UTR sequences for improving mRNA stability and translation efficiency and their applications

Abstract

This invention provides UTR sequences for improving mRNA stability and translation efficiency, and their applications. Specifically, it provides an mRNA molecule comprising a coding region encoding a polypeptide or protein and its fragments, a 5′ UTR sequence upstream of the coding region, and / or a 3′ UTR sequence downstream of the coding region. The 5′ UTR sequence is the nucleotide sequence shown in SEQ ID NO:1, and the 3′ UTR sequence is the nucleotide sequence shown in SEQ ID NO:2; and / or, the 5′ UTR sequence is the nucleotide sequence shown in SEQ ID NO:3, and the 3′ UTR sequence is the nucleotide sequence shown in SEQ ID NO:4. This invention improves mRNA stability and translation efficiency through novel and optimized UTR sequences, which can be used as elements to enhance RNA expression efficiency in nucleic acid therapeutics or mRNA vaccines, providing more and better options for mRNA therapy.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and gene therapy, specifically to UTR sequences that improve mRNA stability and translation efficiency and their applications. Background Technology

[0002] With the development of biotechnology, nucleic acid drugs are playing an increasingly important role. In mRNA (messenger RNA) therapy, artificially synthesized mRNA is mainly used to guide the synthesis of specific polypeptides or proteins on the ribosomes of cells. These include polypeptides or proteins with therapeutic effects, or antigen proteins and fragments that the immune system needs to recognize. Improving the stability and translation efficiency of mRNA is key to achieving effective therapeutic results.

[0003] The untranslated region (UTR) sequence in mRNA molecules is crucial for both mRNA stability and transcription efficiency. The 5′ UTR can affect the translation initiation rate, while the 3′ UTR can affect mRNA stability and expression regulation. Previous studies have shown that different UTR sequences have significant differences in their effects on mRNA stability and translation efficiency. Studies have shown that the human cell CYBA UTR sequence can enhance translation efficiency without affecting RNA half-life. Other studies have found that the double-copy β-globin 3′ UTR sequence supports efficient protein expression in dendritic cells. Other UTR sequences used in studies include enhancer sequences from CMV (human cytomegalovirus), the human alpha-globin 5′ UTR, and the human growth hormone UTR sequence.

[0004] The aforementioned UTR sequences were not optimized and suffered from excessively long sequence lengths or complex secondary structures, which affected the construction and stability of expression vector plasmids, and resulted in short mRNA half-lives and low expression levels of target proteins. Developing novel and efficient UTR sequences to improve mRNA stability and translation efficiency is of significant practical importance and crucial for the development of mRNA therapies. Summary of the Invention

[0005] The purpose of this invention is to develop new and efficient UTR sequences to improve mRNA stability and translation efficiency.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] The first aspect of the present invention provides an mRNA molecule comprising a coding region encoding a polypeptide or protein and a fragment thereof, a 5′UTR sequence upstream of the coding region and a 3′UTR sequence downstream of the coding region, wherein the 5′UTR sequence is the nucleotide sequence shown in SEQ ID NO:1 and the 3′UTR sequence is the nucleotide sequence shown in SEQ ID NO:2; and / or, the 5′UTR sequence is the nucleotide sequence shown in SEQ ID NO:3 and the 3′UTR sequence is the nucleotide sequence shown in SEQ ID NO:4.

[0008] In this invention, when referring to a nucleotide sequence, unless otherwise specified, the nucleotide sequence referred to includes not only sequences that are exactly the same as the sequence, but also those sequences that are readily conceived by those skilled in the art based on the sequence and that can be expected to have equivalent effects (e.g., those skilled in the art should know that sequences with high consistency (e.g., 85% or more, especially 90% or more, particularly 95% or more) generally have equivalent effects).

[0009] In some embodiments, the mRNA molecule further comprises a polyadenylate tail.

[0010] In some specific embodiments, the polyadenylate tail includes poly(A).

[0011] Preferably, the length of the polyadenylated tail is at least 100 nt.

[0012] More preferably, the length of the polyadenylate tail is 100nt to 150nt.

[0013] In some specific embodiments, the polypeptide or protein and its fragments include, but are not limited to, gene-editing proteins and their fragments, antigens or their fragments.

[0014] A second aspect of the present invention also provides a nucleic acid molecule encoding the above-mentioned mRNA molecule for reverse transcription to produce the mRNA molecule.

[0015] A third aspect of the present invention also provides a carrier comprising the above-described nucleic acid molecules.

[0016] The vector used in this invention can be a plasmid vector, viral vector, or other vector commonly used in the art, such as a lentiviral vector or adenovirus vector. By constructing the nucleic acid sequence encoding the mRNA molecule of this invention into the vector, efficient transcription of the mRNA molecule can be achieved. A plasmid vector containing the T7 promoter is preferred.

[0017] A fourth aspect of the present invention also provides a host cell comprising the above-described vector.

[0018] The host cells used in this invention are preferably mammalian cells, such as human cervical cancer cells (HeLa), human liver cancer cells (Hep3B), human non-small cell lung cancer cell line (A549), human embryonic kidney cells (293T), etc.

[0019] The fifth aspect of the present invention also provides a pharmaceutical composition comprising the above-described mRNA molecule, the above-described nucleic acid molecule, the above-described carrier or the above-described host cell, and optionally including pharmaceutically acceptable excipients.

[0020] A sixth aspect of the invention also provides the use of the above-described pharmaceutical composition in the preparation of vaccines, wherein the coding region is a sequence encoding an antigen or a fragment thereof. The UTR of the present invention facilitates adequate antigen production and effective vaccination.

[0021] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:

[0022] This invention improves mRNA stability and translation efficiency through novel and optimized UTR sequences, which can be used as elements to enhance RNA expression efficiency in nucleic acid therapeutics or mRNA vaccines, providing more and better options for mRNA therapy. Attached Figure Description

[0023] Figure 1 Construct a map for the Cas9 mRNA plasmid (CT039);

[0024] Figure 2 Construct a map for the EGFP mRNA plasmid (CT060);

[0025] Figure 3 Construct a map for the Fluc mRNA plasmid (CT072);

[0026] Figure 4 Construct a map for the mCherry mRNA plasmid (CT119);

[0027] Figure 5 The graph shows a comparison of the expression efficiency of EGFP mRNA containing the first group of UTRs and EGFP mRNA containing the second group of UTRs in HeLa cells with that of EGFP mRNA containing Biotech UTRs in HeLa cells.

[0028] Figure 6 The results of expression efficiency assays for mCherry mRNA containing group 1 UTRs in four test cell types. Figure 1 ;

[0029] Figure 7 The results of expression efficiency assays for mCherry mRNA containing group 1 UTRs in four test cell types. Figure 2 ;

[0030] Figure 8 A comparison of the expression efficiency of mCherry mRNA containing the first group of UTRs and mCherry mRNA containing the second group of UTRs in HeLa cells;

[0031] Figure 9 This is a comparison of gene editing efficiency in mice between Cas9 mRNA containing the first set of UTRs and commercially available Cas9 mRNA. Detailed Implementation

[0032] The 5'UTR and 3'UTR play a crucial role in regulating mRNA stability and translation efficiency. In previous studies, the inventors of this application optimized the 5'UTR and 3'UTR sequences using an algorithmic model and the following strategy:

[0033] Adding KOZAK sequences can improve translation initiation efficiency;

[0034] By predicting and optimizing the minimum free energy (MFE) of the 5'UTR and 3'UTR sequences, the mRNA is ensured to have a moderately stable secondary structure, thereby improving the stability of the mRNA.

[0035] Based on the concept of overall mRNA functional optimization, a joint optimization algorithm is adopted, taking into account the interaction between the 5'UTR and 3'UTR sequences and the CDS. The optimization process includes balancing parameters such as translation initiation efficiency (TIE), codon fit index (CAI), and minimum free energy (MFE), and achieves global sequence optimization through multiple rounds of iteration.

[0036] (4) Using artificial intelligence models such as UTR-LM and large-scale training datasets, the sequence features of 5'UTR and 3'UTR sequences and CDS (such as GC content, AUG context structure and secondary structure characteristics) are analyzed. Various key parameters (such as TIE, CAI and MFE) are optimized through model prediction, thereby generating a combination of 5'UTR and 3'UTR sequences with higher translation efficiency and better stability.

[0037] After continuous optimization and experimental verification, the following three combinations of UTR sequences were selected as having the best performance:

[0038] Group 1 UTR sequence combination:

[0039] 5'UTR: GGAACTAACGGCCACGACCAGCCATCGCCATCCTACAGC (SEQ ID NO: 1),

[0040] 3'UTR: GGGTCTGGTCTCCTCAGCCTCCTCATCTGGGGGAGTGGAATAGTATCCTCCAGGTGAGGCAATTAAACGGATTATTAACCCAGACCGAAAAGAGATGGTCTGAGCTAGTCCGAGA (SEQ ID NO: 2).

[0041] Group 2 UTR sequence combinations:

[0042] 5'UTR:GGAAACTACCCACCCACTAATGTAAAGGCCGCTGCAAG (SEQ ID NO:3),

[0043] 3'UTR: GCCCCACCTCCAGGACGCCCAGGACAGGCTGCGGCCCCTCCCCCGTCCTGGAGGTTCCTCATTCCCACTTACCGCGTAATGCGCGGTTAAACCAATGAACGAAGC (SEQ ID NO: 4).

[0044] Based on this, the technical solution of the present invention is as follows: an mRNA molecule comprising a coding region encoding a polypeptide or protein and its fragments, a 5′UTR sequence located upstream of the coding region and a 3′UTR sequence located downstream of the coding region, wherein the 5′UTR sequence is the nucleotide sequence shown in SEQ ID NO:1 and the 3′UTR sequence is the nucleotide sequence shown in SEQ ID NO:2; and / or, the 5′UTR sequence is the nucleotide sequence shown in SEQ ID NO:3 and the 3′UTR sequence is the nucleotide sequence shown in SEQ ID NO:4.

[0045] In the context of this invention, "coding region" should be understood to refer to any polydeoxyribonucleotide molecule that encodes a target polypeptide or protein and its fragments, which, if transfected into a cell, can be transcribed into an mRNA molecule capable of being translated into the target polypeptide or protein and its fragments. The terms "polypeptide" and "protein" herein include any kind of amino acid sequence, i.e., a chain of two or more amino acids linked by peptide bonds, and also include peptides and fusion proteins.

[0046] The present invention will be further described below with reference to embodiments. However, the present invention is not limited to the following embodiments. The implementation conditions used in the embodiments can be further adjusted according to different requirements of specific applications, and the implementation conditions not specified are conventional conditions in the industry. The technical features involved in the various embodiments of the present invention can be combined with each other as long as they do not conflict with each other.

[0047] Unless otherwise specified, the raw materials used in the following examples and comparative examples were purchased from commercial sources.

[0048] The following examples use the Biotech (Pfizer) UTR sequence for comparison:

[0049] 5'UTR: AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC (SEQ IDNO: 5),

[0050] 3'UTR: CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAG CACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC (SEQ ID NO:6).

[0051] Example 1: Construction of 5'UTR and 3'UTR vectors and preparation of mRNA molecules

[0052] GenScript Biotech Inc. was commissioned to construct expression plasmids using the two sets of UTR sequences and the Biotech UTR sequence obtained in the previous screening, along with the CDS sequences of Cas9 (SEQ ID NO:7), EGFP (SEQ ID NO:8), Fluc (SEQ ID NO:9), and mCherry (SEQ ID NO:10), respectively. The plasmid map is shown below. Figures 1-4 As shown, CT039 represents the Cas9 mRNA plasmid ( Figure 1 CT060 represents the EGFP mRNA plasmid ( Figure 2 CT072 represents the Fluc mRNA plasmid ( Figure 3 CT119 represents the mCherry mRNA plasmid ( Figure 4 Clones identified by sequencing were subjected to high-level purification using an endotoxin-free plasmid extraction kit, and their concentration was determined using a Nanodrop micro spectrophotometer. The resulting plasmids were then used to prepare mRNA via in vitro transcription.

[0053] Take the extracted plasmid, linearize the plasmid template with restriction endonuclease XbaI (NEB), add 10× reaction buffer and RNase-free water, mix thoroughly by shaking, and then briefly centrifuge to allow the liquid to accumulate at the bottom of the test tube. Incubate at 37℃ for 3 hours, then inactivate at 80℃ for 20 minutes. The obtained product is further purified and recovered using magnetic beads.

[0054] Prepare the DNA purification magnetic beads (VAHTS DNA Clean Beads, Nanjing Novizan Biotechnology Co., Ltd.) in advance, equilibrate to room temperature, and thoroughly mix the beads by inverting or vortexing. Add an equal volume of magnetic beads to the volume of the enzyme digestion product, and mix thoroughly using a pipette. Then, purify the template plasmid according to the magnetic bead recovery steps in the instructions. After purification, take 1 µL of the purified product and determine the concentration using a Nanodrop spectrophotometer. Then, take 50 ng of the purified product for agarose gel electrophoresis (1% TAE) to confirm whether the plasmid template linearization is sufficient.

[0055] In vitro transcription was performed using a T7 RNA polymerase co-transcription kit (Novizan Biotechnology Co., Ltd.). In the modification group, N1-methylpseudouracil was used to completely replace UTP. After adding all components according to the instructions, the mixture was thoroughly aspirated and mixed, briefly centrifuged to collect the liquid at the bottom of the tube, and incubated at 37°C for 2 hours. Then, 5 µL of deoxyribonuclease I (DNase I) was added to the reaction product to digest the DNA template, and the reaction was carried out at 37°C for 15 minutes. The mRNA in the transcription product was purified and recovered using RNA purification magnetic beads (VAHTS RNA Clean Beads, Nanjing Novizan Biotechnology Co., Ltd.). The amount of magnetic beads used was 4 times that of the co-transcription system. After thorough mixing, the operation was performed according to the magnetic bead instructions. Finally, an appropriate amount of nuclease-free water was used for elution. 1 µL of the purified mRNA was taken and the concentration was detected using a micro-spectrophotometer (RNA mode). 50 ng of purified mRNA was taken for denaturing agarose gel electrophoresis (1% TBE + 6% urea) to detect the integrity and purity of the mRNA product.

[0056] Example 2: Cell Experiment

[0057] Immortalized human cervical cancer cells (HeLa), human liver cancer cells (Hep3B), human non-small cell lung cancer cell line (A549), and human embryonic kidney cells (293T) were selected for transfection testing. Cells in good growth condition were harvested, digested, resuspended, and counted. The desired cell density for seeding was 2 × 10⁶ cells / year. 5Cells were cultured at a rate of 100 μL / well in 96-well plates. The plates were incubated overnight at 37°C in a 5% CO2 incubator. The next day, cells were harvested, and EGFP mRNA and mCherry mRNA containing different UTR combinations, prepared above through transcription, were transfected into the cells using Thermo Fisher Scientific's Lipofectamine Messenger MAX transfection reagent for mRNA at different dosages. Detection was performed 48 hours after transfection.

[0058] Experimental results:

[0059] from Figure 5 It can be seen that in HeLa cells, under high-dose conditions (75 ng), the expression efficiencies of EGFP mRNA containing the first UTR sequence (SEQ ID NO:1 and SEQ ID NO:2 UTR) and EGFP mRNA containing the second UTR sequence (SEQ ID NO:3 and SEQ ID NO:4) are comparable to those of EGFP mRNA containing the Biotech UTR sequence (SEQ ID NO:5 and SEQ ID NO:6), respectively. However, under low-dose conditions (4.68 ng to 18.75 ng), the expression efficiencies of EGFP mRNA containing the first UTR sequence (SEQ ID NO:1 and SEQ ID NO:2) and EGFP mRNA containing the second UTR sequence (SEQ ID NO:3 and SEQ ID NO:4) are both superior to those of EGFP mRNA containing the Biotech UTR sequence.

[0060] from Figure 6 and Figure 7 The results show that mCherry mRNA containing the first UTR sequence (SEQ ID NO:1 and SEQ ID NO:2) has high expression efficiency in all four test cell types, with the highest expression efficiency in HeLa cells.

[0061] from Figure 8 The results show that the expression efficiency of mCherry mRNA containing the first group of UTR sequences (SEQ ID NO:1 and SEQ ID NO:2) and the second group of UTR sequences (SEQ ID NO:3 and SEQ ID NO:4) in HeLa cells is not significantly different.

[0062] Example 3: Animal Experiment

[0063] C57BL / 6 mice were selected as animal models. Flux mRNA containing the first UTR sequence (SEQ ID NO:1 and SEQ ID NO:2), Flux mRNA containing the second UTR sequence (SEQ ID NO:3 and SEQ ID NO:4), or commercially available Flux mRNA were injected intravenously into mice at a dose of 5 μg per mouse. Fluorescence imaging was performed using an in vivo fluorescence system at 6 h and 24 h after injection, respectively. The fluorescence signal intensity reflected the translation efficiency of Flux mRNA in mice.

[0064] Results: Comparison showed that 6 hours after injection, the in vivo fluorescence intensity of mice injected with Fluc mRNA containing the first group of UTR sequences (SEQ ID NO:1 and SEQ ID NO:2) and mice injected with Fluc mRNA containing the second group of UTR sequences (SEQ ID NO:3 and SEQ ID NO:4) was approximately 10 times higher than that of mice injected with commercially available Fluc mRNA. 24 hours after injection, the in vivo fluorescence intensity of mice injected with Fluc mRNA containing the first group of UTR sequences (SEQ ID NO:1 and SEQ ID NO:2) and mice injected with Fluc mRNA containing the second group of UTR sequences (SEQ ID NO:3 and SEQ ID NO:4) was 3-5 times higher than that of mice injected with commercially available Fluc mRNA. This indicates that the UTR sequences of the present invention have a significant effect on improving the expression efficiency of exogenous mRNA in mice and can significantly increase the half-life of exogenous mRNA in mice.

[0065] C57BL / 6 mice were selected as an animal model. Lipid nanoparticles containing Cas9 mRNA and sgRNA were intravenously injected into the mice. The Cas9 mRNA contained the first group of UTR sequences (SEQ ID NO:1 and SEQ ID NO:2). The molar ratio of Cas9 mRNA to sgRNA in the lipid nanoparticles was 1:1. The lipid nanoparticles were encapsulated according to the SM-102 formulation (lipid molar ratio of SM-102:DSPC:cholesterol:DMG-PEG2000=50:10:38.5:1.5, RNA to lipid weight ratio of 0.05wt / wt). After sterilization and filtration, the lipid nanoparticles were injected at doses of 0.5mpk, 0.2mpk, and 0.1mpk. Samples were taken 48 hours after injection, and gene editing efficiency was determined by restriction fragment length polymorphism (RFLP) analysis.

[0066] Experimental results:

[0067] from Figure 9The results show that Cas9 mRNA containing the first set of UTR sequences (SEQ ID NO:1 and SEQ ID NO:2) has a high editing efficiency in mice, and the difference in editing efficiency is more significant at low doses. This indicates that the UTR sequences of the present invention have a significant effect on improving the expression efficiency of gene editing tool proteins and can significantly improve gene editing efficiency.

[0068] The above embodiments are merely preferred examples of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications or improvements made without departing from the spirit of the present invention shall fall within the scope of protection claimed by the present invention.

Claims

1. An mRNA molecule, characterized in that, It contains a coding region encoding a polypeptide or protein and its fragments, a 5′UTR sequence upstream of the coding region and a 3′UTR sequence downstream of the coding region, wherein the 5′UTR sequence is the nucleotide sequence shown in SEQ ID NO:1 and the 3′UTR sequence is the nucleotide sequence shown in SEQ ID NO:2; Alternatively, the 5′UTR sequence is the nucleotide sequence shown in SEQ ID NO:3, and the 3′UTR sequence is the nucleotide sequence shown in SEQ ID NO:

4.

2. The mRNA molecule according to claim 1, characterized in that, The mRNA molecule also contains a polyadenylate tail.

3. The mRNA molecule according to claim 2, characterized in that, The length of the polyadenylate tail is at least 100 nt.

4. The mRNA molecule according to claim 1, characterized in that, The polypeptides or proteins and their fragments include gene-edited proteins and their fragments or antigens and their fragments.

5. A nucleic acid molecule encoding the mRNA molecule of any one of claims 1 to 4.

6. A carrier comprising the nucleic acid molecule of claim 5.

7. A host cell comprising the vector of claim 6.

8. A pharmaceutical composition comprising the mRNA molecule of any one of claims 1 to 4, the nucleic acid molecule of claim 5, the vector of claim 6 or the host cell of claim 7, and optionally comprising pharmaceutically acceptable excipients.

9. The use of the pharmaceutical composition of claim 8 in the preparation of a vaccine, characterized in that, The coding region is a sequence that encodes an antigen or a fragment thereof.

Images