Hyperbaric oxygen modification method for recombinant mussel mucin

Abstract

The invention discloses a recombinant mussel mucoprotein hyperbaric oxygen modification method which comprises the following steps: S1, optimizing a mussel mucoprotein gene sequence, cloning the optimized mussel mucoprotein gene sequence into an expression vector, and constructing a recombinant plasmid; s2, transforming the recombinant plasmids into competent cells, and culturing to obtain engineering bacteria; s3, culturing and fermenting the engineering bacteria, centrifugally collecting thalli, adding a bacteria breaking solution to break the thalli, purifying and collecting eluent, and dialyzing to obtain dialysate containing non-viscous recombinant mussel mucin; and S4, continuously introducing pure oxygen into the dialysate containing the non-viscous recombinant mussel mucoprotein, and adding a reinforcing agent for reaction to obtain the viscous recombinant mussel mucoprotein. The invention relates to a mussel mucoprotein modification method based on combination of a solid-phase catalyst physical separation technology and high-pressure oxygen, which realizes a green process without exogenous enzymes / chemical additives. The purity of the obtained product is greater than or equal to 98.9%, the protein recovery rate is greater than or equal to 95%, the adhesion strength and the DOPA content are relatively high, and a high-purity and low-cost mass production solution is provided for the fields of medical adhesives and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a method for hyperbaric oxygen modification of recombinant mussel mucin. Background Art

[0002] Mussel mucin is a water-resistant, biocompatible, and biodegradable bioadhesive secreted by marine organisms called mussels. It promotes cell attachment and crawling, wound healing, broad-spectrum adhesion, and the formation of a water-resistant protective film, finding applications in cosmetics, biomedicine, and other fields. Mefp-3 is one of these small-molecule mucins that plays a major role in adhesion. Its amino acid sequence contains numerous tyrosine residues that can be oxidized to the amino acid 3,4-dihydroxy-L-phenylalanine (DOPA), which is crucial for its interfacial adhesion.

[0003] The natural stock of mussel Mefp-3 is low, and the extraction process is subject to significant loss and toxicity. Artificial chemical synthesis easily produces harmful byproducts that cannot be removed, and the resulting viscosity is weaker than that of natural mussel mucin. However, obtaining mussel protein through genetic engineering offers advantages such as eco-friendliness, high purity, high yield, and low cost. Therefore, developing a method for producing recombinant mussel mucin Mefp-3 using genetically engineered bacteria has important application value.

[0004] The adhesive strength of mussel mucin depends on the DOPA content. Recombinant mussel mucins typically expressed through genetic engineering are non-sticky or have very low viscosity. Tyrosine residues in the recombinant protein must be modified with DOPA to produce a sticky protein. Tyrosine modification in mussel mucin has always been a difficult problem. Currently, tyrosinase is commonly used for biooxidative modification of tyrosine residues, but this method faces challenges such as high cost, enzyme inactivation, and removal of the added modifying enzyme. While oxygen-assisted methods (such as those described in CN103520766A) can avoid residual modifying enzyme residues, relying solely on oxygen makes it difficult to achieve full modification of protein sites, and the reaction efficiency and modification rate are typically extremely low. Summary of the Invention

[0005] In order to solve the problems mentioned in the above background technology, the present invention provides a method for hyperbaric oxygen modification of recombinant mussel mucin.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: A method for hyperbaric oxygen modification of recombinant mussel mucin comprises the following steps: S1. After optimizing the mussel mucin gene sequence, clone it into an expression vector to construct a recombinant plasmid; S2. Transforming the recombinant plasmid into competent cells and culturing them to obtain engineered bacteria; S3. The engineered bacteria were cultured and fermented, the cells were collected by centrifugation, the cells were broken by adding a lytic solution, the eluate was collected and purified, and dialyzed to obtain a dialysate containing non-viscous recombinant mussel mucin; S4. Adding an enhancer to the dialysate containing the non-viscous recombinant mussel mucin and continuously introducing pure oxygen to react to obtain the viscous recombinant mussel mucin.

[0007] Preferably, in step S1, the optimized mussel mucin gene sequence is shown in SEQ ID NO: 1: SEQ ID NO: 1 GCAGATTACT ATGGCCCGAA ATATGGTCCG CCACGTCGTT ACGGTGGTGG CAACTACAACCGTTATGGTC GTCGCTACGG TGGCTACAAG GGTTGGAACA ACGGCTGGAA ACGTGGTCGT TGGGGCCGTAAATACTAC.

[0008] Preferably, in step S1, the expression vector is pET22b(+), which carries an Ampicillin resistance marker and contains a T7 promoter, a signal peptide coding sequence, and a C-terminal 6×His tag functional module.

[0009] Preferably, in step S2, the method for transforming the recombinant plasmid into competent cells is a heat shock method, specifically: taking the recombinant plasmid and adding it to Transetta (DE3) competent cells, ice bathing, heat shocking, ice bathing, adding LB medium and shaking culture, and spreading the transformed bacterial liquid on an LB agar plate containing Ampicillin for culture.

[0010] Preferably, in step S3, the engineered bacteria culture and fermentation conditions are as follows: the fermentation medium is LB medium containing Ampicillin (50 μg / mL), the fermentation temperature is 37°C, the rotation speed is 500-800 rpm, the IPTG induction concentration is 0.5 mM, the dissolved oxygen is 40%-60%, and the fermentation time is 36-42 h.

[0011] Preferably, in step S3, the composition of the lysis solution is: 20-30 mM Tris-HCl, 400-600 mM NaCl, 0.05-0.15 mM EDTA, pH 7-8.

[0012] Preferably, in step S3, the conditions for disrupting the bacteria are: 3-5°C, pressure 100-1500 bar, disruption 2-4 times, 5000-15000 rpm, 5-15 min centrifugation to collect the supernatant.

[0013] Preferably, in step S4, the enhancer is a supported palladium catalyst; the carrier of the supported catalyst comprises at least one of activated carbon, carbon nanotubes, graphene, and carbon nanospheres.

[0014] Preferably, in step S4, the reaction conditions when pure oxygen is introduced are: pressure 0.01-3 MPa, reaction time 1-24 h, and reaction temperature 4° C.-10° C.

[0015] Preferably, the mussel mucin is any one of Mefp-1, Mefp-3, Mefp-5, and Mefp-6.

[0016] The present invention modifies the non-sticky recombinant mussel mucin by continuously introducing pure oxygen. The possible mechanism is as follows: (1) Oxygen activation and electron circulation mediated by a supported metal catalyst such as palladium: Under high pressure oxygen (HBO) environment, the surface of the supported palladium catalyst efficiently adsorbs and dissociates oxygen (O2) to generate highly reactive palladium-oxygen species (Pd + -O - / Pd ²+ -O2 2- The activated oxygen species captures the electrons of the benzene ring of the tyrosine (Tyr) residue in the mussel mucin molecule, triggering a selective hydroxylation reaction. At the same time, the oxidized palladium (Pd 2+ ) directly accepts electrons provided by protein molecules (such as reductive transfer from adjacent cysteine ​​sulfhydryl groups or tryptophan indole rings) and spontaneously reduces to active Pd 0 state, completing the catalytic cycle without the need for external reducing agents.

[0017] (2) Directed hydroxylation of tyrosine to DOPA: Activated oxygen species precisely attack the ortho-CH bond of the tyrosine benzene ring, converting Tyr to highly adhesive 3,4-dihydroxyphenylalanine (DOPA) via a palladium-catalyzed electrophilic substitution pathway. This step is limited by local oxygen concentration and protein conformational exposure, and is highly efficient under high-pressure oxygen drive without the risk of free radical diffusion, ensuring reaction selectivity and protein integrity.

[0018] (3) Restricted formation and self-stabilizing cross-linking of DOPA quinone: The newly generated DOPA catechol groups can be further oxidized by single electrons by palladium-oxygen species to form semiquinone radical intermediates, ultimately forming a locally enhanced micro-cross-linked network, improving adhesion properties while maintaining overall protein solubility and high viscosity.

[0019] Compared with the prior art, the present invention has the following beneficial effects: 1. Environmentally friendly and process-simplified: This invention pioneered the use of a "high-pressure oxygen-loaded palladium" binary system to achieve zero-additive chemical modification of mussel mucin, replacing the traditional enzymatic method that relies on bio-enzyme catalysis, eliminating the inherent defects of unstable enzyme activity, harsh reaction conditions, and difficulty in separating enzyme protein residues; 2. Efficiency, Yield, and Cost Advantages: The one-step "reaction-separation" process eliminates 3-4 steps compared to existing technologies, and the catalyst is recyclable, making it highly commercially viable. Furthermore, the process breaks through yield constraints by radically omitting the dialysis / ultrafiltration step, increasing protein recovery from the industry average of ≤60% to ≥95%, significantly reducing the cost of high-value protein production. 3. Improved product purity, yield, and performance: The most significant contribution of this invention is that it eliminates the need for the introduction or removal of exogenous proteins or any other chemical reagents. Instead, the reaction system is constructed solely through solid-phase catalyst physical separation technology and high-pressure oxygen. The resulting mucin is single-component and well-defined in structure. Compared to enzymatic modification or modification with other chemical reagents, no impurities remain, resulting in extremely pure mucin with relatively high adhesion strength and DOPA content. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Vector construction map.

[0021] Figure 2 Enzyme digestion identification results.

[0022] Figure 3 WB test results.

[0023] Lane M represents protein marker, lane 1 represents the induction 0-point bacteria-like protein, lanes 2 and 4 represent negative bacteria-like protein, and lane 5 represents positive bacteria-like protein.

[0024] Figure 4 Coomassie brilliant blue test results; Lane M represents protein marker, lane 1 is the sample before purification, lane 2 is the flow-through sample, lanes 3-4 are the washed samples, and lanes 5-6 are the eluted samples.

[0025] Figure 5 Protein adhesion test results; Wherein, 1 and 5 are the unmodified Mefp-3 eluate samples from Example 3; 2 is the tyrosinase-modified Mefp-3 sample from Comparative Example 1; 3 is the oxygen-modified Mefp-3 sample from Comparative Example 2; 4 is the Mefp-3 sample co-modified with hyperbaric oxygen and an enhancer from Example 4; 6 is the tyrosinase control sample; 7 is the oxygen control sample; and 8 is the hyperbaric oxygen and enhancer control sample. The Mefp-3 protein content in all samples is 1 mg / mL.

[0026] Figure 6 The standard curve of DOPA content was determined by NBT / potassium glycine staining method.

[0027] Figure 7 DOPA content determination results after protein modification; M3 is the unmodified Mefp-3 protein, M3-1 is the tyrosinase-modified Mefp-3 sample in Comparative Example 1, M3-2 is the oxygen-modified Mefp-3 sample in Comparative Example 2, and M3-3 is the hyperbaric oxygen and enhancer co-modified Mefp-3 sample in Example 4. The Mefp-3 protein content is 1 mg / mL.

[0028] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0029] Unless otherwise specified, the raw materials and reagents used in the present invention are commercially available or can be prepared by known methods.

[0030] Example 1: Construction of mussel mucin Mefp-3 expression vector (1) Gene design and plasmid construction: Based on the mussel mucin Mefp-3 sequence included in GenBank (accession number: ACT66140.1), the N-terminal signal peptide (amino acids 1-24) was removed, and the mature peptide coding sequence (amino acids 25-78) was designed and optimized using the preferred codons of Escherichia coli. The optimized gene sequence (SEQ ID NO: 1) was cloned into the expression vector pET22b(+) to construct the recombinant plasmid pET22b(+)-M3. The vector carries an Ampicillin resistance marker and contains a T7 promoter, a signal peptide coding sequence, and a C-terminal 6×His tag functional module for efficient expression and purification of the target protein. The Mefp-3 gene fragment was inserted using NdeI and XhoI double enzyme digestion, replacing the XhoI (158) to NdeI (288) region to ensure that the Mefp-3 gene can be correctly integrated into the vector. The specific plasmid construction work was entrusted to Nanjing GeneScript Biotechnology Co., Ltd., and the vector construction picture is shown in the figure. Figure 1 shown.

[0031] (2) Transformation and screening: The constructed recombinant plasmid pET22b(+)-GS-M3 was transformed into Transetta (DE3) competent cells (purchased from TransGen Biotech) by heat shock method. The specific steps are as follows: Take 1 μL of recombinant plasmid and add it to 50 μL Transetta (DE3) competent cells and place it on ice for 30 minutes. Heat shock at 42℃ for 90 seconds, then quickly place it on ice for 2 minutes; add 500 μL LB medium and culture it at 37℃ with shaking for 1 hour; spread the transformed bacterial liquid on LB agar plate containing Ampicillin (50 μg / mL) and culture it at 37℃ for 14 hours. Pick a single clone and inoculate it into LB liquid medium containing Ampicillin (50 μg / mL), culture it at 37℃ with shaking for 12 hours for subsequent verification experiments.

[0032] (3) Verification of positive clones: extract the recombinant plasmid, perform double enzyme digestion with MluI and XhoI, analyze the digestion products by agarose gel electrophoresis, and compare them with KB Ladder DNA molecular weight standards. DNA fragments of different sizes migrate at different speeds in an electric field. By comparing with the standard, it can be determined whether the size of the digested band is consistent with the expected size. Extract the recombinant plasmid, verify the correctness of the inserted sequence by double enzyme digestion and sequencing (SEQ ID NO: 1). The agarose gel electrophoresis results are as follows: Figure 2 The results showed that the size of the enzyme-digested band was consistent with the expected size, indicating that the inserted sequence was correct.

[0033] (4) Preservation of engineered bacteria: The verified Transetta pet22b(+)_GS-M3 engineered bacteria were inoculated into LB liquid medium containing ampicillin (50 μg / mL) and cultured at 37°C with shaking until the logarithmic growth phase (OD600 ≈ 0.6). After mixing with 50% glycerol, the culture was aliquoted into cryovials and stored at -80°C for long-term storage.

[0034] Example 2: Expression and identification of mussel mucin Mefp-3 Activated Transetta pet22b(+)_GS-M3 was inoculated into LB medium containing 50 μg / mL of ampicillin. The fermentation temperature was 37°C, the rotation speed was 500-800 rpm, the IPTG induction concentration was 0.5 mM, the dissolved oxygen level was 50%, and the fermentation time was 36-42 hours. The fermentation broth was centrifuged at 9000 rpm for 10 minutes, and the supernatant was discarded. The pellet was washed three times with PBS and centrifuged under the same conditions. The cells were collected and resuspended in PBS. The inducible cells expressed the mussel mucin Mefp-3 with a purification tag (6×His).

[0035] Take the bacterial protein at the induction point 0 and the bacterial protein after induction for protein WB test (electrophoresis system is Tricine-SDS-PAGE system), use the primary antibody ProteinFind Anti-His Mouse Monoclonal Antibody, and the secondary antibody ProteinFind Goat Anti-Mouse IgG (H+L). The WB exposure results are as follows Figure 3 The results showed that the Mefp-3 protein was located at a position close to 7 KDa.

[0036] Example 3: Purification and identification of mussel mucin Mefp-3 protein The collected cells were resuspended in a lysis buffer (25 mM Tris-HCl, 500 mM NaCl, 0.1 mM EDTA, pH 7.5) at a dilution ratio of 1:10. High-pressure disruption was performed at 4°C, 1200 bar, three times, and centrifuged at 9000 rpm for 10 minutes. The supernatant was then passed through a nickel column at a flow rate of 2 cm / min and loaded. The wash buffer consisted of 10 mM imidazole, 300 mM sodium chloride, and 20 mM Tris-HCl, pH 8.0. The elution buffer consisted of 300 mM imidazole, 300 mM sodium chloride, and 20 mM Tris-HCl, pH 8.0, at a flow rate of 2 cm / min.

[0037] After collecting the samples from each step of purification, protein electrophoresis was performed using the Tricine-SDS-PAGE system. After the electrophoresis was completed, the protein film was taken out and stained with Coomassie Brilliant Blue. After decolorization, the protein gel bands were observed. Figure 4 As shown, the results showed that the position of the purified Mefp-3 protein band was the same as that of the Mefp-3 protein identified by WB.

[0038] Example 4: Hyperbaric oxygen modification method for mussel mucin The eluate obtained in Example 3 was placed in a dialysis bag with a cutoff of 1 kDa and dialyzed overnight at 4°C using 20 mM sodium acetate buffer, pH 4.5. The dialyzate was changed twice at a sample-to-dialysis ratio of 1:100.

[0039] The dialyzed fluid was collected and an enhancer (Pd / C, 10% Pd) was added thereto in an amount of 15% of the protein mass. After mixing evenly, the mixed solution was transferred into a high-pressure reactor, sealed, and pure oxygen was introduced to replace the air in the reactor three times. The pressure was increased to 0.5 M and the oxygen pressure was maintained constant (pressure fluctuation ≤±0.02 MPa) for 12 hours. The reaction temperature was controlled at 4°C. After the reaction was completed, the pressure was released to normal pressure, the reaction solution was removed, and centrifuged at 4°C and 8000×g for 10 min. The supernatant was collected; the supernatant was filtered twice through a 0.22 μm filter membrane to ensure that no catalyst particles remained. The filtrate was the modified functional mussel mucin Mefp-3 solution.

[0040] Comparative Example 1 Mussel mucin Mefp-3 tyrosinase modification method The eluate obtained in Example 3 was placed in a dialysis bag with a cutoff of 1 kDa and dialyzed overnight at 4°C using 20 mM sodium acetate buffer, pH 4.5. The dialyzate was changed twice with a sample to dialyzate ratio of 1:100.

[0041] The dialyzed fluid was collected and tyrosinase solution was added to make the final concentration 50U / mL; then CuSO4 solution was added to make the final concentration 2 mM, maintained for 3 hours, and the reaction temperature was controlled at 37°C to finally obtain functional mussel mucin.

[0042] Comparative Example 2 Oxygenation Modification Method of Mussel Mucin Mefp-3 The eluate obtained in Example 3 was placed in a dialysis bag with a cutoff of 1 kDa and dialyzed overnight at 4°C using 20 mM sodium acetate buffer, pH 4.5. The dialyzate was changed twice with a sample to dialyzate ratio of 1:100.

[0043] The dialyzed liquid was collected and transferred into a high-pressure reactor. After sealing, pure oxygen was introduced to replace the air in the reactor three times, and the pressure was increased to 0.5M. The oxygen pressure was maintained constant (pressure fluctuation ≤±0.02 MPa) for 12 hours. The reaction temperature was controlled at 4°C. After the reaction was completed, the pressure was released to normal pressure, and the reaction liquid was taken out to obtain functional mussel mucin.

[0044] Results and Testing Protein adhesion assay 2 μL of the sample obtained in Example 4, Comparative Example 1, and Comparative Example 2 was placed on a 0.2 μm nitrocellulose membrane (NC membrane), and the sample position was marked. After the sample was absorbed by the NC membrane, the NC membrane with the sample was placed in a 500 mL beaker, added with 300 mL of pure water, and sonicated for 10 minutes. The NC membrane was removed and placed in a Petri dish. NBT staining solution was added and stained for 45 minutes in the dark. The NBT staining solution was prepared by dissolving 9 mg of NBT in 15 mL of glycine-potassium buffer, mixing thoroughly, and preparing it immediately before use. The glycine-potassium buffer was prepared by dissolving 75 g of glycine in 400 mL of water, adjusting the pH to 10 with solid KOH, and then adding water to 500 mL. After preparation, the membrane was stored at 4°C. After staining, the NC membrane was removed and rinsed twice with sodium borate solution, then stored in the sodium borate solution overnight, and then rinsed three times with pure water. The sodium borate solution was prepared by dissolving 2.5 g of sodium borate decahydrate in 40 mL of water and sonicating at 40°C.

[0045] The sample marks were observed to have blue-purple spots. The sample results of Example 4, Comparative Example 1 and Comparative Example 2 were as follows: Figure 5 As shown, Figure 5 Spots 1 and 5 represent the eluate samples of unmodified Mefp-3 from Example 3, indicating that unmodified Mefp-3 is non-colorigenic. Modified Mefp-3 (spots 2, 3, and 4) all exhibit significant color development, with the strongest color development observed for Mefp-3 co-modified with hyperbaric oxygen and an enhancer (spot 4) and the weakest for Mefp-3 modified with oxygen alone (spot 3). Among the negative controls, spots 6, 7, and 8 exhibit no color development, except for the tyrosinase control sample (spot 6), which exhibits weak color development. This suggests that the color development of tyrosinase-modified Mefp-3 is subject to slight background interference, while Mefp-3 modified with oxygen alone and Mefp-3 co-modified with hyperbaric oxygen and an enhancer exhibit no background interference. Adhesion results demonstrate that Mefp-3 co-modified with hyperbaric oxygen and an enhancer exhibits significantly stronger adhesion than either tyrosinase-modified or oxygen-only modified Mefp-3.

[0046] Protein dopa content determination Use the NBT / potassium glycinate staining method (0.24 mM NBT, 2 M potassium glycinate, pH 10). Add 0, 2, 4, 8, 16, and 20 μL of DOPA standard (1 μg / mL) to six labeled wells of a 96-well plate, respectively. Adjust the final volume of each well to 20 μL with ultrapure water. Add 20 μL of DOPA standard (4 μg / mL) to the seventh well, followed by 180 μL of NBT / potassium glycinate solution. Repeat the procedures for the samples obtained in Example 4 and Comparative Example 1 in the NBT / potassium glycinate solution. Incubate at 25°C in the dark for 1 hour, and measure the absorbance at 530 nm using a microplate reader. Prepare a standard curve using a series of DOPA solutions, and calculate the DOPA content of the sample based on the measured absorbance of the sample solution.

[0047] Standard curve Figure 6 As shown, the sample results of Example 4, Comparative Example 1 and Comparative Example 2 are as follows Figure 7 As shown, the DOPA content of Mefp-3 increased significantly after modification. The DOPA content after tyrosinase modification was 0.636±0.033μg / mL, the DOPA content after oxygenation alone was 0.132±0.022μg / mL, the DOPA content after hyperbaric oxygenation and enhancer co-modification was 1.029±0.057μg / mL, and the DOPA content of unmodified Mefp-3 was 0.031±0.004μg / mL. The DOPA content of Mefp-3 after tyrosinase modification increased by 20.4 times compared with unmodified Mefp-3 DOPA, the DOPA content after oxygenation alone increased by 4.2 times, and the DOPA content after oxidant and enhancer co-modification increased by 33 times. In other words, the DOPA content of Mefp-3 after tyrosinase modification and oxygenation alone was significantly lower than that after hyperbaric oxygenation and enhancer co-modification.

[0048] Mucin purity determination The purity was determined by high performance liquid chromatography (HPLC) under the following conditions: chromatographic column: C18 reverse phase column (4.6×250 mm, 5 μm), mobile phase: acetonitrile-water (containing 0.1% trifluoroacetic acid), gradient elution (0-20 minutes, acetonitrile ratio 10%-60%), flow rate: 1.0 mL / min, detection wavelength: 280 nm, injection volume: 20 μL.

[0049] Hyperbaric oxygen modification: Purity reached 98.9%. Tyrosinase modification: Purity reached 85.1%. By avoiding the risk of enzyme carryover, the hyperbaric oxygen modification method achieves significantly higher target protein purity than the traditional tyrosinase modification method (98.9% vs. 85.1%), making it suitable for large-scale production of high-purity proteins.

[0050] SEQ ID NO: 1 GCAGATTACT ATGGCCCGAA ATATGGTCCG CCACGTCGTT ACGGTGGTGG CAACTACAACCGTTATGGTC GTCGCTACGG TGGCTACAAG GGTTGGAACA ACGGCTGGAA ACGTGGTCGT TGGGGCCGTAAATACTAC.

[0051] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.

Claims

1. A method for hyperbaric oxygen modification of recombinant mussel mucin, characterized in that: The steps include: S1. After optimizing the mussel mucin gene sequence, clone it into an expression vector to construct a recombinant plasmid; S2. Transforming the recombinant plasmid into competent cells and culturing them to obtain engineered bacteria; S3. The engineered bacteria were cultured and fermented, the cells were collected by centrifugation, the cells were broken by adding a lytic solution, the eluate was collected and purified, and dialyzed to obtain a dialysate containing non-viscous recombinant mussel mucin; S4. Adding an enhancer to the dialysate containing the non-viscous recombinant mussel mucin and continuously introducing pure oxygen to react to obtain the viscous recombinant mussel mucin.

2. A method for hyperbaric oxygen modification of recombinant mussel mucin according to claim 1, characterized in that: In step S1, the optimized mussel mucin gene sequence is shown in SEQ ID NO: 1: SEQ ID NO: 1 GCAGATTACT ATGGCCCGAA ATATGGTCCG CCACGTCGTT ACGGTGGTGG CAACTACAACCGTTATGGTC GTCGCTACGG TGGCTACAAG GGTTGGAACA ACGGCTGGAA ACGTGGTCGT TGGGGCCGTAAATACTAC.

3. The method for hyperbaric oxygen modification of recombinant mussel mucin according to claim 1, characterized in that: In step S3, the composition of the lysis solution is: 20-30 mM Tris-HCl, 400-600 mM NaCl, 0.05-0.15 mM EDTA, pH 7-8.

4. The method for hyperbaric oxygen modification of recombinant mussel mucin according to claim 1, characterized in that: In step S3, the conditions for disrupting the bacteria are: 3-5° C., pressure 100-1500 bar, disruption 2-4 times, 5000-15000 rpm, 5-15 min centrifugation to collect the supernatant.

5. The method for hyperbaric oxygen modification of recombinant mussel mucin according to claim 1, characterized in that: In step S4, the enhancer is a supported palladium catalyst; the carrier of the supported catalyst comprises at least one of activated carbon, carbon nanotubes, graphene, and carbon nanospheres.

6. The method for hyperbaric oxygen modification of recombinant mussel mucin according to claim 1, characterized in that: In step S4, the reaction conditions when pure oxygen is introduced are: pressure 0.01-3 MPa, reaction time 1-24 h, and reaction temperature 4° C.-10° C.

7. The method for hyperbaric oxygen modification of recombinant mussel mucin according to claim 1, characterized in that: The mussel mucin is any one of Mefp-1, Mefp-3, Mefp-5 and Mefp-6.

Images