clearly not limited to these specific embodiments. Without departing from the principles of the present invention, those skilled in the art may make equivalent changes or substitutions to the relevant technical features, and the technical solutions after such changes or substitutions will fall within the scope of protection of the present invention.
[0138] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that the present invention is susceptible to various modifications and variations. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.
Claims
1. A marker for detecting thyroid cancer-related genes, characterized in that: include: 37 gene exons and hotspot introns. The gene list of the 37 gene exons and hotspot introns is as follows: AKT1, ALK, APC, AXIN1, BRAF, CCDC6, CTNNB1, EGFR, EIF1AX, GNAS, HRAS, KIT, KRAS, MET, MTOR, NCOA4, NF1, NKX2-1, NRAS, NT RK1, NTRK2, NTRK3, PAX8, PIK3CA, PPARG, PTCH1, PTEN, RET, TERT, TP53, TSHR, CDC73, DICER1, IDH1, MEN1, CDKN1B, PRKAR1A.
2. A probe set for detecting thyroid cancer-related genes, characterized in that: The probe set is used to specifically amplify at least one of the gene markers according to claim 1, and the probe set includes probes with nucleotide sequences of SEQ ID NO.01 to SEQ ID NO.70; The probe set further comprises a primer, the nucleotide sequence of which is: 5′-bio-GACTACATGGGACAT-3; 5′-GGAACCTACGACGTA-3′.
3. A kit for detecting thyroid cancer-related genes, characterized in that: The probe set according to claim 2 comprises: Enrichment blocking agent: Use commercial blocking agents, including IDT TS BlockerMix, BLG UniversalBlocker-ILL, Any of the Universal Blocking Oligos; Hybridization buffer: an aqueous solution containing 1.25 M NaCl, 0.125 M sodium citrate, 0.1 g / 100 mL BSA, and 7% v / v Tween 20; Library binding buffer: 10 mM Tris-HCl buffer, pH 7.5, containing 1 M NaCl and 1 mM EDTA; Wash buffer 1 : Sodium citrate buffer containing 0.1% m / v SDS, sodium citrate buffer is an aqueous solution containing 175g / L NaCl and 88g / L trisodium citrate; pH value is 7.4; Wash buffer 2 : Sodium citrate buffer diluent containing 0.1% m / v SDS, wherein the sodium citrate buffer diluent is a mixture of 1 part by volume sodium citrate buffer and 9 parts by volume water; PCR amplification enzyme mix : KAPAHiFi HotStartReadyMix; PCR amplification primers: Consists of the following upstream primer and downstream primer sequences: AATGATACGGCGACCACCGAG; CAAGCAGAAGACGGCATACGA.
4. A method for preparing a probe set for detecting thyroid cancer-related genes, for preparing the probe set according to claim 2, characterized in that: The following steps are involved: The mutation regions of 37 gene exons and hotspot introns were obtained from the UCSC or NCBI database and extended 50 bp before and after. The gene list of the 37 gene exons and hotspot introns is as follows: AKT1, ALK, APC, AXIN1, BRAF, CCDC6, CTNNB1, EGFR, EIF1AX, GNAS, HRAS, KIT, KRAS, MET, MTOR, NCOA4, NF1, NKX2-1, NRAS, NT RK1, NTRK2, NTRK3, PAX8, PIK3CA, PPARG, PTCH1, PTEN, RET, TERT, TP53, TSHR, CDC73, DICER1, IDH1, MEN1, CDKN1B, PRKAR1A; The reference genome version hg19 was used to extract the reference sequence of each mutation region, and the sequence of the repeated region was removed. The repeated sequence was analyzed using RepeatMask software; Starting from the first base, a 120bp or 78bp sequence is cut as a probe. Then, move back n bases and cut another 120bp or 78bp sequence until the last 120bp or 78bp. n varies in each region depending on the GC content of the exon. The higher or lower the GC content, the smaller n, and the denser the probe design, which improves capture uniformity. The synthetic probe sequence SEQ ID is designed. The probe density was adjusted according to the GC content. The calculation formula of the probe density is as follows: Dgc = a+a*10*|gc-0.5| Where Dgc represents the probe density at a certain GC content; a represents the probe density when the GC content is 50%, which is 20; gc represents the GC content; After completing the design and synthesis of the probe sequence, all probes were mixed in equal proportions, and a portion of the mixed probes was used for PCR amplification and biotin labeling. The primer sequences were 5'-bio-GACTACATGGGACAT-3, 5'-GGAACCTACGACGTA-3'; The PCR amplification products were purified using commercial purification reagents and then bound using MyOne streptavidin magnetic beads; Add NaOH solution for treatment and use 100°C formamide liquid for washing to separate the probe from the magnetic beads; Finally, the biotin-labeled probe group was obtained by ethanol precipitation.
5. A method for detecting thyroid cancer-related genes, using the kit for detecting thyroid cancer-related genes according to claim 3, characterized in that: The following steps are involved: S1. Nucleic acid preparation, including tissue nucleic acid preparation, blood nucleic acid preparation, and fine needle aspiration nucleic acid preparation. Tissue nucleic acid preparation includes: genomic DNA extraction from paraffin blocks or paraffin sections: extract genomic DNA from a 10 μm thick paraffin block or 8-10 paraffin sections according to the GeneRead DNA FFPE Kit instructions, and then use Qubit to detect the concentration. Extraction of genomic DNA from fresh tissue: Take 25 mg of fresh tissue and extract genomic DNA according to the instructions of the universal column-based genomic extraction kit. Then, use Qubit to detect the concentration. The blood nucleic acid preparation comprises: taking 300 μL of fresh blood, extracting blood genomic DNA according to the instructions of the magnetic bead method nucleic acid extraction kit, and then detecting the concentration by Qubit; The fine needle aspiration cell nucleic acid preparation comprises: taking 500 μL of fine needle aspiration cells preserved in cell preservation solution, centrifuging at 2000 g for 10 minutes, removing the supernatant, extracting cell genomic DNA according to the instructions of a universal column-based genome extraction kit, and detecting the concentration using Qubit; S2. Prelibrary preparation, including: Fragmentation: Genomic DNA was fragmented into 150 bp-250 bp using Covaris M220 ultrasound. ; Prelibrary preparation: Prelibrary preparation was performed according to the RapidMax DNALib Prep Kit for Illumina and the Unique DualIndex for Illumina instructions. The basic process for prelibrary preparation is as follows: 50 μL of fragmented genomic DNA was subjected to end repair and 3'A-tailing, adapter ligation, library amplification, and purification to complete library preparation. The library fragment size was quality controlled by Qubit assay and agarose gel electrophoresis. S3. Preparation of thyroid cancer-related gene targeted library: 500 ng prelibrary, 12 μL blocking agent, 5 μL thyroid-related gene detection probe, 35 μL hybridization buffer, and enzyme-free water were mixed to a total volume of 100 μL and then placed in a PCR amplification instrument for reaction. The reaction procedure was: 95°C for 7 min, 65°C for 12-16 h. Place 50 μL of streptavidin magnetic beads on a magnetic rack, remove the magnetic bead storage solution, and rinse 2-3 times with binding buffer; Keep the hybridization product on the PCR amplification instrument, add the rinsed magnetic bead suspension, pipette and mix, and place it in room temperature for 1 hour; Place on a magnetic stand and discard the liquid, add 500 μL of wash buffer 1, and rotate on a rotary mixer for 15 minutes. During this time, preheat wash buffer 2 at 65°C. Place on a magnetic stand and discard the liquid, add 500 μL of wash buffer 2, and incubate at 65°C on a thermostat for 10 min; Place on a magnetic stand to discard the liquid, and repeat washing three times with wash buffer 2; Discard the liquid and aspirate it clean. Add 22 μL of enzyme-free water, pipette and mix thoroughly, and transfer to a PCR tube containing amplification mixture (25 μL amplification enzyme mix and 5 μL amplification primers). Mix thoroughly and place in the PCR reaction program. The reaction program is as follows: 98°C for 30 seconds; 98°C for 30 seconds, 65°C for 30 seconds, 72°C for 30 seconds, 12 cycles; 72°C for 5 minutes, 4°C ∞; Take the PCR amplification product, add 50 μL of magnetic beads, and purify it according to the instructions of the magnetic bead DNA purification and recovery kit; The purified product was quality checked using qubit reagent, and the concentration was qualified if it was greater than 1.5; S4. High-throughput sequencing: The methylation-targeted enrichment library was subjected to high-throughput sequencing on an Illumina NovaSeq6000 or NextSeq CN500 second-generation sequencing platform to obtain raw sequencing data. S5. Bioinformatics analysis includes the following steps: (1) Perform quality control on the raw data obtained by sequencing to obtain high-quality clean data; (2) Compare the Clean data with the human reference genome sequence to obtain the Bam file; (3) Detect and annotate SNV / InDel based on Bam files to obtain all mutation information; (4) Somatic SNVs / Indels mutation detection: Use the Mutect2 module in the GATK software to perform somatic mutation detection on paired samples to obtain SNVs / Indels mutation information; use the software ANNOVAR to simultaneously associate the results of Mutect2 with multiple databases for annotation, and the annotated data is filtered to complete the final result output; (5) Germline SNPs / Indels mutation detection: Use the haplotyper module of the GATK software to perform germline mutation detection on normal samples to obtain germline SNPs / Indels variation information; use the software ANNOVAR to simultaneously associate multiple databases, annotate the above-obtained variations, filter them, and then output the results; (6) SV variation detection: SV detection was performed on the samples using delly software; (7) CNV variation detection: CNV detection was performed on samples using CNVkit software, and copy number changes were detected based on the depth distribution of reads mapped to the reference genome; S6. Detection data quality control: The kit was used for high-throughput sequencing, and the average depth of the kit in the target region reached more than 1000x, and the coverage of the target region reached more than 98%, with good coverage, meeting the requirements of gene mutation, copy number variation, fusion of multiple variation types, and assessment of hereditary tumor risks.
Citation Information
Patent Citations
A kit for detecting single-gene mutations in 50 genetic diseases and the probe set used therein.
CN112301123B