Neutralizing nucleic acid aptamer for targeted inhibition of B cell activating factor and application of neutralizing nucleic acid aptamer in treatment of systemic lupus erythematosus

Abstract

The invention discloses a neutralizing nucleic acid aptamer for targeted inhibition of a B cell activating factor and application of the neutralizing nucleic acid aptamer in treatment of systemic lupus erythematosus. The neutralizing aptamer disclosed by the invention can be used for efficiently inhibiting the combination of BAFF and specific receptors on a B cell membrane, including a BAFF receptor (BAFF-R), a human calcium regulatory cyclophilin ligand interaction molecule (TACI) and a B cell maturation antigen (BCMA), so that the proportion of plasma cells, plasma mother cells and hair growth center B cells is reduced, and finally, the generation and secretion of autoantibodies are reduced; the compound has a targeted therapeutic effect on systemic lupus erythematosus. Compared with an existing biological agent for neutralizing BAFF, the neutralizing nucleic acid aptamer has the advantages of being high in specificity, high in affinity, easy to synthesize, low in immunogenicity, low in cost, capable of being designed and programmed and the like, is a potential novel nucleic acid preparation for SLE targeted therapy, and has a good clinical transformation application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of screening and application of neutralizing nucleic acid aptamers, and particularly relates to a neutralizing nucleic acid aptamer that targets and inhibits B cell activating factor (BAFF) and its application in the treatment of systemic lupus erythematosus. Background Art

[0002] Systemic lupus erythematosus (SLE) is a severe autoimmune disease characterized by aberrant B cell activation and abnormally increased autoantibodies, affecting multiple systems and organs. According to statistics, there are over one million SLE patients in my country. Its pathogenesis is unclear and it is difficult to cure, placing a significant burden on patients' physical and mental health. Currently, there is no specific treatment for SLE. Traditional medications such as glucocorticoids, immunosuppressants, and antimalarial drugs provide limited disease control and require long-term medication, resulting in significant toxic side effects. In recent years, biologics targeting human BAFF, such as belimumab and telitacicept, have emerged. They effectively inhibit the binding of BAFF molecules to specific receptors on the B cell membrane, including the BAFF receptor (BAFF-R), the human calcineurin ligand-interacting molecule (TACI), and the B cell maturation antigen (BCMA), thereby suppressing the production of plasma cells and the secretion of autoantibodies, demonstrating some therapeutic efficacy in SLE. However, the high cost of these biologics, coupled with the need for further validation of their long-term efficacy and safety, limits their clinical application. Therefore, there is an urgent need to develop new, safe, effective and inexpensive targeted therapies for SLE.

[0003] Aptamers are single-stranded DNA or RNA obtained through in vitro screening using the SELEX technique. Their biological functions are similar to and superior to antibodies, with advantages such as strong specificity, high affinity, ease of synthesis, low immunogenicity, low toxicity, and low cost. Neutralizing aptamers, which neutralize target molecules, can effectively inhibit the binding of target molecules to their specific ligands, and can therefore be used to treat corresponding diseases. Based on this, the present invention proposes to screen for neutralizing aptamers targeting BAFF, which plays a key role in B cell activation, to block the binding of BAFF to BAFF-R, TACI, and BCMA on the B cell membrane, thereby inhibiting plasma cell maturation and autoantibody secretion, ultimately achieving targeted treatment for SLE. This provides new technologies and solutions for the targeted treatment of SLE, and has extremely important scientific value and clinical significance in addressing the significant needs in the field of targeted treatment for SLE. Summary of the Invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a neutralizing nucleic acid aptamer that targets and inhibits B cell activation factor.

[0005] The technical problem that the present invention also aims to solve is to provide a method for obtaining a neutralizing nucleic acid aptamer.

[0006] The final technical problem to be solved by the present invention is to provide the application of the neutralizing nucleic acid aptamer that targets and inhibits B cell activation factor in the preparation of drugs for treating SLE.

[0007] Technical solution: In order to solve the above technical problems, the present invention provides a neutralizing nucleic acid aptamer for targeted inhibition of BAFF, wherein the nucleotide sequence of the neutralizing nucleic acid aptamer is any one of SEQ ID NO.1 to SEQ ID NO.4, or has more than 80% identity with any one of SEQ ID NO.1 to SEQ ID NO.4.

[0008] The neutralizing nucleic acid aptamer may be phosphorylated, methoxylated, methylated, aminoated, sulfhydrylated, modified with a fluorescent molecule, fluorinated, isotopized, or coupled with any drug at any position of any one of SEQ ID NO.1 to SEQ ID NO.4.

[0009] Wherein, the neutralizing nucleic acid aptamer further comprises coupling with biotin.

[0010] The concentration of the neutralizing nucleic acid aptamer is 0.01 to 2 μM. Preferably, the concentration of the neutralizing nucleic acid aptamer is 2 μM.

[0011] The present invention also includes a method for obtaining the neutralizing nucleic acid aptamer, which is obtained by in vitro screening using a ligand-competitive magnetic bead (MNPs)-based multiple reverse screening SELEX technology (multiple reverse screening Mag-SELEX).

[0012] The present invention also includes the use of the neutralizing nucleic acid aptamer that targets and inhibits B cell activation factor in the preparation of a drug for treating SLE.

[0013] The drug includes a drug that neutralizes BAFF and inhibits its binding to BAFF-R, TACI and / or BCMA on the B cell membrane.

[0014] The drugs include drugs that reduce the proportion of plasmablasts, plasma cells and biochemical center B cells.

[0015] Wherein, the drug includes a drug that inhibits the secretion of IgG1, IgG2, IgG3 and / or IgM.

[0016] The drug includes a drug that alleviates disease progression in humanized SLE mice that overexpress BAFF.

[0017] The drugs include drugs that reduce urine protein levels, anti-dsDNA antibody levels, kidney tissue damage, inflammatory cell infiltration, and IgG and / or C3 complement deposition in humanized SLE mice.

[0018] Beneficial effects: Compared with the prior art, the present invention has the following advantages: (1) The neutralizing nucleic acid aptamers described in the present invention are obtained by in vitro screening using the multiple reverse screening Mag-SELEX technology of ligand competition. Compared with existing biological preparations, they have the advantages of short screening cycle, easy synthesis, strong specificity, high affinity, no batch-to-batch variability, low immunogenicity, few side effects, and low cost. (2) The neutralizing nucleic acid aptamers described in the present invention are designable and programmable, and are easy to transform and modify. Aptamer drugs with different neutralizing abilities and blocking efficiencies can be designed and constructed as needed; (3) The neutralizing nucleic acid aptamer described in the present invention not only can neutralize the target molecule itself, but also has a strong drug-carrying capacity. After precise design, it can achieve precise drug delivery and combined therapy, thereby improving treatment efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the multiple counter-screening Mag-SELEX technology based on ligand competition for screening BAFF neutralizing nucleic acid aptamers and SLE treatment; Figure 2 Simulate and predict the secondary structure diagram of nucleic acid aptamers for DNAMAN software; Figure 3 The figure shows the results of the identification of the binding ability of candidate neutralizing nucleic acid aptamers to BAFF; Figure 4 The figure shows the results of BAFF neutralizing aptamer modification based on secondary structure and its affinity determination. Figure 4 A in the figure is the secondary structure diagram of the nucleic acid aptamer before and after modification predicted by DNAMAN software. Figure 4 Figure B shows the Kd values ​​of the neutralizing nucleic acid aptamer before and after modification; Figure 5 This is the molecular docking result diagram of the modified neutralizing nucleic acid aptamer sequence 1a and BAFF; Figure 6 This is a graph showing the results of characterizing the neutralization ability of BAFF neutralizing nucleic acid aptamer sequence 1a; Figure 7 Figure 2 is the result of the proliferation and toxicity test of BAFF neutralizing nucleic acid aptamer sequence 1a on human PBMC cells; Figure 8 The figure shows the results of the determination of the ability of the BAFF neutralizing nucleic acid aptamer sequence 1a to inhibit the antibody secretion of human PBMC; Figure 9This figure shows the effects of BAFF neutralizing aptamers on the body weight, anti-dsDNA antibodies, and urine protein levels of SLE mice; Figure 9 A in the figure shows the effect of BAFF neutralizing nucleic acid aptamer on the body weight of SLE mice; Figure 9 Figure B shows the effect of BAFF neutralizing aptamer on anti-dsDNA antibodies in SLE mice; Figure 9 Figure C shows the effect of BAFF neutralizing nucleic acid aptamer on the urine protein level of SLE mice; Figure 10 This figure shows the effect of BAFF neutralizing nucleic acid aptamer on B cell subtypes related to antibody secretion in the spleen of SLE mice; Figure 11 Figure 2 shows the effect of BAFF neutralizing aptamer on pathological damage and immune complex deposition in renal tissue of SLE mice. The line segments in the figure represent a scale of 100 μm. DETAILED DESCRIPTION

[0020] The following examples are provided for a better understanding of the present invention, but are not intended to limit the scope of protection of the present invention. Unless otherwise specified, the experimental methods, materials, and reagents used in the following examples are conventional methods, laboratory routine materials and reagents, and can all be purchased from the market.

[0021] The main reagents and materials used include: Ficoll solution (Cytiva, Catalog No. 17-1440-03), DPBS (10×) buffer (Gibco, Catalog No. 14200075), human BAFF protein (GenScript Biotech Co., Ltd., Catalog No. Z02976), human serum albumin (MedChemExpress, Catalog No. HY-P1956), human IgG (Sangon Biotech (Shanghai) Co., Ltd., Catalog No. D110501), carboxyl magnetic nanoparticles (MNPs). -COOH (Sangon Biotech (Shanghai) Co., Ltd., Catalog No. D149007), Streptavidin Magnetic Beads SA-MNPs (Sangon Biotech (Shanghai) Co., Ltd., Catalog No. D112005), EDC (Sangon Biotech (Shanghai) Co., Ltd., Catalog No. C600433), Sulfo-NHS (Shanghai Yuanye Biotechnology Co., Ltd., Catalog No. S30615), Carboxyl Magnetic Beads Activation Buffer (Sangon Biotech (Shanghai) Co., Ltd., Catalog No. D601030), Carboxyl magnetic bead coupling buffer (Sangon Biotech, Cat. No. D601031), SLE mice overexpressing human BAFF (B6-hBAFF, Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.), SA-HRP (Sangon Biotech (Shanghai) Co., Ltd., Cat. No. D111054), bovine serum albumin (BSA) (Sangon Biotech (Shanghai) Co., Ltd., Cat. No. A600332), salmon sperm DNA (Solarbio, D8030), human BAFF-R (Nearshore protein, C02U), human T ACI (Abcam, C07R), human BMCA (Abcam, CS79), human BAFF ELISA kit (Proteintech, KE00215), mouse anti-dsDNA antibody detection kit (Huamei Biotechnology, CSB-E11194m), urine protein detection kit (Nanjing Jiancheng Bioengineering Institute, C035-2-1), rabbit anti-mouse C3 antibody (Proteintech, Cat. No. 21337-1-AP), Fluorescein (FITC)-conjugated goat anti-mouse IgG antibody (Proteintech, Cat. No. SA00003-1), CoraLite594-conjugated goat anti-rabbit IgG (Proteintech, Cat. No. SA00013-4), mouse Fc receptor blocker (BD Biosciences, Cat. No. 553141), Zombie Aqua TM(Biolegend, Catalog No. 423101), CD3 (Biolegend, Catalog No. 100204), B220 (Biolegend, Catalog No. 103222), IgD (Biolegend, Catalog No. 405710), CD138 (Biolegend, Catalog No. 142523), GL-7 (Biolegend, Catalog No. 144606), FAS (Biolegend, Catalog No. 152608), cyclophosphamide CTX (Merck Biotechnology, Catalog No. C0768), R848 (MedChemExpress, Catalog No. HY-13740), 1640 culture medium (KeyGen Biotechnology, Catalog No. KGL1501), CCK8 kit (Biyuntian, Catalog No. C0038), etc.

[0022] The single-stranded DNA random library, primer sequences, subsequent nucleic acid aptamer sequences and biotin modifications in the following examples were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0023] Example 1 Screening and identification of BAFF neutralizing aptamers (1) Design the following random library and primer sequences based on the screening purpose: Random library: AGCAGAGTTCACGACCCGATAAGNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNGAGTTACATACCAATCGTCGCAG SEQ ID NO.7 Upstream primer: AGCAGAGTTCACGACCCGATAAG SEQ ID NO.5 Downstream primer: Biotin-CTGCGACGATTGGTATGTAACTC SEQ ID NO.6 (2) Preparation of 2× binding buffer: dilute 10× DPBS buffer to 2× with sterile water, then add MgCl2 at a final concentration of 10 mM, salmon sperm DNA at a final concentration of 0.2 mg / mL, and bovine serum albumin (BSA) at a final concentration of 2 mg / mL; (3) Preparation of cleaning solution: Add 1× DPBS buffer to a final concentration of 5 mM MgCl2; (4) Preparation of magnetic bead-coupled human BAFF protein (BAFF-MNPs): Take 10 mg of MNPs-COOH, wash it three times with pre-cooled carboxyl magnetic bead activation buffer, add it to 1 mL of carboxyl magnetic bead activation buffer containing 5 mg EDC and 5 mg Sulfo-NHS, and incubate it at room temperature (20-30 °C) for 20 min; discard the supernatant after magnetic separation, add 2 mL of carboxyl magnetic bead coupling buffer containing 500 μg human BAFF protein, 5 mg EDC and 5 mg Sulfo-NHS to the activated MNPs-COOH, and incubate it at 4 °C for 12 h; discard the supernatant after magnetic separation, add 1 mL of freshly prepared 2× binding solution, and store it at 4 °C for later use.

[0024] The preparation of magnetic bead-coupled human serum albumin (HSA-MNPs) and magnetic bead-coupled human immunoglobulin (IgG-MNPs) was the same as that of BAFF-MNPs.

[0025] (5) Multiple reverse screening Mag-SELEX technology using ligand competition ( Figure 1 BAFF-MNPs were used as targets, and HSA-MNPs and IgG-MNPs were used as controls to screen for neutralizing aptamers that specifically block the binding of BAFF to its ligand. The procedure was as follows: 10 nmoles of the random library was dissolved in 500 μL of sterile water, heated at 95°C for 10 minutes, and immediately placed on ice for 10 minutes. Then, 2 mg of BAFF-MNPs dispersed in 500 μL of 2× binding buffer was added. The mixture was incubated at 37°C with rotation for 60 minutes. Unbound sequences were discarded, and 200 μL of sterile water was added and boiled in a boiling water bath for 10 minutes. The supernatant was collected by magnetic separation to obtain target-bound sequences.

[0026] (6) Preparation of secondary library: Using the supernatant collected in (5) as a template, PCR amplification was performed with an unlabeled upstream primer and a biotin-labeled downstream primer (shown in SEQ ID NO. 5 and SEQ ID NO. 6) (specific amplification conditions are shown in Table 1). 5 mg of streptavidin magnetic beads (SA-MNPs) were washed three times with PBS buffer (0.01 M, pH 7.4, the same below), then added to the PCR amplification product and incubated at room temperature for 60 min. The supernatant was discarded by magnetic separation, washed three times with PBS buffer, and incubated at room temperature for 5 min with 50 μL of 0.2 M NaOH solution. The supernatant was collected by magnetic separation, and 50 μL of 0.2 M HCl solution was added to adjust the pH to 7.0. After desalting with a desalting column, it was used as the secondary library for the next round of screening.

[0027] Table 1 PCR amplification system

[0028] Amplification conditions: 95 °C: 5 min, 95 °C: 30 s, 64 °C: 30 s, 72 °C: 30 s, 72 °C: 5 min, storage at 12 °C.

[0029] (7) Counter-screening: Repeat steps (5) and (6) twice. Heat 0.5 mL of the secondary library prepared after the third round of screening at 95 °C for 10 min and immediately place on ice for 10 min. Then add it to an equal volume of 2× binding solution containing 0.5 mg HSA-MNPs or IgG-MNPs and incubate at 37 °C for 30 min. Magnetic separation was performed to remove the supernatant and add it to 2 mg BAFF-MNPs. The cells were incubated at 37 °C for another 60 min. The supernatant was discarded after magnetic separation. 200 μL of sterile water was added to the BAFF-MNPs and boiled in a boiling water bath for 10 min. The supernatant was removed after magnetic separation to obtain the sequences bound to the BAFF-MNPs. Repeat step (6) to prepare a new secondary library for the next round of screening.

[0030] (8) Multiple rounds of screening and competitive screening: After repeating (7) three times, 5 μg of BAFF-R, TACI, or BCMA were added sequentially during the incubation with BAFF-MNPS after the eighth round of counter-screening to compete with the aptamer for binding to BAFF-MNPS. Finally, magnetic separation was performed and the supernatant was discarded. 200 μL of sterile water was added to the BAFF-MNPs and boiled in a boiling water bath for 10 min. The supernatant was magnetically separated and the sequences bound to BAFF-MNPs were obtained. Repeat step (6) to prepare a new secondary library for the next round of screening.

[0031] During the screening process, to improve the affinity and specificity of the aptamers, the screening pressure was gradually increased, including reducing the secondary library (from 10 nmoles to 100 pmoles), the target dosage (2 mg to 200 μg), the control molecule dosage (0.5 mg to 2 mg), shortening the positive screening time (60 min to 15 min), increasing the counter-screening time (30 min to 90 min), and increasing the number of washes (3 times to 6 times). After 13 rounds of screening, the enrichment of the secondary library reached a plateau. The final round of screening products were selected for PCR amplification, cloning, and sequencing analysis, resulting in three candidate aptamer sequences (sequence 1, sequence 2, and sequence 3) that can bind to BAFF. The secondary structures of the aptamers were simulated and predicted using DNAMAN software. The results are shown in Figure 2. Figure 2 As shown, these three candidate nucleic acid aptamers all have rich stem-loop structures, which play an important role in determining the higher-order structure, specificity, affinity and neutralization ability of nucleic acid aptamers.

[0032] Sequence 1: AGCAGAGTTCACGACCCGATAAGAGGCCACCGCTACTCAA AAGCCATATCAGAGCAGTAGGTCGAGTTACATACCAATCGTCGCAG SEQ ID NO.1 Sequence 2: AGCAGAGTTCACGACCCGATAAGTCGCTTGATAGGGCTAA AGGTGTTACG GGGTCAAATTATGGAGTTACATACCAATCGTCGCAG SEQ ID NO.2 Sequence 3: AGCAGAGTTCACGACCCGATAAGAGTTCATGAGACGCGGC AGCCCCTCCGAGCCAGATTCGCCGAGTTACATACCAATCGTCGCAG SEQ ID NO.3 (9) Identification of nucleic acid aptamers: The three candidate neutralizing nucleic acid aptamers modified with biotin synthesized by Sangon Biotechnology and the random library (control) were prepared into a working concentration of 100 nM with 1× binding buffer, and 100 μL was added to each well of a 96-well plate coated with BAFF, HSA or IgG. The plates were incubated at 37°C for 60 min, washed three times with cleaning buffer, and 100 μL of horseradish peroxidase-coupled streptavidin (SA-HRP) solution was added to each well and incubated at 37°C for 60 min. The plates were then washed six times with cleaning buffer, and 100 μL of TMB colorimetric substrate was added. The plates were developed at 37°C for 10 min, and 50 μL of stop buffer was added. The absorbance of each well at a wavelength of 450 nm was measured with an enzyme reader to identify the specificity of the three nucleic acid aptamers binding to BAFF. The results are shown in Figure 2. Figure 3 As shown, compared with the control random library group, among the three neutralizing nucleic acid aptamers, sequence 1 has a stronger binding ability to BAFF and a weaker binding ability to HSA and IgG, indicating that sequence 1 has the strongest specificity.

[0033] Example 2: Modification, optimization and affinity determination of BAFF neutralizing aptamers Based on the secondary structure of the neutralizing nucleic acid aptamer sequence 1, the nucleic acid aptamer structure was modified, and the redundant sequences that could not effectively form the core stem-loop structure were deleted to improve its affinity and neutralization ability. Figure 4As shown in Figure A, the modified neutralizing aptamer sequence 1a retains the core structure of the original sequence, while its sequence length is shortened from 86 bp to 47 bp, resulting in a shorter sequence and smaller structure. Furthermore, the affinity between the original neutralizing aptamer sequence 1 and the modified neutralizing aptamer sequence 1a was determined using aptamer-based ELISA. Specifically, human BAFF protein was dissolved in PBS buffer (0.01 M, pH 7.4) to a concentration of 10 µg / mL and then added to a 96-well microtiter plate at a volume of 100 µL per well and incubated at 4°C overnight. After washing three times, 100 μL of biotin-conjugated neutralizing aptamer (0 nM, 1 nM, 5 nM, 10 nM, 30 nM, 50 nM, 80 nM, 100 nM, 200 nM, 300 nM, and 500 nM) of different concentrations was added to each group (three replicates per group). The cells were incubated at 37°C for 60 min, washed three times with washing buffer, and 100 μL of SA-HRP was added. The cells were reacted at 37°C for 60 min, washed six times with washing buffer, and then 100 μL of chromogenic substrate TMB solution was added. The cells were developed at 37°C for 10 min. 50 μL of stop solution was added, and the absorbance of each well at 450 nm was measured on a microplate reader. The difference between the average absorbance value of each group and the average absorbance value of the blank control group was used as the ordinate, and the concentration of the neutralizing nucleic acid aptamer was used as the abscissa. The Kd value of the neutralizing nucleic acid aptamer was calculated according to the aptamer affinity calculation formula Y = BmaxX / (Kd + X). Y: relative average absorbance value; Bmax: maximum absorbance value; X: concentration of the neutralizing nucleic acid aptamer; Kd: dissociation constant (the smaller the value, the greater the affinity, and vice versa). The results are shown in Figure 2. Figure 4 As shown in Figure B, after structural modification, the Kd value of the neutralizing aptamer was reduced from 27.53 ± 7.7 nM of the original sequence to 8.14 ± 2.0 nM, indicating that the modified neutralizing aptamer sequence 1a has a higher affinity than sequence 1. Finally, the tertiary structure of sequence 1a was simulated using 3dRNA / DNA software, and sequence 1a was molecularly docked with BAFF protein using HDOCK software. The molecular docking results are shown in Figure 3. Figure 5 As shown, the neutralizing nucleic acid aptamer sequence 1a binds to the BAFF protein by forming salt bridges, electrostatics, hydrogen bonds and carbon-hydrogen bonds, and its docking score reaches -364.27, which has a strong affinity.

[0034] Sequence 1a: CGACCCGATAAGAGGCTACTCAAAAGCCATATCAGAGCAG TAGGTCG SEQ ID NO.4 Example 3 Determination of the Neutralization Ability of BAFF Neutralizing Aptamers The ability of the optimized neutralizing aptamer sequence 1a to neutralize BAFF was evaluated using a human BAFF ELISA kit. 100 μL of sequence 1a at different concentrations (0 nM, 10 nM, 100 nM, and 500 nM) was mixed with 100 ng / mL BAFF protein solution and added to a 96-well microtiter plate coated with BAFF-R, TACI, or BCMA. The plate was incubated at 37°C for 60 minutes. After three washes with wash buffer, 100 μL of biotin-conjugated BAFF antibody from the human BAFF ELISA kit was added and the plate was incubated at 37°C for 60 minutes. After three washes with wash buffer, 100 μL of SA-HRP was added and the plate was incubated at 37°C for an additional 60 minutes. Then, wash 6 times with cleaning solution, add 100 μL of TMB color development solution, develop at 37°C for 10 min, add 50 μL of stop solution to each well, and measure the absorbance of each well at 450 nm on a microplate reader. Figure 6 As shown in the figure, as the concentration of the neutralizing aptamer sequence 1a increases, the absorbance value of each well gradually decreases. When its concentration reaches 500 nM, its absorbance value no longer decreases, indicating that the neutralizing aptamer sequence 1a can block the binding of BAFF to its specific ligands BAFF-R, TACI and BCMA.

[0035] Example 4: Investigation of the proliferation and toxicity of BAFF neutralizing nucleic acid aptamers on human peripheral blood mononuclear cells (PBMCs) (1) Isolation of PBMC from healthy individuals: Mix 1 mL of 2.5 U / mL heparin sodium solution with 12.5 mL of whole blood and 11.5 mL of PBS. Slowly add 7.5 mL of Ficoll solution along the tube wall. Centrifuge at 18°C, 600 g for 30 min. Carefully aspirate the middle layer of liquid, which is the PBMC. Wash the PBMC with 15 mL of PBS solution. Finally, centrifuge at 4°C, 500 g for 10 min. Collect the precipitate, resuspend in freshly prepared 1640 complete medium, and count.

[0036] (2) CCK8 detection: The PBMCs isolated above were added to a 96-well cell culture plate, with 5×10 5 The cells were stimulated by adding 1 μg / mL of R848 and cultured at 37°C, 5% CO2 for 24 h. Subsequently, 0 μM, 0.1 μM, 0.5 μM, 1 μM, 2 μM, and 4 μM of the neutralizing nucleic acid aptamer sequence 1a were added to each experimental group, and cultured at 37°C, 5% CO2 for 24 h. Subsequently, 10 μL of CCK8 reagent was added to each well of cells and cultured for another 4 h. The absorbance value of each well at 450 nm was detected using a microplate reader. The results are shown in Figure 2. Figure 7 As shown, the cell viability of the experimental group and the control group was comparable, with no significant difference, indicating that the neutralizing nucleic acid aptamer sequence 1a had lower toxicity and better biosafety to PBMC cells.

[0037] Example 5: Determination of the ability of BAFF neutralizing aptamers to inhibit antibody secretion from human PBMCs Healthy human PBMCs were isolated (same as step (1) in Example 4) and added to a 24-well cell culture plate at 2×10 6 The cells were stimulated with 1 μg / mL of R848. Neutralizing aptamer sequence 1a was added at 0 μM (control), 0.5 μM, 1 μM, and 2 μM, respectively, to each experimental group. The cells were cultured at 37°C, 5% CO₂ for 5 days, and the cell culture supernatants were collected. ELISA was used to measure the concentrations of IgG1, IgG2, IgG3, and IgM in the supernatants of the above groups. The results are shown in Figure 2. Figure 8 As shown, compared with the control group, the neutralizing aptamer effectively inhibited the secretion of IgG1, IgG2, IgG3, and IgM in PBMCs, and its ability to inhibit these antibodies gradually increased with increasing dosage. At a dosage of 2 μM, significant differences in the secretion of all four types of antibodies were observed. These results demonstrate that the neutralizing aptamer sequence 1a can significantly inhibit the secretion of IgG1, IgG2, IgG3, and IgM in human PBMCs in vitro.

[0038] Example 6: Evaluation of the therapeutic effect of BAFF neutralizing nucleic acid aptamers on humanized SLE mice Humanized SLE mice (6-8 weeks old, female, approximately 20 g, 15 mice total) overexpressing human BAFF were purchased from Jiangsu Jicui Pharmaceutical Kang Biotechnology Co., Ltd. and divided into three groups of five mice each. PBS, cyclophosphamide (CTX), and the neutralizing aptamer sequence 1a were injected via the tail vein starting at 11 weeks of age. Treatment was administered once daily, 2.5 µmoles per dose. Body weight, urine protein, and blood anti-dsDNA antibody levels were regularly monitored. Treatment was continued for 10 weeks. At the 20th week, mice were sacrificed by cervical dislocation under anesthesia. Spleens were collected for analysis of B cell subtypes, and kidneys were harvested from both sides for hematology and immunofluorescence staining to detect renal histopathological changes and IgG and C3 complement deposition. The specific procedures were as follows: (1) Mouse weight monitoring: Starting from the day of administration, the weight of mice in each group was measured every two weeks. Figure 9 As shown in Figure A, the body weight of mice in the neutralizing nucleic acid aptamer sequence 1a treatment group and the PBS and CTX treatment groups did not change much, and there was no significant difference, indicating that the neutralizing nucleic acid aptamer sequence 1a had little effect on the body weight of mice and had good safety.

[0039] (2) Anti-dsDNA antibody detection: Mouse anti-dsDNA antibody detection kit was used for detection according to the instructions. First, 100 μL of mouse whole blood was collected and centrifuged at 10,000 rpm for 10 min, and the supernatant was taken. Then, the serum and standard were diluted with sample diluent at a volume ratio of 1:20, and then added to the ELISA plate, 100 μL per well, and incubated at 37°C for 120 min. The liquid was dried, and 100 μL of biotin-labeled conjugate was added to each well and incubated at 37°C for 60 min. The liquid was dried, washed 3 times with cleaning solution, and 100 μL of SA-HRP solution was added to each well, incubated at 37°C for 60 min, and washed 6 times with cleaning solution. After drying, 90 μL of TMB solution was added to each well, and the color was developed at 37°C for 10-20 min. Then, 50 μL of stop solution was added to each well, and the absorbance value at a wavelength of 450 nm was detected by enzyme-linked microplate reader. The results are as follows. Figure 9 As shown in Figure B, as mice age, the anti-dsDNA antibody concentrations in the CTX-treated group remain low. The anti-dsDNA antibody concentrations in both the PBS- and neutralizing aptamer sequence 1a-treated groups gradually increase, but the rate of increase and concentration of anti-dsDNA antibody concentration in the neutralizing aptamer sequence 1a-treated group are significantly lower than those in the PBS-treated group. These results suggest that the neutralizing aptamer sequence 1a can, to some extent, reduce the anti-dsDNA antibody levels in SLE mice.

[0040] (3) Urine protein detection: Detect the content of mouse urine protein according to the instructions of the urine protein detection kit. First, dilute the Coomassie Brilliant Blue working solution at a volume ratio of 1:4. Then, take 5µL of pure water, urine protein standard and urine of each group of mice, respectively, and add them to a 96-well plate. Add 300 µL of the prepared Coomassie Brilliant Blue working solution to each well, let it stand for 5 minutes, and then use an enzyme reader to measure the absorbance value of each well at 595 nm. Finally, calculate the content of urine protein according to the formula: Urine protein concentration = (measured OD-blank OD) × standard concentration (52.4 mg / dL) / (standard OD-blank OD). The results are as follows: Figure 9 As shown in Figure C, urinary protein levels in the CTX-treated group remained low as mice aged. Urinary protein levels in both the PBS- and neutralizing aptamer sequence 1a-treated groups gradually increased, but the rate of increase and concentration of urinary protein in the 1a-treated group were significantly lower than those in the PBS-treated group. The P value for the difference between the two groups was 0.0523 at the end of treatment. These results suggest that the neutralizing aptamer sequence 1a can reduce urinary protein levels in SLE mice to a certain extent.

[0041] (4) Flow cytometry of B cells: The spleens of the mice in the above groups were removed and placed in a 6-well cell culture plate. 1 mL of red blood cell lysis buffer was added. The spleens were gently ground to prepare a single cell suspension. The lysis was continued for 3-5 min until the solution was clear. 20 mL of PBS was added to terminate the lysis. Tissue debris was removed by filtering with a 70 µm cell strainer. Single cell suspensions of spleen cells were obtained by centrifugation at 600 g for 5 min at 4°C. The cells were resuspended in complete cell culture medium and counted. 1×10 6 Add cells to the flow cytometry tube, wash once with PBS, add 50 μL of 0.1% BSA solution containing 0.5 μL of mouse Fc receptor blocker to each tube, and incubate at room temperature for 20 minutes to block Fc receptors. TM , CD3, B220, IgD, CD138, GL-7, FAS mixture 0.1% BSA solution 50 μL, incubate at room temperature for 60 min, wash with PBS three times, add 200 μL PBS to each tube to resuspend, and perform flow cytometry detection. Figure 10 As shown, compared with the control PBS-treated group, the proportions of plasma cells, plasmablasts and biochemical center B cells in the spleen of BAFF humanized SLE mice treated with the neutralizing nucleic acid aptamer sequence 1a were significantly reduced, indicating that the neutralizing nucleic acid aptamer sequence 1a can inhibit the generation of plasma cells, plasmablasts and biochemical center B cells.

[0042] (5) HE staining of kidney tissue: One kidney from each group of mice was freshly collected and placed in a 2 mL centrifuge tube. The tube was filled with 4% paraformaldehyde solution and fixed for 24 h. After dehydration and transparency, paraffin-embedded tissue was prepared. Then 5 µm tissue sections were cut with a microtome and fixed on a tissue slide. Before staining, the tissue sections were baked in a 60 ° C oven for 2 h, dewaxed with conventional xylene, and then treated with ethanol and ultrapure water from high to low concentrations. Subsequently, hematoxylin was added for staining for 10 min, and after rinsing with running water, the sections were treated with 0.7% hydrochloric acid ethanol (10 s), running water (1 min), 95% ethanol (30 s) and running water (1 min) in sequence. Then, the sections were soaked in eosin staining solution for 3 to 5 min, rinsed with running water, and treated with ethanol and xylene from low to high concentrations until the tissue was dehydrated and transparent. Each step was 1 min. Finally, the sections were sealed with neutral gum and observed under a microscope and photographed. The results are as follows Figure 11 As shown, the pathological damage and inflammatory cell infiltration in the kidney tissue of BAFF humanized SLE mice treated with the neutralizing nucleic acid aptamer sequence 1a were significantly reduced compared with the PBS-treated group, indicating that the neutralizing nucleic acid aptamer sequence 1a can significantly reduce the pathological damage and inflammatory cell infiltration in the kidney tissue of SLE mice.

[0043] (6) Immunofluorescence detection of renal tissue: The freshly collected kidneys from the other side of the mice in the above groups were quickly frozen in liquid nitrogen, then embedded in OCT embedding medium, and 5 μm tissue sections were cut using a freezing microtome. They were fixed on adsorbent tissue slides and dried at room temperature for 30 minutes. The slides were washed with PBS three times for 5 minutes each time to remove the OCT embedding medium on the slides. 100 μL of blocking solution was added to the tissue and placed in a light-proof humidified box. The tissues were incubated at 37°C for 60 minutes, washed once with PBS, and the liquid was dried. 100 μL of Fluorescein (FITC)-conjugated goat anti-mouse IgG antibody or rabbit anti-mouse C3 antibody was added to the tissues and incubated at 37°C for 60 minutes. The tissues were dried and washed three times with PBS. For the IgG detection group, after washing, an appropriate amount of DAPI-containing sealing solution was added to the slides for sealing. The slides were then used for fluorescence microscopy observation and image acquisition. For the C3 detection group, after washing, the corresponding CoraLite594-conjugated goat anti-rabbit IgG was added, incubated at 37°C for 60 min, and washed three times with PBS. An appropriate amount of DAPI-containing mounting solution was added to seal the slides, and fluorescence microscopy was used for observation and image collection. Figure 11 As shown, the deposition of IgG antibodies and C3 complement in the kidney tissue of BAFF humanized SLE mice treated with the neutralizing nucleic acid aptamer sequence 1a was significantly reduced compared with the PBS-treated group, indicating that the neutralizing nucleic acid aptamer sequence 1a can reduce the deposition of immune complexes in the kidney tissue of SLE mice to a certain extent.

Claims

1. A neutralizing nucleic acid aptamer that targets and inhibits B cell activation factor, characterized in that: The nucleotide sequence of the neutralizing nucleic acid aptamer is any one of SEQ ID NO.1 to SEQ ID NO.

4.

2. The neutralizing nucleic acid aptamer according to claim 1, characterized in that The neutralizing nucleic acid aptamer may be phosphorylated, methoxylated, methylated, aminoated, sulfhydrylated, modified with a fluorescent molecule, fluorinated, isotopized, or coupled with any drug at any position of any one of SEQ ID NO.1 to SEQ ID NO.

4.

3. The neutralizing nucleic acid aptamer according to claim 1, characterized in that The neutralizing nucleic acid aptamer is further coupled with biotin.

4. Use of the neutralizing nucleic acid aptamer for targeted inhibition of B cell activating factor according to any one of claims 1 to 3 in the preparation of a drug for treating systemic lupus erythematosus.

5. The use according to claim 4, characterized in that The concentration of the neutralizing nucleic acid aptamer is 0.01-2 μM.

6. The use according to claim 4, characterized in that The drugs include drugs that neutralize BAFF and inhibit its binding to BAFF-R, TACI and / or BCMA on the B cell membrane.

7. The use according to claim 4, characterized in that The drugs include drugs that reduce the proportion of plasmablasts, plasma cells and / or biochemical center B cells.

8. The use according to claim 4, characterized in that The drugs include drugs that inhibit the secretion of IgG1, IgG2, IgG3 and / or IgM.

9. The use according to claim 4, characterized in that The drugs include drugs that alleviate disease progression in humanized SLE mice that overexpress BAFF.

10. The use according to claim 9, characterized in that The drugs include drugs that reduce urine protein levels, anti-dsDNA antibody levels, kidney tissue damage, inflammatory cell infiltration, and IgG and / or C3 complement deposition in humanized SLE mice.

Images