Application of m6A modified circNDUFA10 in diagnosis and treatment of lung adenocarcinoma
By using m6A-modified circNDUFA10 as a diagnostic biomarker and therapeutic target, the lack of information on the mechanism of action of circRNA in lung adenocarcinoma has been addressed, enabling accurate diagnosis and effective treatment of lung adenocarcinoma and providing new molecular diagnostic and targeted therapy methods.
Patent Information
- Application Number
- CN202510958521.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-11
- Publication Date
- 2025-11-07
AI Technical Summary
In the current technology, there is a lack of research on the mechanism of action of m6A-modified circRNA in lung adenocarcinoma, especially its influence on tumor proliferation, invasion and metastasis by regulating downstream signaling pathways. Moreover, the problems of recurrence, metastasis and drug resistance after treatment of lung adenocarcinoma have not been effectively solved.
We will provide m6A-modified circNDUFA10 as a diagnostic biomarker, and develop corresponding diagnostic reagents and kits by specifically detecting its expression level or modification level. We will also design antisense oligonucleotides to intervene in its expression and regulate the c-Myc signaling pathway to inhibit the proliferation and metastasis of lung adenocarcinoma cells.
This study enabled accurate detection of circNDUFA10 expression in lung adenocarcinoma tissues, revealing its molecular mechanism in the proliferation and metastasis of lung adenocarcinoma cells. It provides new molecular diagnostic and targeted therapy methods and can effectively inhibit the malignant growth and migration of tumor cells.
Smart Images

Figure CN120905383A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biological medicine, and in particular to an application of m6A modified circNDUFA10 in lung adenocarcinoma and a detection method thereof. BACKGROUND
[0002] Lung adenocarcinoma has the characteristics of high heterogeneity, complex clinical response and poor prognosis, and usually occurs in the periphery of the lung. The early symptoms are not obvious and most patients have metastasis or are in the advanced stage at the time of diagnosis. Although the early screening technology and treatment of lung cancer are constantly improving, the problems of recurrence, metastasis and drug resistance after treatment still need to be solved.
[0003] CircRNA is a closed loop non-coding RNA molecule formed by reverse splicing of precursor mRNA, which has the characteristics of stable structure, high tissue specificity and precise spatiotemporal expression regulation, and plays a key role in the occurrence and development of tumors. In recent years, research has found that the function of circRNA is closely related to its epigenetic modification, among which N 6 Methylation (m6A) modification, as one of the most common internal modifications of eukaryotic RNA, can affect the stability, subcellular localization and interaction with proteins of circRNA, thereby affecting its biological function. However, the specific mechanism of m6A modified circRNA in lung adenocarcinoma, especially how it regulates downstream signaling pathways to affect tumor proliferation, invasion and metastasis, is still relatively scarce.
[0004] C-Myc, as an important proto-oncogene, is closely related to the malignant progression of lung adenocarcinoma. It can promote the proliferation and metastasis of tumor cells by regulating cell cycle, metabolic reprogramming and epithelial-mesenchymal transition (EMT). Studies have shown that m6A recognition proteins (such as YTHDF family) can regulate the translation efficiency of target mRNA by recognizing m6A modification sites, thereby affecting the expression of cancer genes such as c-Myc. However, whether m6A modified circRNA regulates the expression of c-Myc by interacting with m6A recognition proteins and its specific mechanism in lung adenocarcinoma has not been clearly defined.
[0005] Therefore, further exploring the circRNA molecules with abnormal m6A modification in lung adenocarcinoma and elucidating its molecular mechanism of regulating downstream signaling pathways to affect the malignant phenotype of tumors has important theoretical significance and clinical value for developing new diagnostic markers and targeted therapy targets for lung adenocarcinoma. SUMMARY
[0006] In order to overcome the defects of the prior art, the application provides application of m6A modified circNDUFA10 in diagnosis and treatment of lung adenocarcinoma, including using the same as a diagnostic marker, providing a diagnostic reagent and kit for detecting the expression amount thereof; using the same as a therapeutic target, providing an antisense oligonucleotide for inhibiting the expression thereof and related drugs, and inhibiting lung adenocarcinoma proliferation and metastasis by regulating the c-Myc signaling pathway, thereby providing a new means for diagnosis and treatment of lung adenocarcinoma.
[0007] In order to achieve the above-mentioned purpose, the application provides application of m6A modified circNDUFA10 in preparation of a lung adenocarcinoma diagnostic marker, wherein the sequence of the circNDUFA10 is SEQ ID NO: 1.
[0008] Another purpose of the application is to provide a reagent for lung adenocarcinoma diagnosis, which comprises a substance for specifically detecting the expression amount or modification level of m6A modified circNDUFA10, wherein the substance comprises specific primers, probes or antibodies for recognizing the reverse splicing site and / or m6A modification site of the circNDUFA10, and the sequence of the circNDUFA10 is SEQ ID NO: 1.
[0009] Another purpose of the application is to provide a kit for lung adenocarcinoma diagnosis, which comprises primers, probes and / or antibodies for specifically detecting the expression amount or modification level of m6A modified circNDUFA10, and the sequence of the circNDUFA10 is SEQ ID NO: 1.
[0010] Another purpose of the application is to provide application of m6A modified circNDUFA10 as a drug target for treating lung adenocarcinoma, wherein the m6A modified circNDUFA10 affects the proliferation, migration and EMT process of lung adenocarcinoma cells by regulating the c-Myc signaling pathway, and the sequence of the circNDUFA10 is SEQ ID NO: 1.
[0011] Another purpose of the application is to provide application of a substance for inhibiting the expression of m6A modified circNDUFA10 in preparation of a drug for treating lung adenocarcinoma, wherein the substance comprises an antisense oligonucleotide, the antisense oligonucleotide can specifically bind to the reverse splicing site of the circNDUFA10, the sequence of the circNDUFA10 is SEQ ID NO: 1, and the sequence of the antisense oligonucleotide is SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4.
[0012] Another object of the present application is to provide a drug for treating lung adenocarcinoma, comprising an antisense oligonucleotide for inhibiting the expression of m6A modified circNDUFA10, wherein the antisense oligonucleotide can specifically bind to the reverse splice site of circNDUFA10, the sequence of the circNDUFA10 is SEQ ID NO: 1, and the sequence of the antisense oligonucleotide is SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4.
[0013] The present application has the following beneficial effects: the present application develops specific primers, probes and antibodies for the expression amount of m6A modified circNDUFA10 as a diagnostic marker for lung adenocarcinoma, constructs corresponding diagnostic reagents and kits, and realizes accurate detection of the expression of circNDUFA10 in lung adenocarcinoma tissues; at the same time, the present application discloses the molecular mechanism of m6A modified circNDUFA10 participating in lung adenocarcinoma cell proliferation and metastasis by regulating c-Myc signaling pathway, based on which, an antisense oligonucleotide for inhibiting the expression of m6A modified circNDUFA10 is designed for preparing a drug for treating lung adenocarcinoma, which can effectively inhibit the malignant growth and migration of tumor cells. The technical scheme provides a new technical means for the molecular diagnosis and targeted treatment of lung adenocarcinoma, and has high application value and clinical popularization potential. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 is a flowchart in the embodiments of the present application; Figure 2FIG. (A. Heatmap of the differentially expressed circRNAs in three pairs of lung adenocarcinoma and adjacent normal tissues; B. Venn diagram showing the intersection results of differentially expressed circRNAs in three pairs of lung adenocarcinoma and adjacent normal tissues; C. Prediction of m6A modification sites on circNDUFA10 based on SRAMP database; D. Analysis of the distribution of potential m6A modification sites on circNDUFA10 using circPrimer2.0 software; E. MeRIP-qPCR was used to verify the m6A modification level of circNDUFA10 in normal lung epithelial cells and LUAD cell lines; F. Genomic location of circNDUFA10 and reverse splicing process, the sequence of the reverse splicing junction site in the lower right corner was verified based on Sanger sequencing; G. RT-qPCR experiment was used to detect circNDUFA10 using divergent and convergent primers with cDNA and gDNA as templates, and the reaction products were further verified by agarose gel electrophoresis; H. q-PCR was used to detect the tolerance of circNDUFA10 and its host gene NDUFA10 mRNA to RNase R; I. The stability of circNDUFA10 and NDUFA10 mRNA was detected by actinomycin D treatment; J. Nucleocytoplasmic separation experiment was used to detect the subcellular localization of circNDUFA10; K. RT-qPCR was used to detect the expression of circNDUFA10 in normal lung epithelial cells and lung adenocarcinoma cells; L. RT-qPCR was used to detect the expression of circNDUFA10 in lung adenocarcinoma and adjacent normal tissues); Figure 3 FIG. (A. RT-qPCR analysis of circNDUFA10 and its host gene NDUFA10 mRNA expression after circNDUFA10 knockdown; B, D. CCK-8 and EDU were used to evaluate the proliferation ability of lung adenocarcinoma cells after knockdown of circNDUFA10; C. Clonogenic assay was used to detect the clonogenic ability of cells after knockdown of circNDUFA10; E, F. Transwell invasion and migration experiments were used to detect the migration and invasion ability of lung adenocarcinoma cells after knockdown of circNDUFA10; G. Western blot was used to detect the expression of EMT-related marker proteins in lung adenocarcinoma cells after knockdown of circNDUFA10); Figure 4Figure 1. circNDUFA10 promotes c-Myc translation in an m6A-dependent manner (A. RT-qPCR was used to detect c-Myc mRNA expression level in A549 and H1299 cells after knockdown of circNDUFA10; B. western blot was used to detect c-Myc protein expression after knockdown and overexpression of circNDUFA10; C, D. WB was used to detect whether the regulatory effect of circNDUFA10 on c-Myc protein expression was dependent on m6A modification; E, F. CHX treatment was used to detect the protein stability of c-Myc after overexpression of circNDUFA10; G, H. Ribosome RIP was used to detect the effect of circNDUFA10 on c-Myc translation efficiency and whether this effect was dependent on m6A modification); Figure 5 Figure 2. Overexpression of c-Myc rescues the inhibitory effect of circNDUFA10 knockdown on the malignant phenotype of lung adenocarcinoma cells (A. Western blot was used to detect the protein level of c-Myc after overexpression of c-Myc; B, D. CCK-8 and EDU were used to determine the effect of c-Myc overexpression on the proliferation of circNDUFA10 knockdown cells; C. Clonogenic assay was used to detect the effect of c-Myc overexpression on the clonogenic ability of circNDUFA10 silenced cells; E, F. Tanswell migration and invasion assays were used to detect the effect of c-Myc overexpression on the migration and invasion ability of circNDUFA10 knockdown cells; G. Immunoblot analysis was used to detect the expression of EMT-related marker proteins); Figure 6Figure A. Based on single-cell data set analysis of the correlation between the average expression of six translation-related m6A readers and c-Myc; red represents positive correlation, blue represents negative correlation, and the larger the square, the greater the absolute value of the correlation coefficient; B. Based on CPTAC database analysis of the protein expression correlation between six translation-related m6A readers and c-Myc in LUAD; C, D. Analysis of the protein expression of YTHDF3 and IGF2BP2 in LUAD by CPTAC database; E, G. z-score scatter plot of different grouping samples; different colors represent different groups, and each scatter point represents a sample; the abscissa and the ordinate represent the z-score of YTHDF3 / IGF2BP2 and MYC, respectively, and z-score≤0 indicates low expression of the gene, and z-score>0 indicates high expression of the gene; F, H. Combined Kaplan-Meier survival analysis of YTHDF3 / IGF2BP2 and MYC in lung adenocarcinoma; the abscissa represents the survival time (months), and the ordinate represents the probability of individual survival beyond a certain time; the table in the upper right corner shows the Log-rank test results between each two survival curves, and the lower left corner shows the overall Log-rank test results; I. RNA immunoprecipitation (RIP) experiment was used to verify the binding between YTHDF3 protein and circNDUFA10 in A549 and H1299 cells; J. MeRIP was used to detect the change of m6A modification level of circNDUFA10 in A549 cells after overexpression of wild-type METTL3 and m6A modification catalytic domain mutant METTL3 (METTL3-Mut); K. RIP was used to detect the content of circNDUFA10 combined with YTHDF3 protein in A549 cells after overexpression of wild-type METTL3 and m6A modification catalytic domain mutant METTL3 (METTL3-Mut); L, M. The expression level of c-Myc mRNA was detected by RT-qPCR after overexpression and knockdown of circNDUFA10; N, O. The protein expression level of c-Myc was detected by Western blot analysis after overexpression and knockdown of circNDUFA10; Figure 7Figure 1. circNDUFA10 promotes c-Myc translation by enhancing YTHDF3-c-Myc mRNA interaction (A-C. WB was used to detect the protein expression of c-Myc after overexpression / knockdown of YTHDF3; D, E. WB was used to detect the mediation of YTHDF3 on the regulation of c-Myc protein expression by circNDUFA10; F, G. Ribosome RIP experiment showed that the regulation of circNDUFA10 on c-Myc translation depended on YTHDF3; H, I. RIP experiment showed that overexpression of circNDUFA10 could promote the binding of YTHDF3 and c-Myc mRNA); Figure 8 Figure 2. circNDUFA10 overexpression promotes lung adenocarcinoma proliferation and metastasis in vivo (A, tumor tissue graph of subcutaneous tumor in nude mice; B. The volume change of subcutaneous tumor in nude mice within 28 days after injection of circNDUFA10 stable overexpression cells and corresponding control cells; C. The final tumor weight of xenograft tumor at the end point; D. The whole body metastasis of nude mice after tail vein injection was imaged; E. The lung tissue section of tail vein metastasis tumor; F. H&E staining of tail vein metastasis tumor lung tissue; G. Western blot was used to detect the expression of N-cadherin, E-cadherin, Snail, YTHDF3 and c-Myc protein in xenograft tumor tissue of control group and circNDUFA10 overexpression group); Figure 9Figure A. Validation of circNDUFA10 overexpression promotes lung adenocarcinoma cell proliferation, invasion, migration and EMT process in the present application (Figure A. The relative expression levels of circNDUFA10 and its host gene NDUFA10 mRNA were detected by RT-qPCR when circNDUFA10 was overexpressed in A549 and H1299 cells, which reflected that circNDUFA10 overexpression did not affect the mRNA level of the host gene; Figure B. CCK-8 experiment was used to detect the cell proliferation of A549 and H1299 cells under different treatments (Vector, circNDUFA10) with time (days) change, which reflected the promotion of circNDUFA10 overexpression on cell proliferation; Figure C. Cloning formation experiment was used to detect the cloning formation ability of A549 and H1299 cells under different treatments (Vector, circNDUFA10), and the number of cloning cells was used as the measure; Figure D. EdU experiment combined with fluorescence staining (Hoechst33342 staining nucleus, EdU labeling proliferating cells) was used to detect the cell proliferation of A549 and H1299 cells under different treatments (Vector, circNDUFA10); Figure E. Transwell experiment was used to detect the migration and invasion ability of A549 and H1299 cells under different treatments (Vector, circNDUFA10), and the migrated and invaded cells were observed under microscope; Figure F. Quantification of Transwell experiment results, the number of migrated and invaded cells of A549 and H1299 cells under different treatments (Vector, circNDUFA10) was counted and presented in percentage form; Figure G. Western blot was used to detect the expression levels of EMT related markers (N-Cadherin, E-Cadherin, Snail) and host gene NDUFA10 protein of A549 and H1299 cells under different treatments (Vector, circNDUFA10), and β-actin was used as internal reference); Figure 10Figure A. Western blot detection of c-Myc protein expression level in A549 and H1299 cells under different treatments (Vector+NC, circNDUFA10+NC, circNDUFA10+si-c-Myc-2, etc.), β-actin as internal reference, to verify the c-Myc knockdown efficiency; Figure B. CCK-8 experiment to detect the cell proliferation of A549 and H1299 cells under different treatments (Vector+NC, circNDUFA10+NC, circNDUFA10+si-c-Myc-2) with time (days) change, to reflect the reversal of the cell proliferation promoting effect of circNDUFA10 overexpression cells by knocking down c-Myc; Figure C. Cloning formation experiment to detect the cloning formation ability of A549 and H1299 cells under different treatments (Vector+NC, circNDUFA10+NC, circNDUFA10+si-c-Myc-2), measured by the number of cloning cells; Figure D. EdU experiment combined with fluorescence staining (Hoechst33342 dye nucleus, EdU label proliferating cells) to detect the cell proliferation of A549 and H1299 cells under different treatments (Vector+NC, circNDUFA10+NC, circNDUFA10+si-c-Myc-2); Figure E. Transwell experiment to detect the migration and invasion ability of A549 and H1299 cells under different treatments (Vector+NC, circNDUFA10+NC, circNDUFA10+si-c-Myc-2), and the migrated and invaded cells were observed under microscope; Figure F. Quantification of the results of Transwell experiment, to count the number of migrated and invaded cells of A549 and H1299 cells under different treatments (Vector+NC, circNDUFA10+NC, circNDUFA10+si-c-Myc-2), and presented in percentage form; Figure G. Western blot detection of EMT related markers (N-Cadherin, E-Cadherin, Snail) and c-Myc protein expression level in A549 and H1299 cells under different treatments (Vector+NC, circNDUFA10+NC, circNDUFA10+si-c-Myc-2), β-actin as internal reference. DETAILED DESCRIPTION
[0015] The application will be further described in detail below with examples.
[0016] The circRNA researched in the application is circNDUFA10 (circBase ID: has_circ_0058923), the length is 815 bp, the nucleotide sequence is SEQ ID NO:1, and the specific sequence is as follows: SEQ ID NO:1: AGAGGAATTCATAGCAGTGTGCAGTGCAAACTGCGCTATGGAATGTGGCATTTCCTACTTGGGGATAAAGCAAGCAAAAGACTGACAGAACGCAGCAGAGTGATAACTGTAGATGGCAATATATGTACTGGAAAAGGCAAACTTGCAAAAGAAATAGCAGAGAAACTAGGCTTCAAGCACTTTCCTGAAGCGGGGATTCATTATCCAGACAGTACCACAGGAGATGGGAAGCCCCTCGCCACCGACTATAATGGCAACTGTAGTTTGGAGAAATTTTACGATGATCCGAGAAGCAATGATGGCAACAGTTACCGCCTGCAGTCCTGGTTGTACAGCAGTCGCCTGCTGCAGTACTCAGATGCCTTGGAGCACTTGCTGACCACAGGACAAGGTGTTGTGTTGGAGCGCTCCATCTTCAGTGACTTTGTGTTCCTGGAGGCGATGTACAACCAGGGATTCATCCGAAAGCAGTGTGTGGACCACTACAACGAGGTGAAGAGCGTCACCATCTGCGATTACCTGCCCCCCCACCTGGTGATTTACATCGATGTGCCCGTTCCAGAGGTCCAGAGGCGGATTCAGAAGAAAGGAGATCCACATGAAATGAAGATCACCTCTGCCTATCTACAGGACATTGAGAATGCCTATAAGAAAACCTTTCTCCCTGAGATGAGTGAAAAATGTGAGGTTTTACAATATTCTGCAAGGGAAGCTCAAGATTCAAAAAAGGTGGTAGAGGACATTGAATACCTGAAGTTCGATAAAGGGCCGTGGCTCAAGCAGGACAATCGCACTTTATACCACCTGCGATTACT.
[0017] The application designs three antisense oligonucleotides (ASO) for the reverse splicing site of circNDUFA10, which are named ASO-circNDUFA10-1 (5'-3'), ASO-circNDUFA10-2 (5'-3') and ASO-circNDUFA10-3 (5'-3') respectively, and the nucleotide sequences thereof correspond to SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 in turn, and are as follows: SEQ ID NO: 2: CCTGCGATTACTAGAGGAAT; SEQ ID NO: 3: GCGATTACTAGAGGAATTCA; SEQ ID NO: 4: CTGCGATTACTAGAGGAATT.
[0018] Application of m6A modified circNDUFA10 in preparation of a lung adenocarcinoma diagnosis marker In order to screen a circRNA marker suitable for the diagnosis of lung adenocarcinoma, the m6A-circRNA epitranscriptome chip technology is used to detect lung adenocarcinoma (LUAD) tissues and para-cancer tissues in the embodiments of the application, and it is found that the m6A modification level of circNDUFA10 is significantly up-regulated in the LUAD tissues. The differential expression is verified in a plurality of LUAD cell lines (such as A549, H1299, H1650 and HCC827) by MeRIP-qPCR.
[0019] Further analysis by RT-qPCR shows that the expression of circNDUFA10 is up-regulated in the LUAD tissues and cell lines, and the m6A modification level thereof is significantly increased in the cancer tissues compared with the normal tissues. Therefore, the m6A modified circNDUFA10 can be used as a specific molecular marker of lung adenocarcinoma, and can be used for the auxiliary diagnosis and risk stratification of lung adenocarcinoma.
[0020] A reagent for the diagnosis of lung adenocarcinoma In order to detect the m6A modified circNDUFA10, the embodiments of the application develop a detection reagent, which can include any of the following substances: A specific primer or probe for specifically recognizing the reverse splicing site of circNDUFA10; A specific antibody for recognizing the m6A modification site (such as the 632 or 740 site); An immunological reagent which can be used in combination with MeRIP or RIP method, for enriching and detecting the m6A modified circNDUFA10.
[0021] The reagent is suitable for detecting circNDUFA10 in a tissue sample, a cell extract or a blood sample, can be matched with a qPCR, an immunoblotting, an ELISA or a high-throughput screening platform, and provides a reliable basis for early diagnosis and molecular typing of lung adenocarcinoma.
[0022] Application of modified circNDUFA10 as a drug target for lung adenocarcinoma Based on the functional experiment, it is found that the m6A modified circNDUFA10 significantly promotes the proliferation, migration and invasion of lung adenocarcinoma cells in vitro, and after knocking down circNDUFA10, the proliferation ability (CCK-8, EdU test), migration and invasion ability (Transwell experiment) of the cells are significantly reduced, and the EMT related marker proteins change (such as N-cadherin decreases, E-cadherin increases).
[0023] Further mechanism research finds that circNDUFA10 binds to m6A recognition protein YTHDF3 through m6A dependent manner, enhances the translation efficiency of c-Myc, promotes the protein expression of c-Myc, and drives the malignant progression of lung adenocarcinoma.
[0024] Therefore, the m6A modified circNDUFA10 can be used as a key drug target in the treatment of lung adenocarcinoma, and is particularly suitable for the development of a new treatment strategy targeting the c-Myc signal axis.
[0025] Application of a substance inhibiting m6A modified circNDUFA10 in the treatment of lung adenocarcinoma.
[0026] In order to intervene the expression level of circNDUFA10, the embodiments of the present application design antisense oligonucleotides (ASOs: A1, A2, A3) targeting the reverse splicing site of circNDUFA10, which can specifically knock down circNDUFA10 without affecting the expression of the host gene NDUFA10.
[0027] At the cellular level, knocking down circNDUFA10 significantly inhibits the proliferation, clone formation, migration and invasion ability of LUAD cells, and also inhibits the expression of c-Myc protein and the EMT process, verifying the treatment potential.
[0028] Therefore, the antisense oligonucleotide as an effective tool for inhibiting the expression of circNDUFA10 is suitable for preparing a drug for treating lung adenocarcinoma, and has a clear molecular mechanism of action and targeting specificity.
[0029] A drug for treating lung adenocarcinoma The drug form provided by the embodiment of the present application is an antisense oligonucleotide (ASO), and sequences A1, A2 and A3 are designed for the reverse splicing site of circNDUFA10, which can specifically knock down the expression of circNDUFA10.
[0030] In animal experiments, cells stably overexpressing or knocking down circNDUFA10 are used to construct subcutaneous xenograft tumor models and tail vein metastasis models to verify the pro-cancer effect of circNDUFA10. Compared with the control group, cells with knocked down circNDUFA10 result in reduced tumor volume and significantly reduced lung metastasis.
[0031] Therefore, the drug (antisense oligonucleotide) can be used for treating lung adenocarcinoma, by targeting down-regulating the expression of m6A modified circNDUFA10 to indirectly regulate the c-Myc pathway, thereby inhibiting the progression of lung adenocarcinoma.
[0032] The mechanism of action of m6A modified circNDUFA10 regulating c-Myc translation through YTHDF3 to promote the malignant progression of lung adenocarcinoma will be verified and analyzed in the following combined with the accompanying drawings: Reference Figures 1-8 As shown in the figure, the molecular mechanism of m6A modified circRNA and its application in lung adenocarcinoma include the following contents: 1. As Figure 1 shown, the present application screens circRNAs with different expression levels of m6A modification in lung adenocarcinoma and its adjacent tissues by m6A-circRNA epitranscriptome chip, and determines that circNDUFA10 is a circular RNA molecule with high m6A modification in lung adenocarcinoma. Through CCK-8 proliferation test, colony formation test, EdU incorporation test, Transwell migration / invasion test and EMT marker protein analysis, the in vitro function verification is carried out and the subcutaneous xenograft tumor and tail vein metastasis tumor model is established for in vivo verification. The regulatory effect of circNDUFA10 on lung adenocarcinoma proliferation and metastasis in vivo and in vitro is analyzed and it is determined whether the related molecular mechanism depends on m6A modification.
[0033] 2. In order to better illustrate the molecular mechanism of m6A modified circRNA and its application in lung adenocarcinoma verified by the above experimental method, the specific embodiments will be described from the following steps: In order to identify the most significant difference in m6A modification level of circular RNA in lung adenocarcinoma (LUAD), the present application selects three pairs of LUAD and adjacent normal tissues for high-throughput m6A-circRNA epitranscriptome chip. The intersection analysis shows that the m6A modification level of 129 circular RNAs in lung adenocarcinoma tissue is significantly changed compared with the adjacent tissue (P<0.05, fold change>2). Figure 2A, B). Among them, the m6A modification level of circNDUFA10 (hsa_circ_0058923) in LUAD tissues was significantly increased (fold change = 3.376, p = 0.004). The potential m6A modification sites of circNDUFA10 were predicted based on the SRAMP database, including two high-confidence sites located at positions 632 and 740 Figure 2 C). The planar distribution of m6A modification sites on circNDUFA10 was visualized using the circPrimer2.0 software Figure 2 D). MeRIP experiments confirmed that the m6A modification level of circNDUFA10 was significantly up-regulated in LUAD cell lines (A549, H1299, H1650, HCC827) compared with normal lung epithelial cells (BEAS-2B) Figure 2 E).
[0034] According to circBase annotation, circNDUFA10 is a circular RNA molecule derived from exons 2-8 of the NDUFA10 gene on chromosome 2 Figure 2 F). Sanger sequencing verified its circular structure, confirming the presence of a reverse splice site between exons 2 and 8 in the NDUFA10 pre-mRNA Figure 2 G). The divergent primer amplified circNDUFA10 from cDNA templates, confirming its lack of free 5' or 3' ends. After RNase R and actinomycin D (ActD) treatment, circNDUFA10 showed stronger RNase R resistance and higher RNA stability than linear NDUFA10 mRNA Figure 2 H, I). Nucleocytoplasmic separation experiments showed its distribution in the nucleus and cytoplasm Figure 2 J). In addition, RT-qPCR analysis showed that circNDUFA10 was highly expressed in LUAD tissues and cell lines compared with the control group Figure 9 K, L). In summary, these results identified circNDUFA10 as a circular RNA molecule with high m6A modification levels and high expression itself in LUAD, suggesting its potential oncogenic role.
[0035] To evaluate the oncogenic role of circNDUFA10 in LUAD, we established A549 and H1299 cell lines stably overexpressing circNDUFA10 Figure 3 A), and designed three antisense oligonucleotides (ASOs; A1, A2, and A3) targeting the reverse splice site to achieve specific knockdown Figure 3A). Importantly, neither overexpression nor knockdown of circNDUFA10 affected the mRNA level of its host gene NDUFA10 ( Figure 9 A, Figure 3 A), confirming the specificity of these interventions.
[0036] Functional experiments showed that knockdown of circNDUFA10 significantly inhibited LUAD cell proliferation, which was confirmed by CCK-8 and EdU incorporation experiments, while overexpression of circNDUFA10 significantly enhanced these effects ( Figure 9 B, D; Figure 3 B, D). Colony formation experiments further confirmed the ability of circNDUFA10 to promote colony formation ( Figure 9 C; Figure 3 C). Transwell experiments showed that knockdown of circNDUFA10 significantly reduced the invasion and migration abilities of A549 and H1299 cells, while its overexpression increased these abilities ( Figure 9 E-F; Figure 3 E-F). Western blot analysis showed that knockdown of circNDUFA10 down-regulated the protein expression of mesenchymal marker (N-cadherin) and EMT core transcription factor Snail, while up-regulated the protein expression of epithelial marker E-cadherin ( Figure 9 G). In contrast, overexpression of circNDUFA10 reversed this EMT feature ( Figure 3 G).
[0037] Notably, although some circular RNAs have been shown to exert biological functions by regulating the expression of their host genes, knockdown or overexpression of circNDUFA10 did not affect the protein expression of NDUFA10 ( Figure 9 G; Figure 4 G), ruling out the possibility that its function depends on the linear transcript. Taken together, these results established circNDUFA10 as a driver of LUAD progression, acting independently of its host gene NDUFA10.
[0038] Emerging evidence suggests that m6A-modified circular RNAs can enhance or inhibit m6A recognition protein-mediated regulation of target mRNAs. Given the crucial role of c-Myc as an oncogenic driver in lung adenocarcinoma (LUAD) and its regulation by multiple m6A recognition proteins, we hypothesized that highly m6A-modified circNDUFA10 might regulate c-Myc expression in an m6A-dependent manner. To verify this, we first assessed whether circNDUFA10 regulates c-Myc expression. qPCR and Western blot analyses showed that knockdown and overexpression of circNDUFA10 did not regulate c-Myc mRNA levels (…). Figure 4 B), only regulates its protein expression ( Figure 4 A). To determine the m6A-dependent nature of this regulation, we knocked down METTL3 (the core m6A methyltransferase) and overexpressed wild-type METTL3 and an m6A-modified catalytic domain mutant (METTL3-MUT), respectively. In METTL3-knockdown cells, overexpression of circNDUFA10 failed to enhance c-Myc protein levels when METTL3-MUT was reintroduced instead of wild-type METTL3. Figure 4 CD), which confirms that the regulatory role of circNDUFA10 in c-Myc protein expression depends on m6A modification.
[0039] Since circNDUFA10 only regulates c-Myc protein expression without altering its mRNA level, we next aimed to determine whether it inhibits c-Myc protein degradation or enhances its translation. Cycloheximide (CHX) tracking experiments showed no difference in c-Myc protein stability between cells overexpressing circNDUFA10 and control cells. Figure 4 EF) ruled out the possibility of affecting protein degradation. Ribosomal immunoprecipitation (RIP) experiments using the FLAG-tagged ribosomal protein RPL22 showed that knockdown of circNDUFA10 significantly reduced the binding of c-MycmRNA to ribosomes (EF). Figure 4 G), indicating impaired translation. Notably, overexpression of METTL3, rather than METTL3-MUT, enhanced ribosome-binding c-MycmRNA levels (G). Figure 5 G). In summary, these results indicate that circNDUFA10.
[0040] Given that circNDUFA10 regulates c-Myc expression via an m6A-dependent mechanism, we conducted a rescue experiment to investigate whether c-Myc mediates the oncogenic function of circNDUFA10. Western blotting confirmed the effective overexpression of c-Myc in LUAD cells. Figure 5A). CCK-8, EdU incorporation and colony formation assays showed that c-Myc overexpression significantly rescued the inhibition of proliferation and colony formation caused by circNDUFA10 knockdown ( Figure 5 B-D). Similarly, Transwell assays and immunoblotting of EMT-related markers showed that c-Myc overexpression reversed the inhibition of invasion, migration and EMT progression caused by circNDUFA10 knockdown ( Figure 10 E-G). Conversely, c-Myc knockdown in circNDUFA10 overexpressing cells significantly rescued the pro-malignant phenotype driven by circNDUFA10 ( Figure 6 A-G). These findings further validated that c-Myc could mediate the pro-oncogenic role of circNDUFA10 in lung adenocarcinoma.
[0041] The regulatory role of m6A modification on target genes is mainly achieved by m6A recognition proteins, so we want to further clarify the m6A recognition proteins that mediate the regulation of c-Myc translation by the circNDUFA10 / m6A axis. According to existing research on m6A modification, we selected six m6A recognition proteins that can regulate mRNA translation, namely YTHDF1, YTHDF3, YTHDC2, IGF2BP1 / 2 / 3.
[0042] First, we compared the correlation between the average expression of the above six genes and the average expression of MYC in the single-cell data set by bioinformatics analysis. The results showed that YTHDF1, YTHDF3 and IGF2BP2 were significantly positively correlated with MYC ( Figure 6 A). Next, we further analyzed the correlation between the six m6A recognition proteins and the protein expression of c-Myc in lung adenocarcinoma. The results showed that IGF2BP1, IGF2BP3, YTHDC2, YTHDF1 had no obvious correlation with c-Myc protein expression, and YTHDF3 and IGF2BP2 were positively correlated with c-Myc protein expression ( Figure 6 B). Therefore, we analyzed the protein expression of YTHDF3 and IGF2BP2 in lung adenocarcinoma through the CPTAC database, and the results showed that YTHDF3 was highly expressed in lung adenocarcinoma and IGF2BP2 was lowly expressed in lung adenocarcinoma ( Figure 6 C-D). However, some studies
[3435] have shown that IGF2BP2 is highly expressed in lung adenocarcinoma and is associated with the malignant progression and poor prognosis of lung adenocarcinoma, and cannot directly exclude the possibility of IGF2BP2 regulating c-Myc protein expression in lung adenocarcinoma based on expression. Therefore, we next want to explore the potential association between the two and MYC through transcriptome combined survival analysis. After grouping patients according to the expression of YTHDF3, IGF2BP2 and MYC ( Figure 6E, G), compared to the YTHDF3 and MYC low expression group, the YTHDF3 and MYC high expression group showed poor prognosis, while there was no significant difference between other groups. This further implies the potential association between YTHDF3 and c-Myc. However, there was no significant difference in patient prognosis between the combined groups of IGF2BP2 and MYC. Therefore, we speculate that circNDUFA10 may regulate the translation of c-Myc by combining with YTHDF3 through m6A modification, thereby up-regulating its expression.
[0043] To verify this, the RIP experiment confirmed that anti-YTHDF3 antibody could enrich circNDUFA10 ( Figure 6 I), while overexpression of METTL3 could enhance the content of enriched circNDUFA10, but this enhancement was not significant in the METTL3-MUT group ( Figure 6 J-K). These results show that circNDUFA10 binds to YTHDF3 in an m6A-dependent manner. In addition, circNDUFA10 does not affect the mRNA and protein expression of YTHDF3 ( Figure 7 L-O). In summary, circNDUFA10 can bind to YTHDF3 through m6A modification, but does not affect the expression of YTHDF3, which indicates that circNDUFA10 may act as a scaffold to promote the binding of YTHDF3 to c-Myc mRNA.
[0044] To determine whether circNDUFA10 acts as a scaffold to promote YTHDF3-driven c-Myc mRNA translation, we first verified the regulatory effect of YTHDF3 on c-Myc expression. Western blotting showed that YTHDF3 knockdown or overexpression significantly inhibited or enhanced c-Myc protein levels in lung adenocarcinoma (LUAD) cells ( Figure 7 A-C), confirming that YTHDF3 is a regulator of c-Myc. Importantly, YTHDF3 overexpression rescued the down-regulation of c-Myc protein caused by circNDUFA10 knockdown, while YTHDF3 knockdown reversed the up-regulation of c-Myc protein induced by circNDUFA10 overexpression, which was verified in A549 and H1299 cells ( Figure 7D-E). This indicates that YTHDF3 is an important regulator mediating the regulation of c-Myc protein expression by circNDUFA10. Next, we want to clarify whether YTHDF3 plays a function by assisting circNDUFA10 in the regulation of c-mYC translation. Consistent with our hypothesis, the ribosome RIP experiment confirmed that overexpression of YTHDF3 can promote the translation of c-Myc, and the regulation of c-Myc translation by circNDUFA10 depends on the mediation of YTHDF3 Figure 7 F-G).
[0045] Based on the above results, we hypothesize that circNDUFA10 can promote the binding of YTHDF3 to c-Myc mRNA. RIP experiments show that, compared with the IgG group, the content of c-Myc mRNA enriched by anti-YTHDF3 antibody is significantly increased after overexpression of circNDUFA10 Figure 8 H-I). In summary, circNDUFA10 can promote the binding of YTHDF3 to c-Myc mRNA in a m6A-dependent manner, and further enhance the translation of c-Myc.
[0046] To evaluate the effect of circNDUFA10 on the proliferation and metastasis of lung adenocarcinoma in vivo, we established a subcutaneous xenograft model and a tail vein metastasis model. First, to form subcutaneous tumors, we injected cell lines stably overexpressing circNDUFA10 and their corresponding control cell lines into the subcutaneous right axilla of nude mice. The results showed that overexpression of circNDUFA10 significantly increased the volume and weight of xenograft tumors Figure 8 A-C). Next, we further investigated whether circNDUFA10 could affect lung adenocarcinoma metastasis in a nude mouse tail vein metastasis model. Notably, small animal live imaging experiments showed that overexpression of circNDUFA10 significantly increased the formation of metastatic foci in the whole body of nude mice compared with the control group Figure 8 D). The number of surface tumors in lung tissue and the results of H&E staining further confirmed these findings E-F). In addition, we evaluated the protein expression levels of c-Myc, YTHDF3, N-cadherin, E-cadherin, and Snail in xenograft tumor tissues by immunoblotting analysis, and the results were consistent with previous experiments. In summary, our research findings indicate that m6A-modified circNDUFA10 promotes the malignant progression of lung adenocarcinoma by enhancing the YTHDF3 / c-Myc axis.
[0047] In general, the following steps are included: circNDUFA10 was screened and verified in lung adenocarcinoma by m6A-circRNA epitranscriptome chip and MeRIP; Sanger sequencing and agarose gel electrophoresis were used to verify the existence of reverse splicing binding sites; RT-qPCR was used to detect the tolerance of circNDUFA10 and its host gene NDUFA10 mRNA to RNase R and the RNA stability after actinomycin D treatment; nuclear-cytoplasmic separation experiment was used to detect the subcellular localization of circNDUFA10; RT-qPCR was used to detect the expression amount of circNDUFA10 in lung adenocarcinoma cells and tissues; RT-qPCR was used to analyze the expression levels of circNDUFA10 and its host gene NDUFA10 mRNA after knockdown of circNDUFA10; CCK-8 and EDU were used to detect the proliferation ability of lung adenocarcinoma cells after knockdown of circNDUFA10; Clonogenic assay was used to detect the clonogenic ability of lung adenocarcinoma cells after knockdown of circNDUFA10; Transwell experiment was used to detect the invasion and migration ability of lung adenocarcinoma cells after knockdown of circNDUFA10; WB was used to detect the expression changes of EMT-related marker proteins after knockdown of circNDUFA10; RT-qPCR and immunoblotting analysis were used to detect the regulatory effect of circNDUFA10 on c-Myc mRNA and protein expression levels and to determine whether the regulation of c-Myc protein expression was dependent on m6A modification; immunoblotting analysis was used to detect the effect of overexpression of circNDUFA10 on c-Myc protein stability after cycloheximide treatment of cells; ribosome immunoprecipitation experiment was used to confirm whether circNDUFA10 regulated c-Myc mRNA translation and whether this regulation was dependent on m6A modification; Immunoblotting analysis was used to detect the efficiency of overexpression of c-Myc; CCK-8, EDU and clonogenic assay were used to detect the proliferation and clonogenic ability of lung adenocarcinoma cells; Tanswell experiment was used to detect the invasion and migration ability of lung adenocarcinoma cells; immunoblotting analysis was used to detect the expression of EMT-related marker proteins; Based on existing research, six m6A recognition proteins with translation regulation function were selected, and YTHDF3 was screened by average expression correlation of single-cell data set, protein expression correlation, protein expression difference and double-gene joint survival analysis; RIP and MeRIP experiments were used to confirm whether the binding between circNDUFA10 and YTHDF3 was dependent on m6A modification mediated by METTL3; RT-qPCR and immunoblotting analysis were used to detect whether circNDUFA10 regulated the mRNA and protein expression of YTHDF3; Western blotting analysis was used to detect whether YTHDF3 regulates the protein expression of c-Myc and whether it can mediate the regulatory effect of circNDUFA10 on the protein expression of c-Myc; ribosome immunoprecipitation experiment was used to verify whether YTHDF3 can mediate the translation regulatory effect of circNDUFA10 on c-Myc in A549 and H1299 cells; immunoprecipitation experiment was used to detect whether circNDUFA10 can affect the binding between YTHDF3 and c-Myc mRNA; The subcutaneous tumor transplantation model and the tail vein metastasis tumor model of nude mice were constructed to further verify the regulatory effect of circNDUFA10 on the proliferation and metastasis of lung adenocarcinoma in vivo: the volume and weight of the subcutaneous tumor of nude mice were measured after injection of circNDUFA10 stable overexpression cells and corresponding control cells, and the expression of YTHDF3, c-Myc and EMT related marker proteins was detected by Western blotting analysis; the whole body metastasis of nude mice was detected by in vivo imaging instrument, the tumor on the surface of lung tissue of euthanized nude mice was counted, and finally the lung surface tumor tissue was verified by HE staining.
[0048] The above is only the preferred embodiment of the present application, and the protection scope of the present application is not limited to the above-mentioned embodiments. Any technical solution falling within the concept of the present application shall fall within the protection scope of the present application. It should be noted that, for ordinary skilled persons in the art, some improvements and refinements without departing from the principles of the present application shall also be considered as the protection scope of the present application.
Claims
1. Application of m6A modified circNDUFA10 in preparation of a lung adenocarcinoma diagnosis marker, wherein the sequence of the circNDUFA10 is SEQ ID NO:
1.
2. A reagent for lung adenocarcinoma diagnosis, characterized by: The substance comprises specific primers, probes or antibodies for recognizing the reverse splicing site and / or m6A modification site of the m6A modified circNDUFA10, wherein the sequence of the circNDUFA10 is SEQ ID NO:
1.
3. A kit for the diagnosis of lung adenocarcinoma, characterized by: The kit comprises primers, probes and / or antibodies for specifically detecting the expression amount or modification level of the m6A modified circNDUFA10, wherein the sequence of the circNDUFA10 is SEQ ID NO:
1.
4. Application of m6A modified circNDUFA10 as a drug target for treating lung adenocarcinoma, characterized in that: The m6A modified circNDUFA10 affects the proliferation, migration and EMT process of lung adenocarcinoma cells by regulating the c-Myc signaling pathway, wherein the sequence of the circNDUFA10 is SEQ ID NO:
1.
5. The use of a substance for inhibiting the expression of m6A modified circNDUFA10 in the preparation of a drug for treating lung adenocarcinoma, characterized in that: The substance comprises an antisense oligonucleotide capable of specifically binding to the reverse splicing site of the circNDUFA10, wherein the sequence of the circNDUFA10 is SEQ ID NO: 1, and the sequence of the antisense oligonucleotide is SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO:
4.
6. A medicament for treating lung adenocarcinoma, characterized by: The antisense oligonucleotide comprises an antisense oligonucleotide capable of specifically binding to the reverse splicing site of the m6A modified circNDUFA10, wherein the sequence of the circNDUFA10 is SEQ ID NO: 1, and the sequence of the antisense oligonucleotide is SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4.