Intravenous administration of antisense oligonucleotides for treatment of pain
By intravenously injecting 2'-O-2-methoxyethyl modified FXYD2-LASO-Gapmer antisense oligonucleotides, the problems of large side effects of local therapeutic drugs and frequent intrathecal injections are solved, providing a long-term and effective treatment for pain, especially neuropathic pain and inflammatory pain.
Patent Information
- Application Number
- CN202480013118.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-01-06
- Filing Date
- 2024-01-05
- Publication Date
- 2025-10-03
AI Technical Summary
Existing local therapeutic drugs such as capsaicin and lidocaine have significant side effects when used for neuropathic pain, and intrathecal injection of FXYD2-LASO treatment requires long-term daily administration, which makes clinical application difficult and lacks effective long-term pain treatment options.
Treatment was with a 2'-O-2-methoxyethyl-modified FXYD2-LASO antisense oligonucleotide (FXYD2-LASO-Gapmer) administered intravenously, initially daily until complete analgesia was achieved, and then at intervals to maintain the analgesic effect.
It achieves long-term therapeutic effects on neuropathic pain and inflammatory pain, reduces side effects, and provides a less invasive long-term pain treatment option.
Smart Images

Figure BDA0005550552830000111 
Figure BDA0005550552830000121 
Figure HDA0005550552840000011
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of pain, and more particularly, the present invention relates to the specific use of intravenously administered antisense oligonucleotides for the treatment of pain. Background Art
[0002] Pain is an unpleasant sensation usually caused by an intense or damaging stimulus. The widely used definition by the International Association for the Study of Pain states: "Pain is an unpleasant sensory and emotional experience associated with, or described in terms of, actual or potential tissue damage." There are different types of pain.
[0003] Acute pain is sudden, short-term pain with a specific cause, usually tissue damage. It usually lasts less than six months and disappears once the underlying cause is treated.
[0004] Chronic pain is a common problem that poses a major challenge to healthcare providers due to its complex natural history, unclear etiology, and poor response to treatment. Chronic pain is a poorly defined condition. Most authors consider persistent pain longer than 6 months to be definitive, while others use 3 months as a minimum criterion. In chronic pain, the duration parameter is used arbitrarily. A variety of neuromuscular, reproductive, gastrointestinal, and urinary disorders can cause or contribute to chronic pain.
[0005] Nociceptive pain is the most common type of pain. It is caused by stimulation of nociceptors, which act as pain receptors for tissue damage. Nociceptors are found throughout the body, particularly in the skin and internal organs. When stimulated by a potential injury, such as a cut or other injury, they send electrical signals to the brain, causing the subject to experience pain.
[0006] Visceral pain is caused by injury or damage to an internal organ. It can be felt in the torso, including your chest, abdomen, and pelvis. It's often difficult to pinpoint the exact location of visceral pain. Visceral pain is often described as pressure, aching, squeezing, or pinching.
[0007] Somatic pain is caused by stimulation of pain receptors in tissues other than internal organs. This includes the skin, muscles, joints, connective tissue, and bones. It's often easier to pinpoint the location of somatic pain than visceral pain. Somatic pain often feels like a constant aching or gnawing sensation. It can be further categorized as deep or superficial. Deep somatic pain is felt in your joints, tendons, bones, and muscles and is often described as aching; superficial somatic pain is felt in your skin and mucous membranes and can feel sharp or throbbing.
[0008] Peripheral neuropathy pain is caused by the damage from the neural structure of the peripheral nervous system, such as the damage (for example from nociceptors) of peripheral nerve endings in the skin. These damaged nerve endings can produce pulses in the absence of stimulation, can be allergic to normal stimulation, and / or can be triggered by remaining local inflammation stimulation. Even a small amount of damaged and overactive small nerve fibers in the epidermis are also enough to trigger peripheral neuropathy pain. Example is the peripheral neuropathy pain caused by diabetic neuropathy, postherpetic neuralgia, trigeminal neuralgia, chronic idiopathic axonal polyneuropathy and chemotherapy-induced polyneuropathy.
[0009] The two most commonly used topical compounds for the treatment of neuropathic pain are capsaicin (a capsaicin receptor agonist and counter-irritant) and lidocaine (a membrane stabilizer). However, both topical capsaicin 0.025% to 0.075% and capsaicin 8% patches have the following disadvantages: application often induces intolerable side effects, such as increased burning sensation, and treatment usually must be combined with a local anesthetic to neutralize such side effects (Jay GW & Barkin RL (2014)). Topical lidocaine 5% patches disclosed in U.S. Patent Application 2014 / 0141056 and U.S. Patent Application 2013 / 0184351 require replacement every 12 hours and cannot be used on wounds, ulcers, damaged or inflamed skin, which are commonly seen in patients with diabetic neuropathy. Moreover, application to the toes, particularly in the elderly, can be problematic because the patch must be cut. Other topical forms of lidocaine up to 8% in creams and gels are also commercially available (Deny S et al. (2014)). However, there is no evidence from high-quality randomized controlled trials to support the use of topical lidocaine for the treatment of neuropathic pain, although some individual studies seem to suggest that topical lidocaine may be effective in relieving neuropathic pain (Deny S et al. (2014)). However, the consensus among patients and their practitioners is that the response rate of patients with neuropathic pain to topical lidocaine, and more generally to any neuropathic pain medication, whether topical or oral, remains quite unsatisfactory.
[0010] The term "neuropathic pain" is increasingly considered an underdeveloped concept. "Neuropathic pain" is a collection of distinct pathological conditions characterized by various pathogenic processes. Expecting a single therapeutic molecule to be effective across a range of different neuropathic pain syndromes is clearly unrealistic. Therefore, personalized treatment strategies for patients with specific neuropathic pain conditions are urgently needed. Furthermore, there is a strong need for treatment options with reduced side effects, or even better, no side effects, even when administered chronically—for example, daily, weekly, or monthly, for days, weeks, months, or years. SUMMARY OF THE INVENTION
[0012] The present invention relates to antisense oligonucleotides targeting FXYD2 for use in the treatment of pain, wherein the antisense oligonucleotides are administered intravenously.
[0013] In particular, the invention is defined by the claims. Detailed Description of the Invention
[0015] Although highly effective, FXYD2-LASO-based treatments require long-term daily intrathecal injections, which may represent an obstacle to their routine use in clinical practice. To circumvent this potential problem, the inventors tested whether 2'-O-2-methoxyethyl chemical modification, known to significantly increase the metabolic stability and binding affinity of ASOs to their target mRNA sequences, might be advantageous. They thus synthesized 2'-O-2-methoxyethyl-modified FXYD2-LASO (hereinafter referred to as FXYD2-LASO-Gapmer) and injected it intravenously, a less invasive route of administration.
[0016] FXYD2-LASO-Gapmer was injected intravenously daily until a first phase of complete analgesia was achieved, followed by a second phase with more injections spaced apart to maintain the analgesic effect over time.
[0017] Compared to intrathecal administration, intravenous administration of FXYD2-optimized antisense oligonucleotides (LASOs) with MOEs allows for long-term effects on pain. The inventors have demonstrated this long-term effect on neuropathic pain in the spinal nerve ligation (SNL) rat model and inflammatory pain in the complete Freund's adjuvant (CFA)-induced rat model.
[0018] Thus, the inventors demonstrated the long-term efficacy of FXYD2 optimized antisense oligonucleotides (LASOs) with MOE in the treatment of pain.
[0019] The present invention relates to antisense oligonucleotides targeting FXYD2 for use in the treatment of pain, wherein the antisense oligonucleotides are administered intravenously.
[0020] In a specific embodiment, the antisense oligonucleotide for use according to the present invention, wherein said antisense oligonucleotide comprises a 2'-O-methoxyethyl group (2'-MOE).
[0021] In a specific embodiment, the present invention relates to a method for treating pain comprising the step of intravenously administering a therapeutically effective amount of an antisense oligonucleotide targeting FXYD2 to a subject in need thereof.
[0022] In a specific embodiment, the method according to the present invention comprises daily intravenous injections of FXYD2-LASO-Gapmer until a first phase of complete analgesia is achieved, followed by a second phase of more spaced injections to maintain the analgesic effect over time.
[0023] As used herein, the term "treatment" refers to prophylactic or preventative treatment and curative or disease-modifying treatment, including treatment of subjects at risk of contracting a disease or suspected of having contracted a disease, as well as subjects who are ill or have been diagnosed with a disease or medical condition, and includes suppressing clinical relapse. The treatment can be applied to subjects with a medical condition or who may eventually acquire the condition to prevent, cure, delay the onset of the condition or recurring condition, reduce the severity of the condition or recurring condition, or improve the onset of one or more symptoms of the condition or recurring condition, or to extend the subject's survival beyond the expected survival in the absence of such treatment. A "treatment regimen" refers to a pattern of treatment for a disease, such as the dosage pattern used during treatment. A treatment regimen can include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction phase" refers to a treatment regimen (or portion of a treatment regimen) for the initial treatment of a disease. The general purpose of an induction regimen is to provide a high level of drug to the subject in the initial stages of a treatment regimen. An induction regimen can employ (in part or in whole) a "loading regimen," which can include administering a larger dose of the drug than the physician would administer during a maintenance regimen, administering the drug more frequently than the physician would administer during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a treatment regimen (or portion of a treatment regimen) that is used to maintain a subject during treatment for a disease, e.g., to maintain remission of the subject over the long term (months or years). A maintenance regimen can employ continuous treatment (e.g., administration of a drug at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent treatment (e.g., intermittent treatment, intermittent treatment, recurrent treatment, or treatment upon reaching specific predetermined criteria [e.g., pain, disease manifestations, etc.]).
[0024] In some embodiments, a first phase of daily intravenous delivery of an antisense oligonucleotide of the invention is administered, followed by a second phase of intermittent delivery.
[0025] In some embodiments, the first phase lasts at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days.
[0026] In some embodiments, the antisense oligonucleotides of the invention are administered at least every 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days, more particularly every 7, 8, 9, or 10 days during the second phase of delivery.
[0027] In some embodiments, the antisense oligonucleotides of the invention are administered by intravenous delivery daily for the first 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days, followed by intravenous delivery every 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days for the remainder of the treatment.
[0028] As used herein, the term "administer" refers to the act of injecting or otherwise physically delivering a substance (e.g., an antisense oligonucleotide targeting FXYD2) present outside the body to a subject via intravenous delivery. When treating a disease or its symptoms, administration of the substance typically occurs after the onset of the disease or its symptoms. When preventing a disease or its symptoms, administration of the substance typically occurs before the onset of the disease or its symptoms. In the context of the present invention, antisense oligonucleotides targeting FXYD2 are administered via an intravenous route.
[0029] As used herein, the term "pain" refers to an unpleasant sensation typically caused by an intense or damaging stimulus. The International Association for the Study of Pain's widely used definition is as follows: "Pain is an unpleasant sensory and emotional experience associated with actual or potential tissue damage, or described in terms of such damage." There are different types of pain: acute pain, chronic pain, somatic pain, nociceptive pain, visceral pain, or peripheral pain. In the context of the present invention, pain is peripheral pain. More specifically, peripheral pain is neuropathic pain, diabetic pain, chemotherapy pain, inflammatory pain, postoperative pain, and / or chronic postoperative pain.
[0030] As used herein, the term "subject" refers to a mammal, such as a rodent, a feline, a canine, and a primate. In particular, the subject according to the present invention is a human, a mouse, or a rat. As used herein, the term "subject" encompasses a "patient."
[0031] In certain embodiments, the subject suffers from or is susceptible to pain.
[0032] In certain embodiments, the subject suffers from or is susceptible to peripheral pain.
[0033] In certain embodiments, the subject suffers from or is susceptible to neuropathic pain.
[0034] In certain embodiments, the subject is suffering from or susceptible to inflammatory pain.
[0035] In certain embodiments, the subject suffers from or is susceptible to diabetic pain.
[0036] In certain embodiments, the subject is suffering from or susceptible to chemotherapy pain.
[0037] In certain embodiments, the subject is suffering from or susceptible to post-operative pain.
[0038] In certain embodiments, the subject suffers from or is susceptible to chronic postoperative pain.
[0039] As used herein, the term "FXYD2" refers to the FXYD domain-containing ion transport regulator 2. It has the general meaning in the art and refers to the γ-subunit of the Na, K-ATPase. The term includes naturally occurring FXYD2 variants and modified forms thereof. The FXYD2 mRNA sequence can be found in NCBI Gene ID NO: 486.
[0040] The naturally occurring human FXYD2 gene, variant b, has the nucleotide sequence shown in Genbank Accession No. NM 021603.4. The nucleotide sequence cDNA of Homo sapiens FXYD2, transcript variant b, is defined by the sequence SEQ ID NO: 1 (593 bp):.
[0041] The naturally occurring human FXYD2 gene, variant a, has the nucleotide sequence shown in Genbank Accession No. NM_001680.5. The nucleotide sequence of Homo sapiens FXYD2 cDNA, transcript variant a, is defined by the sequence SEQ ID NO: 2 (589 bp):.
[0042] The naturally occurring human FXYD2 gene has a common sequence encoding two variants (a and b) having the following nucleotide sequence and defined by the sequence SEQ ID NO: 3:
[0043] 5'-91
[0044] GGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTACTATGACTATGAGACCGTTCGCAATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTGGGGCTCCTCATCCTCCTCAGCAGAAGATTCCGCTGTGGGGGCAATAAGAAGCGCAGGCAAATCAATGAAGATGAGCCGTAA 267-3'.
[0045] In a specific embodiment, the nucleotide sequence ARN of Homo sapiens FXYD2, transcript variant b, is defined by the sequence SEQ ID NO: 4:
[0046] UGA GAG GUA GGU CCG GGG UCC GUU CGU CGU GGA GGG ACG AGA GGA CGU GAGGAC CUG UGU UGG UCG UCG AGG ACG GUA CCU GUC CAC CAU GGA CCC GCC GGG GUUCCC CCU GCA CCU GGG CAA GAU GA AU ACC ACU GCU GCU CCC GGA CUAGAA GCG ACC UGA CCG GAA GUA GCA CCC CGA GGA GUA GGA GGA GUC GUC UAA GGCGAC ACC CCC GUU AUU CUU CGC GUC CGU UUA GUU ACU UCU ACU CGG CAU UGU CGU CGU CGGAGC CGC CAC GGU GGGA CGU CGU CGU UCC UCC GCC UAC CGG GAC GGAGAC CGC GGA GGG GAA GAA GGG ACC CGA AAU CUG GAA ACA GGG GCA GUG ACG GUC GCGAAC CCG ACU UCC UUC GAG GUC UGA GUU ACA CUG GGG GUC CAC CGU CGU AGC GGU UGA GGACGG A GACGU UAG UGU GUA GUA GGC CGC AGU CUC UGG CGA CGA AGG GAGUGG ACG GAC GGA CAG AGG GAG GAG ACA GUG GUG GUC GGA GAG GUU CGA GUU CAU GUUUAU GUC GGC CCA GAG UAA ACA AAA AAG UU。
[0047] The FXYD2 sequence is attached to the RNA sequence, the sequence is identified, and the sequence is SEQ IDNO: 5.
[0048] UCU GUG AGA GGU UUU UCG UCU CUG UCG UCC UUC UCC CCU CAC CUC CGU CGGGUA AGU GGA CCC CUU UAC UGA CCC AAC AGC UAC CUG CCA CCG CCG UCG GGG UUC CCCCUG CAC CUG GGC AAG AUG AUA CUG AUA CUC UGG CAA GCG UUA CCC CCG GAC UAG AAGCGA CCU GAC CGG AAG UAG CAC CCC GAG GAG UAG GAG GAG UCG UCU UCU AAG GCG ACACCC CCG UUA UUC UUC GCG UCC GUU UAG UUA CUU CUA CUC GGC AUU GUC GUC GGA GCCGCC ACG GUG GGU GAC GUG ACC CCG GUC GAC CCU UCG GUU CGU ACC GGG ACG GAG ACCGCG GAG GGG AAG AAG GGA CCC GAA AUC UGG AAA CAG GGG CAG UGA CGG UCG CGA ACCCGA CUU CCU UCG AGG UCU GAG UUA CAC UGG GGG UCC ACC GUA GCG GUU GAG GAC GGAGCA CGG UGG AGU ACG AAU AUU AUU UCG GCC GCA GUC UCU GGC GAC GAA GGG AGU GGACGG ACG GAC AGA GGG AGG AGA CAG UGG UGG UCG GAG AGG UUC GAG UUC AUG UUU AUGUCG GCC CAG AGU AAA CAA AAA AGU U
[0049] The naturally occurring human FXYD2 gene has a common sequence encoding two variants (a and b) having the following nucleotide sequence ARN and defined by the sequence SEQ ID NO:6:
[0050] CCG CCG UCG GGG UUC CCC CUG CAC CUG GGC AAG AUG AUA CUG AUA CUC UGGCAA GCG UUA CCC CCG GAC UAG AAG CGA CCU GAC CGG AAG UAG CAC CCC GAG GAG UAGGAG GAG UCG UCU UCU AAG GCG ACA CCC CCG UUA UUC UUC GCG UCC GUU UAG UUA CUUCUA CUC GGC AUU
[0051] In another embodiment, the antisense oligonucleotide for use according to the present invention targets at least 15 nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 of FXYD2.
[0052] In a particular embodiment, the antisense oligonucleotides according to the invention target:
[0053] - a region comprising or consisting of nucleotides 210-238 of SEQ ID NO: 3; and / or
[0054] - a region comprising or consisting of nucleotides 210-267 of SEQ ID NO: 3.
[0055] In a specific embodiment, the antisense oligonucleotide for use according to the invention reduces the expression and / or activity of FXYD2.
[0056] In a particular embodiment, the antisense oligonucleotide for use according to the present invention targets at least the region comprising or consisting of the nucleotides of SEQ ID NO:3.
[0057] In a particular embodiment, the antisense oligonucleotide for use according to the invention targets at least the region comprising or consisting of the nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0058] In a specific embodiment, the antisense oligonucleotide for use according to the invention targets the region comprising or consisting of nucleic acid 219-229 as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0059] In a specific embodiment, the antisense oligonucleotide for use according to the invention targets the region comprising or consisting of nucleic acid 210-238 as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0060] In a specific embodiment, the antisense oligonucleotide for use according to the invention targets the region comprising or consisting of nucleic acid 210-267 as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0061] In a specific embodiment, the antisense oligonucleotide for use according to the invention targets the region comprising nucleic acid 91-267 as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0062] In a specific embodiment, the antisense oligonucleotide for use according to the invention targets the region consisting of nucleic acid 91-267 as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0063] In a particular embodiment, the antisense oligonucleotide for use according to the present invention targets the region consisting of the nucleic acid shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0064] In a particular embodiment, the antisense oligonucleotide for use according to the invention targets a region comprising the nucleic acid shown as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0065] In a particular embodiment, the antisense oligonucleotide for use according to the invention targets the nucleotide sequence defined by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and / or SEQ ID NO: 6.
[0066] In some embodiments, antisense oligonucleotides for use according to the present invention have a length of at least 15 nucleotides.
[0067] In some embodiments, antisense oligonucleotides for use according to the present invention have a length of 15 to 25 nucleotides.
[0068] In particular, the antisense oligonucleotides for use according to the invention have a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.
[0069] Antisense oligonucleotides, including antisense RNA molecules and antisense DNA molecules, will directly block the translation of FXYD2 mRNA by binding to FXYD2 mRNA, thereby preventing protein translation, or by increasing mRNA degradation, thereby reducing the level of FXYD2 protein in cells and thus reducing activity. For example, antisense oligonucleotides of at least about 15 bases and complementary to a unique region of the sequence of the mRNA transcript encoding FXYD2 can be synthesized, for example, by conventional phosphodiester technology and administered, for example, by intravenous injection or infusion. Methods for using antisense technology to specifically reduce gene expression of genes whose sequences are known are well known in the art (see, for example, U.S. Patent Nos. 6,566,135; 6,566,131; 6,365,354; 6,410,323; 6,107,091; 6,046,321 and 5,981,732, each of which is incorporated herein by reference in its entirety).
[0070] The antisense RNA complementary to the sense target sequence is encoded by a DNA sequence used to produce any of the aforementioned inhibitors (eg, antisense, siRNA, shRNA, or miRNA). The DNA encoding the double-stranded RNA of interest is incorporated into a gene cassette, such as an expression cassette in which transcription of the DNA is controlled by a promoter.
[0071] In a particular embodiment, the antisense oligonucleotide for use according to the claims is an isolated, synthetic or recombinant antisense oligonucleotide targeted to the FXYD2 mRNA transcript.The oligonucleotide of the invention may be of any suitable type.
[0072] In some embodiments, the antisense oligonucleotide for use according to the claims is an RNA oligonucleotide.In some embodiments, the oligonucleotide is a DNA oligonucleotide.
[0073] In a specific embodiment, the antisense oligonucleotide for use is selected from, but not limited to, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, or SEQ ID NO: 39. NO:39.
[0074]
[0075]
[0076] Table 1. Antisense oligonucleotide sequences tested for their ability to reduce FXYD2 protein levels in HEK293 cells
[0077] As used herein, the term "nucleotide" is defined as a modified or naturally occurring deoxyribonucleotide or ribonucleotide. Nucleotides generally include purines and pyrimidines, including thymidine (T), cytidine (C), guanosine (G), adenosine (A), and uridine (U).
[0078] As used herein, the term "oligonucleotide" refers to the oligomer of nucleotide defined above. The term "oligonucleotide" refers to a 3'-5' or 5'-3' directed nucleic acid sequence, which can be single-stranded or double-stranded. The oligonucleotide used in the context of the present invention can particularly be DNA or RNA. The term also includes "oligonucleotide analogs", which refer to a backbone structure with (i) modification, such as a backbone different from the standard phosphodiester bond found in natural oligonucleotides and polynucleotides, and (ii) optionally, a modified sugar moiety, such as a morpholino moiety rather than an oligonucleotide of a ribose or deoxyribose moiety. Oligonucleotide analogs support bases that can be hydrogen-bonded to standard polynucleotide bases by Watson-Crick base pairing, wherein the analog backbone presents bases in a sequence-specific manner to allow the bases in the oligonucleotide analog molecule and the standard polynucleotides (such as single-stranded RNA or single-stranded DNA) to carry out this hydrogen bonding. In particular, analogs are those with substantially uncharged phosphorus-containing backbones. A substantially uncharged phosphorus-containing backbone in an oligonucleotide analog is one in which the majority of the subunit linkages, e.g., 50-100%, typically at least 60% to 100% or 75% or 80%, of the linkages are uncharged and contain a single phosphorus atom.
[0079] The term "oligonucleotide" also refers to an oligonucleotide sequence that is reversed relative to its normal direction of transcription and thus corresponds to an RNA or DNA sequence that is complementary to a target gene mRNA molecule expressed in a host cell (e.g., which can hybridize to the target gene mRNA molecule by Watson-Crick base pairing).
[0080] Antisense strand can be constructed in many different ways, provided that it is able to interfere with the expression of the target gene.For example, antisense strand can be constructed by reverse complementing the coding region (or part thereof) of the target gene relative to the normal direction of its transcription to allow its complement to be transcribed (for example, the RNA encoded by antisense and sense genes can be complementary). In some embodiments, oligonucleotides do not need to have the same intron or exon pattern as the target gene, and the non-coding segment of the target gene can be as effective as the coding segment such as antisense oligonucleotide (ASO) in realizing the antisense inhibition of target gene expression. In some embodiments, oligonucleotides have the same exon pattern as the target gene, such as siRNA and antisense oligonucleotide (ASO).
[0081] The term "targeting" as used herein refers to an oligonucleotide that can specifically bind to the FYXD2 gene or FXYD2 mRNA encoding the FXYD2 gene product. In particular, it refers to an oligonucleotide that can inhibit the gene or mRNA by methods known to those skilled in the art (e.g., antisense, RNA interference).
[0082] According to the present invention, the antisense oligonucleotide for use according to the present invention targets the mRNA and / or DNA encoding the FXYD2 gene product and is capable of reducing the expression level and / or activity of FXYD2 in cells.
[0083] That is, the antisense oligonucleotide comprises a sequence that is at least partially complementary to the region of the mRNA sequence, particularly fully complementary, said complementarity being sufficient to produce specific binding under intracellular conditions. As will be apparent to those skilled in the art, a sequence that is "fully complementary" to a second sequence refers to the reverse complementary counterpart of the second sequence, either in the form of a DNA molecule or in the form of an RNA molecule. A sequence is "partially complementary" to a second sequence if there are one or more mismatches.
[0084] The antisense oligonucleotide for use according to the present invention targets cDNA or mRNA encoding the FXYD2 gene (e.g., the FXYD2 gene comprising SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6) and can be designed by using the sequence of the mRNA as a basis, for example, using bioinformatics tools.
[0085] In particular, the antisense oligonucleotides for use according to the invention are capable of reducing the expression and / or activity of FXYD2 in DRG. Methods for determining whether an oligonucleotide is capable of reducing the expression and / or activity of FXYD2 in a cell are known to those skilled in the art.
[0086] This can be done, for example, by analyzing FXYD2 RNA expression (e.g., by RT-qPCR, in situ hybridization) or FXYD2 protein expression (e.g., by immunohistochemistry, Western immunoblotting), and by comparing FXYD2 protein expression or FXYD2 functional activity in the presence and absence of the antisense oligonucleotide to be tested.
[0087] In other embodiments, the antisense oligonucleotides for use according to the present invention target the translation start site (AUG codon) of mRNA, sequences in the coding region (e.g., one or more exons), 5'-untranslated region, or 3'-untranslated region. The purpose is to interfere with the function of messenger RNA, including all important functions, including RNA transport to the protein translation site, protein from the actual translation of RNA, RNA splicing or maturation, and even possible independent catalytic activity that can be participated in by RNA. The overall effect of this interfering RNA function is to cause interference with protein expression.
[0088] In some embodiments, the antisense oligonucleotides for use according to the present invention are further modified, particularly chemically modified, to increase stability and / or therapeutic efficacy in vivo. Those skilled in the art can easily provide some modifications that improve oligonucleotide efficacy, such as stable modification (C.Frank Bennett and Eric E.Swayze, RNA Targeting Therapeutics:Molecular Mechanisms of Antisense Oligonucleotides as a Therapeutic Platform Annu. Rev. Pharmacol. Toxicol. 2010. 50: 259-293; Juliano RL. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016 Aug 19; 44 (14): 6518-48). In particular, the oligonucleotides used in the context of the present invention can include modified nucleotides. Chemical modification can occur in three different sites: (i) at the phosphate group, (ii) on the sugar moiety, and / or (iii) on the entire backbone structure of the oligonucleotide. Generally, chemical modifications include backbone modifications, heterocycle modifications, sugar modifications, and conjugation strategies.
[0089] For example, the oligonucleotide is selected from oligodeoxyribonucleotides, oligoribonucleotides, small regulatory RNA (sRNA), U7- or U1-mediated ASOs or conjugated products thereof (such as peptide-conjugated or nanoparticle-complexed ASOs), chemically modified oligonucleotides by backbone modification (such as morpholinos, phosphorodiamidate morpholino oligomers (phosphorodiamidate morpholinos, PMOs), peptide nucleic acids (PNAs), phosphorothioate (PS) oligonucleotides, stereochemically pure phosphorothioate (PS) oligonucleotides, phosphoramidate-modified oligonucleotides, thiophosphoramidate-modified oligonucleotides, and methylphosphonate-modified oligonucleotides); chemically modified oligonucleotides by heterocycle modification, such as bicyclic modified oligonucleotides, bicyclic nucleic acids (BNAs), tricyclic modified oligonucleotides, tricyclic-DNA-antisense oligonucleotides (ASOs), nucleobase modifications such as 5-methyl substitutions on pyrimidine nucleobases, 5-substituted pyrimidine analogs, 2-thio-thymine-modified oligonucleotides, and purine-modified oligonucleotides. Chemically modified oligonucleotides by sugar modification, such as locked nucleic acid (LNA) oligonucleotides, 2',4'-methyleneoxy bridged nucleic acids (BNA), ethylene bridged nucleic acids (ENA), constrained ethyl (cEt) oligonucleotides, 2'-modified RNA, 2'- and 4'-modified oligonucleotides such as 2'-O-MeRNA (2'-OMe), 2'-O-methoxyethyl RNA (MOE), 2'-fluoro RNA (FRNA) and 4'-thio modified DNA and RNA; Chemically modified oligonucleotides by conjugation strategies, such as N-acetylgalactosamine (GalNAc) oligonucleotide conjugates such as 5'-GalNAc and 3'-GalNAc ASO conjugates, lipid oligonucleotide conjugates (LASOs), cell penetrating peptide (CPP) oligonucleotide conjugates, targeting oligonucleotide conjugates, antibody-oligonucleotide conjugates, polymer-oligonucleotide conjugates, such as conjugated to PEGylation and targeting ligands; and, for example, Bennett and Swayze, 2010 (RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Annu Rev Pharmacol Toxicol. 2010; 50: 259-93); Wan and Seth, 2016 (The Medicinal Chemistry of Therapeutic Oligonucleotides. J Med Chem.2016Nov10;59(21):9645-9667); Juliano,2016(The delivery of therapeutic oligonucleotides.Nucleic Acids Res. 2016 Aug 19; 44 (14): 6518-48); Lundin et al., 2015 (Oligonucleotide Therapies: The Past and the Present. Hum Gene Ther. 2015 Aug; 26 (8): 475-85); and Prakash, 2011 (An overview of sugar-modified oligonucleotides for antisense therapeutics. Chem Biodivers. 2011 Sep; 8 (9): 1616-41). In practice, oligonucleotides can be stabilized for use in vivo. A "stabilized" oligonucleotide refers to an oligonucleotide that is relatively resistant to degradation in vivo (e.g., by exo- or endo-nucleases). Stabilization can be a function of length or secondary structure. In particular, oligonucleotide stabilization can be achieved by phosphate backbone modifications, phosphodiester modifications, phosphorothioate (PS) backbone modifications, combinations of phosphodiester and phosphorothioate modifications, phosphoroamidite thio modifications, 2' modifications (2'-O-Me, 2'-O-(2-methoxyethyl) (MOE) modifications, and 2'-fluoro modifications), methylphosphonates, methylphosphothioates, phosphorodithioates, p-ethoxy groups, and combinations thereof.
[0090] In a particular embodiment, the antisense oligonucleotide for use according to the present invention comprises 2'-O-(2-methoxyethyl) (MOE).
[0091] As used herein, the term "gapmer" refers to short DNA antisense oligonucleotide structures with RNA-like segments on both sides of the sequence. They consist of a short DNA chain flanked by RNA mimic chains.
[0092] In one embodiment, the antisense oligonucleotides for use according to the invention are lipid-conjugated, referred to as LASOs.
[0093] In some embodiments, the antisense-oligonucleotide for use according to the invention is modified by a moiety comprising at least three saturated or unsaturated, in particular saturated, linear or branched, in particular linear hydrocarbon chains comprising 2-30 carbon atoms, in particular 5-20 carbon atoms, more in particular 10-18 carbon atoms, as described in WO2014 / 195432, by substitution at the 3' or 5' end.
[0094] In some embodiments, the antisense-oligonucleotide for use according to the invention is modified by a moiety comprising at least one ketal functional group by substitution at the 3' or 5' end, wherein the ketal carbon of the ketal functional group carries two saturated or unsaturated, in particular saturated, linear or branched, in particular linear hydrocarbon chains comprising 1-22 carbon atoms, in particular 6-20 carbon atoms, in particular 10-19 carbon atoms, and even more in particular 12-18 carbon atoms, as described in WO2014 / 195430.
[0095] For example, oligonucleotides can be used as phosphorothioate derivatives (substitution of non-bridging phosphoryl oxygen atoms with sulfur atoms), which have increased resistance to nuclease digestion.
[0096] Additionally or alternatively, the oligonucleotides of the present invention may comprise fully, partially or in combination modified nucleotides having substitutions at the 2' position of the sugar, in particular derivatives having substitutions of the following chemical modifications: O-methyl group (2'-O-Me) substitution, 2-methoxyethyl group (2'-O-MOE) substitution, fluoro group (2'-fluoro) substitution, chloro group (2'-Cl) substitution, bromo group (2'-Br) substitution, cyanide group (2'-CN) substitution, trifluoromethyl group (2'-CF3) substitution, OCF3 group (2'-OCF3) substitution, OCN substitution. Alternatively or in addition, the oligonucleotides of the present invention may comprise fully or partially modified nucleotides, wherein the ribose moiety is used to produce locked nucleic acids (LNAs), wherein a covalent bridge is formed between the 2' oxygen and the 4' carbon of the ribose, fixing it in a 3'-terminal configuration. These molecules are extremely stable in biological culture media, are able to activate RNase H, e.g. when LNA is located at the termini (Gapmer), and form tight hybrids with complementary RNA and DNA.
[0097] In some embodiments, the antisense oligonucleotides for use according to the present invention comprise modified nucleotides having 2'-O-(2-methoxyethyl) (MOE) oligomers.
[0098] In another embodiment, the antisense oligonucleotide for use according to the present invention comprises a 2'-phosphorothioate analog, a 2'-fluoro analog, a 2'-Cl analog, a 2'-Br analog, a 2'-CN analog, a 2'-CF3 analog, a 2'-OCF3 analog, a 2'-OCN analog, a 2'-O-alkyl analog, a 2'-S-alkyl analog, a 2'-N-alkyl analog, a 2'-O-alkenyl analog, a 2'-S-alkenyl analog, a 2'-N -alkenyl analogs, 2'-ONO2 analogs, 2'-NO2 analogs, 2'-N3 analogs, 2'-NH2 analogs, tricyclic (tc)-DNA, U7 short nuclear (sn) RNA, tricyclic-DNA-oligonucleotide antisense molecules and combinations thereof (U.S. Provisional Patent Application No. 61 / 212,384, filed April 10, 2009, for tricyclic-DNA antisense oligonucleotides, compositions and methods for treating disease, the entire contents of which are incorporated herein by reference).
[0099] In a specific embodiment, the antisense oligonucleotide for use according to the present invention is an LNA oligonucleotide. As used herein, the term "LNA" (locked nucleic acid) (or "LNA oligonucleotide") refers to an oligonucleotide containing one or more bicyclic, tricyclic or polycyclic nucleoside analogs (also known as LNA nucleotides and LNA analog nucleotides). LNA oligonucleotides, LNA nucleotides and LNA analog nucleotides are generally described in International Publication No. WO 99 / 14226 and subsequent applications; International Publication Nos. WO 00 / 56746, WO 00 / 56748, WO 00 / 66604, WO 01 / 25248, WO 02 / 28875, WO 02 / 094250, WO 03 / 006475; U.S. Patent Nos. 6,043,060, 6268490, 6770748, 6639051 and U.S. Publication Nos. 2002 / 0125241, 2003 / 0105309, 2003 / 0125241, 2002 / 0147332, 2004 / 0244840 and 2005 / 0203042, all of which are incorporated herein by reference. LNA oligonucleotides and LNA analogue oligonucleotides are commercially available from, for example, Proligo LLC, 6200 Lookout Road, Boulder, CO 80301 USA.
[0100] Other forms of the oligonucleotides of the invention are oligonucleotide sequences coupled to small nuclear RNA molecules such as U1 or U7, which are combined with viral transfer methods based on, but not limited to, lentiviruses or adeno-associated viruses (Denti, MA, et al, 2008; Goyenvalle, A, et al, 2004).
[0101] Another form of the oligonucleotide of the present invention is peptide nucleic acid (PNA). In peptide nucleic acid, the deoxyribose backbone of the oligonucleotide is replaced by a backbone that is more similar to a peptide than a sugar. Each subunit or monomer has a naturally occurring or non-naturally occurring base connected to the backbone. One such backbone is composed of repeating units of N-(2-aminoethyl)glycine connected by amide bonds. Due to the group deviation from the deoxyribose backbone, these compounds are named peptide nucleic acids (PNA) (Dueholm et al., New J. Chem., 1997, 21, 19-31). PNA binds DNA and RNA to form PNA / DNA or PNA / RNA duplexes. The resulting PNA / DNA or PNA / RNA duplexes bind with greater affinity than the corresponding DNA / DNA, DNA / RNA or RNA / RNA duplexes, as measured by Tm. This high thermal stability may be attributed to the lack of charge repulsion, which is due to the neutral backbone of PNA. The neutral backbone of PNA also causes the Tm of PNA / DNA (RNA) duplexes to be virtually independent of salt concentration. Therefore, the PNA / DNA (RNA) duplex interaction provides a further advantage over DNA / DNA, DNA / RNA or RNA / RNA duplex interactions, which are highly dependent on ionic strength. Homopyrimidine PNAs have been shown to bind complementary DNA or RNA in an antiparallel orientation, forming highly thermally stable (PNA)2 / DNA (RNA) triplexes (see, for example, Egholm, et al., Science, 1991, 254, 1497; Egholm, et al., J.Am.Chem.Soc., 1992, 114, 1895; Egholm, et al., J.Am.Chem.Soc., 1992, 114, 9677). In addition to increased affinity, PNAs are also shown to bind DNA or RNA with increased specificity. When PNA / DNA duplex mismatches are melted relative to DNA / DNA duplexes, a Tm decrease of 8 to 20°C is observed. In the case of the corresponding DNA / DNA duplex with mispairing, this amplitude of Tm decline is not seen. The combination of PNA chain and DNA or RNA chain can occur in one of two directions. When the DNA or RNA chain in 5' to 3' direction is combined with the complementary PNA chain so that the carboxyl end of PNA points to the 5' end of DNA or RNA and the amino end of PNA points to the 3' end of DNA or RNA, this direction is referred to as antiparallel. In the parallel direction, the carboxyl end and amino end of PNA are just opposite to the 5'-3' direction of DNA or RNA. Compared with oligonucleotides, another advantage of PNA is that their polyamide backbone (having suitable core base or being connected to other side chain groups thereon) is not recognized and is not cut by nuclease or protease.Therefore, unlike nucleic acids and peptides, PNAs resist enzymatic degradation. WO92 / 20702 describes peptide nucleic acid (PNA) compounds that bind to complementary DNA and RNA more tightly than the corresponding DNA. PNAs have shown strong binding affinity and specificity for complementary DNA (Egholm, M., et al., Chem. Soc., Chem. Commun., 1993, 800; Egholm, M., et al., Nature, 1993, 365, 566; and Nielsen, P., et al. Nucl. Acids Res., 1993, 21, 19). In addition, PNAs show nuclease resistance and stability in cell extracts (Demidov, VV, et al., Biochem. Pharmacol., 1994, 48, 1309-1313). Modifications of PNAs include extended backbones (Hyrup, B., et.al. Chem. Soc., Chem. Commun., 1993, 518), extended linkers between the backbone and the nucleobase, inversion of the amide bond (Lagriffoul, PH, et.al., Biomed. Chem. Lett., 1994, 4, 1081), and the use of chiral backbones based on alanine (Dueholm, KL, et.al., BioMed. Chem. Lett., 1994, 4, 1077). Peptide nucleic acids are described in U.S. Patent Nos. 5,539,082 and 5,539,083. Peptide nucleic acids are further described in U.S. Patent Application No. 08 / 686,113.
[0102] Typically, the antisense oligonucleotides for use according to the present invention are obtained by conventional methods well known to those skilled in the art. For example, the antisense oligonucleotides for use according to the present invention can be synthesized de novo using any of the many methods known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage et al., 1981); the nucleoside H-phosphonate method (Garegg et al., 1986; Froehler et al., 1986, Garegg et al., 1986, Gaffney et al., 1988). These chemistries can be performed by various automated nucleic acid synthesizers available on the market. These nucleic acids can be referred to as synthetic nucleic acids. Alternatively, oligonucleotides can be produced on a large scale in plasmids (see Sambrook, et al., 1989). Oligonucleotides can be prepared from existing nucleic acid sequences using known techniques, such as the use of restriction enzymes, exonucleases, or endonucleases. Oligonucleotides prepared in this manner can be referred to as isolated nucleic acids.
[0103] A number of methods and modifications for enhancing the delivery and efficacy of oligonucleotides can be readily provided by those skilled in the art, such as chemical modifications of oligonucleotides, lipid- and polymer-based nanoparticles or nanocarriers, ligand-oligonucleotide conjugates by linking the oligonucleotide to targeting agents such as carbohydrates, peptides, antibodies, aptamers, lipids, or small molecules, and small molecules that improve oligonucleotide delivery as described in Juliano RL. Delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016 Aug 19; 44(14): 6518-48). Lipophilic and lipid conjugates include fatty acid-oligonucleotide conjugates; sterol-oligonucleotide conjugates; and vitamin-oligonucleotide conjugates.
[0104] In a specific embodiment, the antisense oligonucleotide for use according to the present invention is conjugated to a second molecule. Typically, the second molecule is selected from an aptamer, an antibody, or a polypeptide. For example, the antisense oligonucleotide for use according to the present invention can be conjugated to a cell penetrating peptide. Cell penetrating peptides are well known in the art, including, for example, TAT peptides (Bechara C, Sagan S. Cell-penetrating peptides: 20 years later, where do we stand? FEBS Lett. 2013 Jun 19; 587 (12): 1693-702).
[0105] In some embodiments, as will be appreciated by those skilled in the art, the antisense oligonucleotides for use according to the present invention are combined with a carrier or vehicle, such as a liposome or micelle, although other carriers may be used. Liposomes are vesicles made from a lipid bilayer having a structure similar to that of a biological membrane. Such carriers are used to promote cellular uptake or targeting of oligonucleotides, or to improve the pharmacokinetics or therapeutic properties of oligonucleotides. For example, the oligonucleotides of the present invention may also be encapsulated in liposomes or pharmaceutical compositions for administration, wherein the active ingredient is dispersed or variously present in a body consisting of aqueous concentric layers adhering to the lipid layer. Depending on solubility, the oligonucleotide may be present in both the aqueous layer and the lipid layer, or in a suspension commonly referred to as a liposomal suspension. The hydrophobic layer typically, but not exclusively, comprises phospholipids such as phosphatidylcholine and sphingomyelin, steroids such as cholesterol, more or less ionic surfactants such as diacetyl phosphate, stearylamine or phosphatidic acid, or other hydrophobic substances. The diameter of the liposome is typically about 15 nm to about 5 microns. Using liposomes as drug delivery vehicles provides several advantages. Liposomes increase intracellular stability, increase uptake efficiency, and improve biological activity. Liposomes are hollow spherical vesicles composed of lipids arranged in a manner similar to those that make up cell membranes. They have an internal aqueous space for trapping water-soluble compounds and range in size from 0.05 to several microns in diameter. Several studies have shown that liposomes can deliver nucleic acids to cells and that the nucleic acids remain biologically active. For example, liposome delivery vehicles, such as Lipofectin, which were originally designed as research tools, can deliver intact nucleic acid molecules to cells. Specific advantages of using liposomes include the following: they are non-toxic and biodegradable in composition; they show a long circulation half-life; and recognition molecules can be easily attached to their surface to target tissues. Finally, the cost-effective manufacture of liposome-based drugs in liquid suspensions or lyophilized products has demonstrated the feasibility of this technology as an acceptable drug delivery system.
[0106] In some embodiments, the oligonucleotide of the present invention is complexed with a complexing agent to increase the cellular uptake of the oligonucleotide. Examples of complexing agents include cationic lipids. Cationic lipids can be used to deliver the oligonucleotide to cells. The term "cationic lipid" includes lipids and synthetic lipids with polar and non-polar domains, which can be positively charged at or near physiological pH, and which are combined with polyanions such as nucleic acids and promote nucleic acid delivery into cells. Typically, cationic lipids include saturated and unsaturated alkyl and alicyclic ethers and esters of amines, amides, or derivatives thereof. The straight and branched alkyl and alkenyl groups of the cationic lipids can contain, for example, 1 to about 25 carbon atoms. In particular, straight or branched alkyl or alkene groups have six or more carbon atoms. Alicyclic groups include cholesterol and other steroid groups. Cationic lipids can be prepared with a variety of counterions (anions), which include, for example, Cl-, Br-, I-, F-, acetate, trifluoroacetate, sulfate, nitrite, and nitrate. Examples of cationic lipids include: polyethyleneimine, polyamidoamine (PAMAM) starburst dendrimers, Lipofectin (a combination of DOTMA and DOPE), Lipofectase, Lipofectamine, DOPE, Cytofectin (Gilead Sciences, Foster City, Calif.), and Eufectins (JBL, San Luis Obispo, Calif.). Cationic liposomes may include the following: N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylmethylsulfate (DOTAP), 3β-[N-(N',N'-dimethylaminoethane)carboxamide]cholesterol (DC-Chol), 2,3-dioleoyloxy-N-[2(sperminecarboxamide)ethyl]-N,N-dimethyl-1-propylamine trifluoroacetate (DOSPA), 1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethylammonium bromide; and dimethyldioctadecyl ammonium bromide (DDAB). For example, the cationic lipid N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA) was found to increase the antisense efficacy of phosphorothioate oligonucleotides by 1000-fold. (Vlassov et al., 1994, Biochimica et Biophysica Acta 1197:95-108) Oligonucleotides can also be complexed with, for example, poly(L-lysine) or avidin, and lipids may or may not be included in the mixture (e.g., stearyl-poly(L-lysine)).Cationic lipids have been used in the art to deliver oligonucleotides to cells (see, e.g., U.S. Patent Nos. 5,855,910; 5,851,548; 5,830,430; 5,780,053; 5,767,099; Lewis et al. 1996. Proc. Natl. Acad. Sci. USA 93:3176; Hope et al. 1998. Molecular Membrane Biology 15:1). Other lipid compositions that can be used to promote the absorption of the present oligonucleotides can be used in conjunction with the claimed methods. In addition to those listed above, other lipid compositions are also known in the art and include, for example, those taught in U.S. Patent Nos. 4,235,871; 4,501,728; 4,837,028; 4,737,323.
[0107] In a specific embodiment, the antisense oligonucleotide for use according to the present invention, wherein the antisense oligonucleotide targets the region consisting of the nucleotides of SEQ ID NO:3.
[0108] In a specific embodiment, the antisense oligonucleotide for use according to the present invention comprises the sequence: SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38 or SEQ ID NO: 39.
[0109] In a specific embodiment, the antisense oligonucleotide for use according to the present invention consists of the sequence of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39.
[0110] In a specific embodiment, the antisense oligonucleotide for use according to the present invention comprises and / or consists of the sequence of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38 or SEQ ID NO: 39.
[0111] In a particular embodiment, the antisense oligonucleotide for use according to the present invention comprises and / or consists of the following sequence: SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26.
[0112] In a particular embodiment, the antisense oligonucleotide for use according to the present invention, wherein said antisense oligonucleotide is capable of reducing the amount of FYXD2 in dorsal root ganglia (DRG).
[0113] According to the present invention, a first nucleic acid sequence having at least 70% identity to a second nucleic acid sequence means that the first sequence has 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identity to the second nucleic acid sequence using a suitable sequence alignment algorithm and default parameters, such as BLAST N (Karlin and Altschul, Proc. Natl Acad. Sci. USA 87(6):2264-2268 (1990)).
[0114] In a specific embodiment, the present invention relates to a vector for the antisense oligonucleotide of the present invention for use.
[0115] In another embodiment, a nucleic acid (eg, an antisense nucleic acid) of the invention can be delivered in vivo alone (LASO) or in combination with a vector.
[0116] In its broadest sense, a "vector" is any vector that can facilitate the transfer of an oligonucleotide of the present invention to a cell. In particular, the vector transports the nucleic acid to the cell with reduced degradation relative to the degree of degradation caused when the vector is not present. In general, vectors that can be used in the present invention include, but are not limited to, naked plasmids, non-viral delivery systems (cationic transfection agents, liposomes, lipid nanoparticles, etc.), phagemids, viruses, and other vectors derived from viral or bacterial sources that are manipulated by inserting or incorporating oligonucleotide sequences. Viral vectors include, but are not limited to, nucleic acid sequences from the following viruses: RNA viruses such as retroviruses (e.g., Moloney murine leukemia virus and lentivirus-derived vectors), Harvey murine sarcoma virus, mouse mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus (AAV); SV40-type virus; polyoma virus; Epstein-Barr virus; papilloma virus; herpes virus; vaccinia virus; poliovirus. Other vectors that are not named but known in the art can be readily used.
[0117] Therefore, the object of the present invention relates to a vector comprising an oligonucleotide sequence encoding a part or fragment of FXYD2 or a variant thereof.
[0118] In another embodiment, the vector of the present invention comprises any variant of the oligonucleotide sequence encoding a portion or fragment of FXYD2.
[0119] In another embodiment, the vector of the present invention comprises any variant of the oligonucleotide sequence encoding any variant of FXYD2.
[0120] In another embodiment, the present invention relates to a vector comprising an antisense oligonucleotide sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0121] In another embodiment, the present invention relates to a vector comprising a shRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0122] In another embodiment, the present invention relates to a vector comprising a miRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0123] In another embodiment, the vector according to the present invention, wherein the antisense oligonucleotide targets a region comprising or consisting of the nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0124] In another embodiment, the present invention relates to a vector comprising the sequence of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38 or SEQ ID NO: 39, or a variant thereof, which encodes a part or fragment of FXYD2.
[0125] In another embodiment, the present invention relates to a vector consisting of the following sequence or variants thereof: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39, which encodes a part or fragment of FXYD2.
[0126] In another embodiment, the vector of the present invention comprises any variant of the following sequence or variants thereof: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30, SEQ ID NO:26 or SEQ ID NO:27, which encodes a portion or fragment of FXYD2.
[0127] In another embodiment, the vector of the present invention consists of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39, or any variant thereof, which encodes a portion or fragment of FXYD2.
[0128] In a specific embodiment, the vector of the present invention consists of any variant of the following sequences: SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26.
[0129] In another embodiment, the present invention relates to a vector comprising a sequence selected from, but not limited to, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 and a promoter.
[0130] In another embodiment, the present invention relates to a vector comprising or consisting of a sequence selected from, but not limited to, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: SEQ ID NO: 38 or SEQ ID NO: 39 and a promoter.
[0131] In another embodiment, the present invention relates to a vector comprising or consisting of a sequence selected from but not limited to SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 and a promoter.
[0132] In another embodiment, according to the vector of the present invention, the antisense oligonucleotide targets a region comprising or consisting of the nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 and a U6 promoter or a PolII promoter.
[0133] In some embodiments, the vector comprises a sequence selected from, but not limited to, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, or SEQ ID NO:39 and a U6 promoter or a PolII promoter.
[0134] In some embodiments, the vector comprises a sequence and a U6 promoter or a PolII promoter, wherein the sequence is as shown in a sequence selected from but not limited to SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26.
[0135] In another embodiment, the present invention relates to a vector comprising an oligonucleotide sequence encoding a portion or fragment of FXYD2 or a variant thereof and a CAG promoter.
[0136] In another embodiment, the present invention relates to a vector comprising a miRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof and a CAG promoter or a PolII promoter.
[0137] In another embodiment, the present invention relates to a vector comprising a shRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof and a U6 promoter.
[0138] In another embodiment, according to the vector of the present invention, the antisense oligonucleotide targets a region comprising or consisting of the nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 and a CAG promoter.
[0139] In another embodiment, the present invention relates to a vector comprising a sequence selected from, but not limited to, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38 or SEQ ID NO: 39 and a CAG promoter.
[0140] In a specific embodiment, the vector of the present invention comprises a sequence selected from but not limited to SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 and a CAG promoter.
[0141] Variants include, for example, variants that occur naturally due to allelic variation (e.g., polymorphism), alternative splicing forms, etc. between individuals. The term variant also includes gene sequences of the present invention from other sources or organisms. Variants are preferably substantially homologous to sequences according to the present invention, i.e., they exhibit a nucleotide sequence identity of generally at least about 75%, preferably at least about 85%, more preferably at least about 90%, and more preferably at least about 95% to the sequences of the present invention. Variants of the genes of the present invention also include nucleic acid sequences that hybridize to the above sequences (or their complementary strands) under stringent hybridization conditions. Typical stringent hybridization conditions include temperatures above 30°C, preferably above 35°C, more preferably above 42°C, and / or a salt concentration of less than about 500mM, preferably less than 200mM. Hybridization conditions can be adjusted by those skilled in the art by changing the concentration of temperature, salinity, and / or other reagents such as SDS, SSC, etc.
[0142] In a specific embodiment, the vector used according to the present invention is a non-viral vector or a viral vector.
[0143] In a specific embodiment, the non-viral vector is a plasmid comprising a nucleic acid sequence encoding FXYD2.
[0144] In another specific embodiment, the vector can be a viral vector.
[0145] Gene delivery viral vectors that can be used to implement the present invention can be constructed using methods well known in the field of molecular biology. Generally, viral vectors carrying transgenes are assembled from polynucleotides encoding transgenes, appropriate regulatory elements, and elements necessary to produce viral proteins that mediate cell transduction.
[0146] As used herein, the term "transgene" refers to the antisense oligonucleotides of the present invention.
[0147] The term "gene transfer" or "gene delivery" refers to a method or system for reliably inserting exogenous DNA into a host cell. These methods can result in transient expression of non-integrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes), or integration of the transferred genetic material into the genomic DNA of the host cell.
[0148] This recombinant virus can be produced by techniques known in the art, such as by transfection packaging cells or by transient transfection with helper plasmids or viruses. Typical examples of viral packaging cells include PA317 cells, PsiCRIP cells, GPenv+ cells, 293 cells, etc. Detailed protocols for producing this replication-defective recombinant virus can be found in, for example, WO95 / 14785, WO96 / 22378, US5,882,877, US6,013,516, US4,861,719, US5,278,056, and WO94 / 19478.
[0149] In a specific embodiment, the viral vector can be an adenoviral, retroviral, lentiviral, herpes virus, or adeno-associated virus (AAV) vector.
[0150] In a specific embodiment, an adeno-associated virus (AAV) vector is used.
[0151] In another embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an oligonucleotide sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0152] In another embodiment, the adeno-associated virus (AAV) vector of the present invention comprises any variant of an oligonucleotide sequence encoding a portion or fragment of FXYD2.
[0153] In another embodiment, the present invention relates to an adeno-associated viral (AAV) vector comprising an antisense sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0154] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising a shRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0155] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising a miRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0156] In another embodiment, according to the adeno-associated virus (AAV) of the present invention, the antisense oligonucleotide targets a region comprising or consisting of the nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0157] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising a sequence selected from, but not limited to, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38 or SEQ ID NO:39, or a variant thereof, which encodes a portion or fragment of FXYD2.
[0158] In another embodiment, the adeno-associated virus (AAV) vector of the present invention comprises any variant of a sequence selected from, but not limited to, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38, or SEQ ID NO:39, which encodes a portion or fragment of FXYD2 or a variant thereof.
[0159] In a specific embodiment, the adeno-associated virus (AAV) vector of the present invention comprises any variant of a sequence selected from but not limited to SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26.
[0160] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an oligonucleotide sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0161] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an antisense sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0162] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising a miRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0163] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising a shRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0164] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an oligonucleotide sequence encoding a portion or fragment of FXYD2 or a variant thereof and a CAG promoter.
[0165] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an antisense sequence encoding a portion or fragment of FXYD2 or a variant thereof and a CAG promoter.
[0166] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising a miRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof and a CAG promoter.
[0167] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising a shRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof and a CAG promoter.
[0168] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an antisense oligonucleotide and a CAG promoter, wherein the antisense oligonucleotide targets a region comprising or consisting of nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.
[0169] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising the sequence of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38 or SEQ ID NO:39 and a CAG promoter.
[0170] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising a sequence selected from, but not limited to, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 and a CAG promoter.
[0171] In one embodiment, the AAV vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10, or any other AAV serotype that can infect humans, rodents, monkeys, or other species.
[0172] "AAV vector" refers to a vector derived from an adeno-associated virus serotype, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10, etc. The AAV vector may have one or more AAV wild-type genes that are completely or partially deleted, such as rep and / or cap genes, but retains functional flanking ITR sequences. Functional ITR sequences are essential for the rescue, replication and packaging of AAV virions. Therefore, AAV vectors are defined herein as comprising at least those cis sequences (e.g., functional ITRs) required for viral replication and packaging. ITRs do not have to be wild-type polynucleotide sequences and can be changed, for example, by insertion, deletion or substitution of nucleotides, as long as the sequence provides functional rescue, replication and packaging. AAV expression vectors are constructed using known techniques to provide at least control elements that are operably connected components in the transcription direction, the control elements comprising a transcription initiation region, a target DNA (i.e., a nucleic acid sequence of the present invention), and a transcription termination region.
[0173] In certain embodiments, the viral vector used in the compositions and methods of the present invention is a recombinant adeno-associated virus (rAAV). The rAAV can be any serotype, modification, or derivative known in the art, or any combination thereof (e.g., a rAAV population comprising two or more serotypes, such as two or more of rAAV2, rAAV8, and rAAV9). In some embodiments, the rAAV is rAAV1, rAAV2, rAAV3, rAAV4, rAAV5, rAAV6, rAAV7, rAAV8, rAAV9, rAAVIO, rAAV-11, rAAV-12, rAAV-13, rAAV-14, rAAV-15, rAAV-16, rAAV.rh8, rAAV.rh10, rAAV.rh20, rAAV.rh39, rAAV.Rh74, rAAV.RHM4-1, AAV.hu37, rAAV.Anc80, rAAV.Anc80L 65, rAAV.7m8, rAAV.PHP.B, rAAV2.5, rAAV2tYF, rAAV.HSC2, rAAV.HSC3, rAAV.HSC4, rAAV.HSC5, rAAV.HSC6, rAAV.HSC7, rAAV.HSC8, rAAV.HSC9, rAAV.HSC10, rAAV.HSC11, rAAV.HSC12, rAAV.HSC13, rAAV.HSC14, rAAV.HSC15 or rAAV.HSC16, or other human AAVs, or a combination of two or more thereof.
[0174] In some embodiments, the rAAV used in the compositions and methods of the invention comprises a capsid protein from an AAV capsid serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-15, AAV-16, AAV.rh8, AAV.rhl0, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, and AAV.rh10. , AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 or AAV.HSC16, or derivatives, modifications or pseudotypes thereof. In some embodiments, the rAAV comprises an AAV selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-15, AAV-16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV. .HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 or AAV.HSC16, or at least 80% or higher identity, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., capsid proteins that are up to 100% identical.
[0175] In certain embodiments, the AAV used in the methods described herein is Anc80 or Anc80L65, as described in Zinn et al., 2015: 1056-1068, which is incorporated herein by reference in its entirety. In certain embodiments, the AAV used in the methods described herein comprises one of the following amino acid insertions: LGETTRP (SEQ ID NO: 14) or LALGETTRP (SEQ ID NO: 15), as described in U.S. Patent Nos. 9,193,956; 9458517; and 9,587,282 and U.S. Patent Application Publication No. 2016 / 0376323, each of which is incorporated herein by reference in its entirety. In certain embodiments, the AAV used in the methods described herein is AAV.7m8, as described in U.S. Patent Nos. 9,193,956; 9,458,517 and 9,587,282 and U.S. Patent Application Publication No. 2016 / 0376323, each of which is incorporated herein by reference in its entirety. In certain embodiments, the AAV used in the methods described herein is any AAV disclosed in U.S. Patent No. 9,585,971, such as AAV-PHP.B. In certain embodiments, the AAV used in the methods described herein is any AAV disclosed in U.S. Patent No. 9,840,719 and WO2015 / 013313, such as AAV.Rh74 and RHM4-1, each of which is incorporated herein by reference in its entirety. In certain embodiments, the AAV used in the methods described herein is any AAV disclosed in WO2014 / 172669, such as AAVrh.74, each of which is incorporated herein by reference in its entirety. In certain embodiments, the AAV used in the methods described herein is AAV2 / 5, as described in Georgiadis et al., 2016, Gene Therapy 23:857-862, each of which is incorporated herein by reference in its entirety. In certain embodiments, the AAV used in the methods described herein is any AAV disclosed in WO2017 / 070491, such as AAV2tYF, which is incorporated herein by reference in its entirety. In certain embodiments, the AAV used in the methods described herein is AAVLK03 or AAV3B, as described in Puzzo et al., 2017, Sci. Transl. Med. 29(9):418, which is incorporated herein by reference in its entirety.In certain embodiments, the AAV used in the methods described herein is any AAV disclosed in U.S. Patent Nos. 8,628,966; 8,927,514; 9,923,120 and WO2016 / 049230, such as HSC1, HSC2, HSC3, HSC4, HSC5, HSC6, HSC7, HSC8, HSC9, HSC10, HSC11, HSC12, HSC13, HSC14, HSC15 or HSC16, each of which is incorporated herein by reference in its entirety.
[0176] In certain embodiments, the AAV used in the methods described herein is the AAV disclosed in the following patents and patent applications, each of which is incorporated herein by reference in its entirety: U.S. Patent Nos. 7,282,199; 7,906,111; 8,524,446; 8,999,678; 8,628,966; 8,927,514; 8,734,809; U.S. 9,284,357; 9,409,953; 9,169,299; 9,193,956; 9458517; 9,587,282; U.S. Patent Application Publication Nos. 2015 / 0374803; 2015 / 0126588; 2017 / 0067908; 2013 / 0224836; 2016 / 0215024; 2017 / 0051257; and International Patent Application Nos. PCT / US2015 / 034799; PCT / EP2015 / 053335. In certain embodiments, the rAAV has a capsid protein that is at least 80% identical, e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identical, to the vp1, vp2, and / or vp3 sequences of the AAV capsids disclosed in the following patents and patent applications: U.S. Patent Nos. 7,282,199; 7,906,111; 8,524,446; 8,999,678; 8,628,966; 8,927, 514; 8,734,809; U.S. Patent Nos. 9,284,357; 9,409,953; 9,169,299; 9,193,956; 9458517; 9,587,282; U.S. Patent Application Publication Nos. 2015 / 0374803; 2015 / 0126588; 2017 / 0067908; 2013 / 0224836; 2016 / 0215024; 2017 / 0051257; and International Patent Application Nos. PCT / US2015 / 034799; PCT / EP2015 / 053335.
[0177] In some embodiments, the rAAV has the sequence described in International Application Publication Nos. WO 2003 / 052051 (see, e.g., SEQ ID NO: 2), WO 2005 / 033321 (see, e.g., SEQ ID NO: 123 and 88), WO 03 / 042397 (see, e.g., SEQ ID NO: 2, 81, 85, and 97), WO 2006 / 068888 (see, e.g., SEQ ID NO: 1 and 3-6), WO 2006 / 110689 (see, e.g., SEQ ID NO: 5-38), WO 2009 / 104964 (see, e.g., SEQ ID NO: 1-5, 7, 9, 20, 22, 24, and 31), WO 2010 / 127097 (see, e.g., SEQ ID NO: 5-38), WO 2015 / 191508 (see, e.g., SEQ ID NO: 1 NOs: 80-294) and the capsid proteins disclosed in U.S. Patent Application Publication No. 20150023924 (see, e.g., SEQ ID NOs: 1, 5-10), each of which is incorporated herein by reference in its entirety. In some embodiments, the rAAV has a capsid protein that is at least 80% identical, e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identical, to the vp1, vp2, and / or vp3 sequences of the AAV capsids disclosed in International Application Publication Nos. WO 2003 / 052051 (see, e.g., SEQ ID NO: 2), WO 2005 / 033321 (see, e.g., SEQ ID NOs: 123 and 88), WO 03 / 042397 (see, e.g., SEQ ID NOs: 2, 81, 85, and 97), WO 2006 / 068888 (see, e.g., SEQ ID NOs: 1 and 3-6), WO 2006 / 110689 (see, e.g., SEQ ID NOs: 5-38), WO 2009 / 104964 (see, e.g., SEQ ID NOs: 1-5, 7, 9, 20, 22, 24, and 31), WO 2010 / 127097 (see, e.g., SEQ ID NOs: 5-38), WO 2015 / 191508 (see, e.g., SEQ ID NOs: 80-294), and U.S. Patent Application Publication No. 20150023924 (see, e.g., SEQ ID NOs: 1, 5-10).
[0178] Nucleic acid sequences for AAV-based viral vectors and methods for preparing recombinant AAV and AAV capsids are described in, for example, U.S. Patent Nos. 7,282,199; 7,906,111; 8,524,446; 8,999,678; 8,628,966; 8,927,514; 8,734,809; U.S. Patent Nos. 9,284,357; 9,409,953; 9,169,299; 9,193,95 6; 9458517; 9,587,282; U.S. Patent Application Publication Nos. 2015 / 0374803; 2015 / 0126588; 2017 / 0067908; 2013 / 0224836; 2016 / 0215024; 2017 / 0051257; International Patent Application Nos. PCT / US2015 / 034799; PCT / EP2015 / 053335; WO 2003 / 052051; WO 2005 / 033321; WO 03 / 042397; WO 2006 / 068888; WO 2006 / 110689; WO 2009 / 104964; WO 2010 / 127097; WO 2015 / 191508; and U.S. Patent Application Publication No. 20150023924.
[0179] In other embodiments, rAAV comprises a pseudotyped rAAV. In some embodiments, the pseudotyped rAAV is rAAV2 / 8 or rAAV2 / 9 pseudotyped rAAV. Methods for preparing and using pseudotyped rAAV are known in the art (e.g., see Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000); Zolotukhin et al., Methods 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, (2001)).
[0180] In other embodiments, the rAAV comprises a capsid comprising capsid proteins from two or more AAV capsid serotypes. In some embodiments, the capsid protein is a chimera of two or more AAV capsid proteins from an AAV serotype selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-15, AAV-16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.A nc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HS C5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 or AAV.HSC16.
[0181] In some embodiments, single-stranded AAV (ssAAV) can be used. In some embodiments, self-complementary vectors, such as scAAV, can be used (e.g., see Wu, 2007, Human Gene Therapy, 18(2):171-82, McCarty et al, 2001, Gene Therapy, Vol. 8, Number 16, Pages 1248-1254; and U.S. Patent Nos. 6,596,535; 7,125,717; 7,456,683, each of which is incorporated herein by reference in its entirety).
[0182] In certain embodiments, the recombinant AAV vector for delivering a transgene has tropism for cells in the DRG. Such vectors can include non-replicating "rAAV", particularly preferably those carrying AAV8 or AAVrh10 capsids. In certain embodiments, the viral vectors provided herein are viral vectors based on AAV9 or AAVrh10. In certain embodiments, the viral vectors based on AAV8 or AAVrh10 provided herein retain DRG tropism. AAV variant capsids can be used, including but not limited to those described by Wilson in U.S. Patent No. 7,906,111, the entire text of which is incorporated herein by reference, wherein AAV / hu.31 and AAV / hu.32 are particularly preferred; and U.S. Patent No. 8,628,966, U.S. Patent No. 8,927,514, Chatterjee and Smith et al., 2014, Mol Ther 22: 1625-1634 AAV variant capsids described, the entire text of which is incorporated herein by reference.
[0183] In some embodiments, the present invention relates to a recombinant adeno-associated virus (rAAV) comprising (i) an expression cassette containing a transgene under the control of regulatory elements and flanked by ITRs, and (ii) an AAV capsid, wherein the transgene encodes an inhibitory RNA that specifically binds to FXYD2 mRNA and inhibits the expression of FXYD2 in a cell.
[0184] Specific embodiments provide an AAV vector comprising an artificial genome, comprising (i) an expression cassette containing a transgene under the control of regulatory elements and flanked by ITRs; and (ii) a viral capsid having an amino acid sequence of an AAV capsid protein or having at least 95%, 96%, 97%, 98%, 99% or 99.9% identity to the amino acid sequence of an AAV capsid protein, while retaining the biological function of the AAV capsid.
[0185] Specific embodiments provide an AAV vector comprising an artificial genome, comprising (i) an expression cassette containing a transgene under the control of regulatory elements and flanked by ITRs; and (ii) a viral capsid having an amino acid sequence of an AAVrh10 capsid protein or having at least 95%, 96%, 97%, 98%, 99% or 99.9% identity to the amino acid sequence of an AAVrh10 capsid protein, while retaining the biological function of the AAVrh10 capsid. In certain embodiments, the encoded AAVrh10 capsid has the sequence of SEQ ID NO:81 set forth in U.S. Patent No. 9,790,427, having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions, and retains the biological function of the AAVrh10 capsid, the entirety of which is incorporated herein by reference.
[0186] The control elements are selected to be functional in mammalian cells. The resulting construct containing the operably linked components is flanked (5' and 3') by functional AAV ITR sequences. "Adeno-associated virus inverted terminal repeats" or "AAV ITRs" refer to regions recognized in the art found at each end of the AAV genome that together function in cis as the origin of viral DNA replication and as a packaging signal. Together with the AAV rep coding region, the AAV ITR provides for efficient excision and rescue of the polynucleotide sequence inserted between the two flanking ITRs in the genome of mammalian cells, as well as integration. The polynucleotide sequences of the AAV ITR region are known. As used herein, "AAV ITR" does not necessarily comprise a wild-type polynucleotide sequence, but can be altered. For example, by insertion, deletion or substitution of nucleotides. In addition, AAV ITRs can be derived from any of a variety of AAV serotypes, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10, and the like. Furthermore, the 5' and 3' ITRs (which flank the selected polynucleotide sequence) in an AAV vector do not necessarily need to be identical or derived from the same AAV serotype or isolate, as long as they can perform their intended function, i.e., allow excision and rescue of the target sequence from the host cell genome or vector, and allow integration of the heterologous sequence into the recipient cell genome when the AAV Rep gene product is present in the cell. Furthermore, AAV ITRs can be derived from a variety of AAV serotypes, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAVrh.10, and the like. Furthermore, the 5' and 3' ITRs (which flank the selected polynucleotide sequence) in an AAV vector do not necessarily need to be identical or derived from the same AAV serotype or isolate, as long as they are able to perform their intended functions, i.e., allowing excision and rescue of the target sequence from the host cell genome or vector, and allowing integration of the heterologous sequence into the recipient cell genome when the AAV Rep gene product is present in the cell.
[0187] Specific embodiments are vectors derived from AAV serotypes that have tropism and high transduction efficiency in mammalian DRG cells. This patent application provides a review and comparison of the transduction efficiency of different serotypes. In certain embodiments, vectors based on AAV2, AAV5, AAV8, AAV9, and rh.10 direct long-term expression of transgenes in DRG.
[0188] The selected polynucleotide sequence is operably linked to control elements that direct its transcription or expression in a subject. These control elements may comprise control sequences that are normally associated with the selected gene.
[0189] Typically, the vectors of the present invention comprise an expression cassette. The term "expression cassette" refers to a nucleic acid construct comprising nucleic acid elements sufficient to express the nucleic acid molecule of the present invention. Typically, the nucleic acid molecule encodes a heterologous gene and may also include suitable regulatory elements. A heterologous gene refers to a transgenic gene encoding a target RNA.
[0190] One or more expression cassettes can be used. Each expression cassette can comprise at least one promoter sequence operably connected to the sequence encoding the target RNA. Each expression cassette can be composed of additional regulatory elements, introns, introns, UTRs, polyadenylation sites, etc. In some embodiments, the expression cassette is polycistronic with respect to the transgenic of encoding for example two or more miRNAs. In other embodiments, the expression cassette comprises a promoter, a nucleic acid encoding one or more target RNA molecules and a polyA. In other embodiments, the expression cassette comprises a 5'-promoter sequence, a sequence encoding a first target RNA, a sequence encoding a second target RNA, and a polyadenylation sequence-3'.
[0191] In some embodiments, the expression cassette may comprise other elements, such as introns, enhancers, polyadenylation sites, woodchuck post-transcriptional response elements (WPREs), and / or other elements known to affect the expression level of a coding sequence. Typically, the expression cassette comprises a nucleic acid molecule of the invention operably linked to a promoter sequence.
[0192] The term "operably linked" refers to the association of two or more nucleic acid fragments on a single nucleic acid fragment so that the function of one is affected by the other.
[0193] For example, a promoter is operably linked to a coding sequence when it is capable of affecting the expression of the coding sequence (e.g., the coding sequence is under the transcriptional control of the promoter). A coding sequence can be operably linked to a regulatory sequence in sense or antisense orientation.
[0194] As used herein, the term "promoter" sequence refers to a polynucleotide region comprising a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene that is capable of binding RNA polymerase and initiating transcription of a downstream (3' direction) coding sequence. Transcriptional promoters can include "inducible promoters" (wherein the expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), "repressible promoters" (wherein the expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), and "constitutive promoters."
[0195] In some embodiments, the promoter is a heterologous promoter.The term "heterologous promoter" as used herein refers to a promoter that is not found operably linked to a given coding sequence in nature.
[0196] Useful heterologous control sequences generally include those derived from sequences encoding mammalian or viral genes. Examples include, but are not limited to, phosphoglycerate kinase (PKG) promoter, CAG (complex of (CMV) cytomegalovirus enhancer, chicken beta actin promoter (CBA) and rabbit beta globin intron), U6 promoter, neuronal promoter (human synapsin 1 (hSyn) promoter, NeuN promoter, CamKII promoter, promoters of dopamine-1 receptor and dopamine-2 receptor), SV40 early promoter, mouse mammary tumor virus LTR promoter; adenovirus major late promoter (AdMLP); herpes simplex virus (HSV) promoter, CMV promoter such as CMV immediate early promoter region (CMV-IE), Rous sarcoma virus (RSV) promoter, synthetic promoter, hybrid promoter, etc. In addition, sequences derived from non-viral genes such as mouse metallothionein genes can also be used herein. Such promoter sequences are commercially available from, for example, Stratagene (San Diego, CA).
[0197] For the purposes of the present invention, heterologous promoters and other control elements, such as DRG-specific and inducible promoters, enhancers, etc., will be particularly useful.
[0198] "Enhancer" is a polynucleotide sequence that can stimulate promoter activity, and can be a natural element of a promoter or a heterologous element inserted to enhance promoter levels or tissue specificity. In some embodiments, the promoter is derived from the entirety of a natural gene. In some embodiments, the promoter is composed of different elements derived from different naturally occurring promoters. In some embodiments, the promoter comprises a synthetic polynucleotide sequence. It will be understood by those skilled in the art that different promoters will direct gene expression in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions or the presence or absence of drugs or transcription cofactors. Ubiquitous, cell type-specific, tissue-specific, developmental stage-specific and conditional promoters, such as drug-responsive promoters (e.g., tetracycline-responsive promoters) are well known to those skilled in the art.
[0199] In mammalian systems, there are three types of promoters that are candidates for constructing expression vectors: the PolI promoter controls the transcription of large ribosomal RNAs; the PolII promoter controls the transcription of mRNAs (which are translated into proteins) and small nuclear RNAs (snRNAs); and the PolIII promoter uniquely transcribes small non-coding RNAs. Each has advantages and limitations that need to be considered when designing constructs for expressing RNA in vivo. For example, the PolIII promoter can be used to synthesize small interfering RNAs (shRNAs) from DNA templates in vivo. For better control of tissue-specific expression, the PolII promoter is preferred, but can only be used for the transcription of miRNAs. However, when using the PolII promoter, it may be preferable to omit the translation initiation signal so that the RNA acts as an antisense RNA, siRNA, shRNA, or miRNA and is not translated into peptides in vivo.
[0200] AAV expression vectors carrying target DNA molecules flanked by AAV ITRs can be constructed by directly inserting the selected sequence into the AAV genome having a major AAV open reading frame ("ORF") excised therefrom. Other parts of the AAV genome may also be deleted, as long as enough ITR portions are retained to allow replication and packaging functions. Such constructs can be designed using techniques well known in the art. See, for example, U.S. Patent Nos. 5,173,414 and 5,139,941; International Publication Nos. WO 92 / 01070 (published on January 23, 1992) and WO 93 / 03769 (published on March 4, 1993). Alternatively, standard ligation techniques can be used to excise the AAV ITRs from the viral genome or an AAV vector containing the same sequence and fuse them to the 5' and 3' ends constructed from selected nucleic acid present in another vector. AAV vectors containing ITRs have been described, for example, in U.S. Patent No. 5,139,941. In particular, several AAV vectors are described herein, which are available from the American Type Culture Collection ("ATCC") under accession numbers 53222, 53223, 53224, 53225, and 53226. In addition, chimeric genes can be synthesized to include AAV ITR sequences located at the 5' and 3' ends of one or more selected nucleic acid sequences. Preferred codons for expressing chimeric gene sequences in mammalian DRG cells can be used, and in certain embodiments, transgenes are codon-optimized by known methods. The complete chimeric sequence can be assembled from overlapping oligonucleotides by standard methods. In order to produce AAV viral particles, the AAV expression vector is introduced into a suitable host cell using known techniques (e.g., by transfection). Many transfection techniques are generally known in the art. Particularly suitable transfection methods include calcium phosphate coprecipitation, microinjection directly into cultured cells, electroporation, liposome-mediated gene transfer, lipid-mediated transduction, and nucleic acid delivery using high-speed microparticles.
[0201] For example, in addition to the nucleic acid sequence of the present invention, a specific viral vector comprises an AAV vector plasmid backbone having ITRs from AAV-2, a promoter such as the mouse PGK (phosphoglycerate kinase) gene or a cytomegalovirus / β-actin hybrid promoter (CAG), which is composed of an enhancer from the CMV immediate gene, a promoter from the chicken β-actin gene, a splice donor and intron, a splice acceptor from rabbit β-globin, or any neuronal promoter such as the promoter of the dopamine-1 receptor or the dopamine-2 receptor, or the synapsin promoter, with or without a wild-type or mutant form of the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and a rabbit β-globin polyA sequence. In addition, the viral vector may comprise a nucleic acid sequence encoding an antibiotic resistance gene, such as a gene for ampicillin resistance (AmpR), kanamycin, hygromycin B, geneticin, blasticidin S, or puromycin.
[0202] In one embodiment, a retroviral vector is used.
[0203] Because retrovirus can be integrated into its gene in the host genome, transfer a large amount of foreign genetic materials, infect a wide spectrum of species and cell types and be packaged in a special cell line, therefore retrovirus can be selected as gene delivery vector.In order to build retroviral vector, the nucleic acid encoding the target gene is inserted into the viral genome to replace some viral sequences to produce replication-defective viruses.In order to produce virions, build a packaging cell line containing gag, pol and / or env genes but not containing LTR and / or packaging components.When the recombinant plasmid containing cDNA is introduced into this cell line (for example, by calcium phosphate precipitation) together with retroviral LTR and packaging sequence, packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged in the virus particle, which is then secreted in the culture medium. Collect the culture medium containing the recombinant retrovirus then, optionally concentrate, and be used for gene transfer. Retroviral vector can infect a variety of cell types.
[0204] In another embodiment, a lentiviral vector is used.
[0205] In a specific embodiment, the present invention relates to a lentiviral vector comprising an oligonucleotide sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0206] In another embodiment, the lentiviral vector of the present invention comprises any variant of an oligonucleotide sequence encoding a portion or fragment of FXYD2.
[0207] In another embodiment, the lentiviral vector of the present invention comprises any variant of an oligonucleotide sequence encoding any variant of FXY2D.
[0208] In another embodiment, the present invention relates to a lentiviral vector comprising an antisense sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0209] In another embodiment, the present invention relates to a lentiviral vector comprising a shRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0210] In another embodiment, the present invention relates to a lentiviral vector comprising a miRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0211] In another embodiment, the present invention relates to a lentiviral vector comprising an antisense oligonucleotide or a variant thereof, wherein the antisense oligonucleotide or a variant thereof targets a region comprising or consisting of the nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0212] In another embodiment, the present invention relates to a lentiviral vector comprising a sequence selected from, but not limited to, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 39, or a variant thereof, which encodes a portion or fragment of FXYD2.
[0213] In another embodiment, the lentiviral vector of the present invention comprises any variant of a sequence selected from, but not limited to, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: SEQ ID NO: 38, or SEQ ID NO: 39, which encodes a portion or fragment of FXYD2.
[0214] In another embodiment, the lentiviral vector of the present invention comprises any variant of a sequence selected from, but not limited to, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26.
[0215] In another embodiment, the present invention relates to a lentiviral vector comprising an oligonucleotide sequence encoding a portion or fragment of FXYD2 or a variant thereof.
[0216] In another embodiment, the present invention relates to a lentiviral vector comprising a shRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof and a U6 promoter.
[0217] In another embodiment, the present invention relates to a lentiviral vector comprising an antisense oligonucleotide and a U6 promoter, wherein the antisense oligonucleotide targets a region comprising or consisting of nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0218] In another embodiment, the present invention relates to a lentiviral vector comprising the sequence of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38 or SEQ ID NO:39 and a U6 promoter.
[0219] In another embodiment, the lentiviral vector of the present invention comprises any variant of a sequence selected from, but not limited to, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 and a U6 promoter.
[0220] In another embodiment, the present invention relates to a lentiviral vector comprising an oligonucleotide sequence encoding a portion or fragment of FXYD2 or a variant thereof and a CAG promoter.
[0221] In another embodiment, the present invention relates to a lentiviral vector comprising an antisense sequence encoding a portion or fragment of FXYD2 or a variant thereof and a CAG promoter.
[0222] In another embodiment, the present invention relates to a lentiviral vector comprising a miRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof and a CAG promoter.
[0223] In another embodiment, the present invention relates to a lentiviral vector comprising a shRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof and a CAG promoter.
[0224] In a specific embodiment, the present invention relates to a lentiviral vector comprising an antisense oligonucleotide and a CAG promoter, wherein the antisense oligonucleotide targets a region comprising or consisting of nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0225] In a specific embodiment, the present invention relates to a lentiviral vector comprising the sequence of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38 or SEQ ID NO:39 and a CAG promoter.
[0226] Lentivirus is a complex retrovirus that contains, in addition to the common retroviral genes gag, pol and env, other genes with regulatory or structural functions. Higher complexity enables the virus to regulate its life cycle, such as during latent infection. Some examples of lentivirus include human immunodeficiency virus (HIV1, HIV2) and simian immunodeficiency virus (SIV). Lentivirus vectors have been produced by multiple attenuated HIV virulence genes, such as genes env, vif, vpr, vpu and nef are deleted, making the vector biologically safe. Lentivirus vectors are known in the art, see, for example, U.S. Patent Nos. 6,013,516 and 5,994,136, both of which are incorporated herein by reference. Typically, vectors are plasmid-based or virus-based and are constructed to carry sequences for incorporating exogenous nucleic acids, for selecting and for transferring nucleic acids into host cells. The gag, pol and env genes of the target vector are also known in the art. Therefore, the relevant genes are cloned into the selected vector and then used to transform the target cells. Recombinant lentivirus capable of infecting non-dividing cells, wherein suitable host cells are transfected with two or more vectors carrying packaging functions, namely gag, pol and env, as well as rev and tat, as described in U.S. Patent No. 5,994,136, which is incorporated herein by reference. This describes a first vector that can provide nucleic acid encoding the viral gag and pol genes and another vector that can provide nucleic acid encoding the viral env to produce packaging cells. The vector providing the heterologous gene is introduced into the packaging cells to produce producer cells that release infectious viral particles carrying the exogenous target gene. Env is preferably an amphotropic envelope protein that allows transduction of cells of humans and other species. Generally, the nucleic acid molecules or vectors of the present invention include "control sequences," which collectively refer to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory structural domains, replication origins, internal ribosome entry sites ("IRES"), enhancers, etc., which collectively provide for replication, transcription, and translation of the coding sequence in the recipient cell. Not all of these control sequences need to be present, as long as the selected coding sequence is capable of replication, transcription, and translation in the appropriate host cell.
[0227] In a specific embodiment, the present invention relates to a method of treating pain in a subject in need thereof, comprising the step of administering to said subject a therapeutically effective amount of an inhibitor and / or antisense oligonucleotide as described above.
[0228] In a specific embodiment, according to the method of the present invention, the antisense oligonucleotide targets at least a region comprising or consisting of the nucleotides of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0229] In a specific embodiment, according to the method of the present invention, the antisense oligonucleotide targets a region comprising or consisting of the nucleotides of SEQ ID NO: 3.
[0230] In a specific embodiment, according to the method of the present invention, the antisense oligonucleotide comprises or consists of a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:38 or SEQ ID NO:39.
[0231] In a specific embodiment, according to the method of the present invention, the antisense oligonucleotide comprises or consists of a sequence selected from the group consisting of: SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26.
[0232] In a specific embodiment, the method according to the invention is one in which the antisense oligonucleotide is administered alone (naked) or in a vector as described above.
[0233] In another embodiment, i) the antisense oligonucleotide for use according to the present invention and ii) the classical therapy are used simultaneously, separately or sequentially as a combined preparation for the treatment of pain.
[0234] As used herein, the term "classical therapy" refers to any natural or synthetic compound. In a specific embodiment, the classical therapy is selected from, but not limited to: aspirin, acetaminophen, nonsteroidal anti-inflammatory drugs (NSAIDs); codeine, cryotherapy, virtual therapy, flax, morphine and its derivatives, opium and its derivatives.
[0235] "Therapeutically effective amount" means the minimum amount of active agent (e.g., an ASO according to the present invention) necessary to give a subject a therapeutic benefit. For example, a "therapeutically effective amount" of a subject is an amount that induces, ameliorates, or otherwise causes an improvement in pathological symptoms, disease progression, or physiological conditions associated with a condition, or resistance to the condition. It should be understood that the total daily dose of the compounds of the present invention will be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dosage level for any particular subject will depend on a variety of factors, including the condition being treated and the severity of the condition; the activity of the specific compound used; the specific composition used for the subject, the age, weight, general health, sex, and diet of the subject; the time of administration, route of administration, and excretion rate of the specific compound used; the duration of treatment; drugs used in combination or concomitantly with the specific compound used; and similar factors well known in the medical field. For example, it is well known to those skilled in the art to start the dose of the compound at a level lower than that required to achieve the desired therapeutic effect and gradually increase the dose until the desired effect is achieved. However, the daily dose of the product can vary over a wide range of 0.01 to 1,000 mg / adult / day. Typically, the composition contains 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of active ingredient for symptomatic adjustment of the dosage of the subject to be treated. The drug typically contains from about 0.01 mg to about 500 mg of active ingredient, preferably from 1 mg to about 100 mg of active ingredient. An effective amount of the drug is typically provided at a dosage level of from 0.0002 mg / kg body weight / day to about 20 mg / kg body weight / day, particularly from about 0.001 mg / kg body weight / day to 7 mg / kg body weight / day.
[0236] In a specific embodiment, the antisense oligonucleotides of the invention are administered intravenously at a dose level of at least 7 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 30 mg / kg or 40 mg / kg body weight.
[0237] In a specific embodiment, the antisense oligonucleotides of the invention are administered intravenously at a dose level of 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 mg / kg body weight.
[0238] In another embodiment, the present invention relates to a pharmaceutical composition comprising the antisense oligonucleotide for use according to the present invention.
[0239] In a specific embodiment, the pharmaceutical compositions of the present invention are administered intravenously.
[0240] In a specific embodiment, according to the pharmaceutical composition of the present invention, the antisense oligonucleotide targets at least the region comprising or consisting of the nucleotides of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.
[0241] In a specific embodiment, according to the pharmaceutical composition of the present invention, the inhibitor targets a region comprising or consisting of the nucleotide sequence of SEQ ID NO: 3.
[0242] In a specific embodiment, the present invention relates to a pharmaceutical composition according to the present invention, comprising at least one antisense oligonucleotide comprising and / or consisting of a sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38 or SEQ ID NO: 39.
[0243] In a specific embodiment, according to the pharmaceutical composition of the present invention, the antisense oligonucleotide comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26.
[0244] In a particular embodiment, the invention relates to a pharmaceutical composition according to the invention for use in the treatment of pain.
[0245] In a particular embodiment, the invention relates to a pharmaceutical composition for use according to the invention, wherein the pain is peripheral pain.
[0246] In a particular embodiment, the invention relates to a pharmaceutical composition for use according to the invention, wherein the pain is neuropathic pain, diabetic pain, chemotherapy pain, inflammatory pain, surgical pain and / or chronic postoperative pain.
[0247] Antisense oligonucleotides as described above can be combined with pharmaceutically acceptable excipients and optional sustained-release matrix such as biodegradable polymers to form pharmaceutical compositions."Pharmaceutically" or "pharmaceutically acceptable" refer to molecular entities and compositions that do not produce disadvantageous, allergic or other adverse reactions when suitably applied to mammals, especially people. Pharmaceutically acceptable carriers or excipients refer to nontoxic solid, semisolid or liquid fillers, diluents, encapsulating materials or formulation adjuvants of any type. Pharmaceutical compositions of the present invention, active components, alone or in combination with another active component for intravenous administration can be used in unit administration form, as a mixture with conventional pharmaceutical carriers, to subjects such as animals and people.
[0248] Typically, pharmaceutical compositions contain a pharmaceutically acceptable vehicle for injectable formulations. These can be, in particular, isotonic, sterile saline solutions (monosodium or disodium phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, or mixtures of these salts), or dried, in particular lyophilized, compositions, which, when added to sterile water or saline, can constitute injectable solutions. Pharmaceutical forms suitable for injection include sterile aqueous solutions or dispersions; formulations comprising sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid for easy injection. It must be stable under the conditions of manufacture and storage and must be protected from the contaminating effects of microorganisms such as bacteria and fungi. Solutions containing the compounds of the invention as free bases or pharmaceutically acceptable salts can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, and in oils. Under normal storage and use conditions, these formulations contain preservatives to prevent the growth of microorganisms. The polypeptide (or its encoding nucleic acid) can be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the protein) formed with inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed with free carboxyl groups can also be derived from inorganic bases, such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or ferric hydroxide, and organic bases, such as isopropylamine, trimethylamine, histidine, procaine, etc. The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. For example, by using a coating such as lecithin, in the case of a dispersion, by maintaining the desired particle size and by using a surfactant, appropriate fluidity can be maintained. The effects of microorganisms can be prevented by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it is preferred to include an isotonic agent, such as sugar or sodium chloride. The extended absorption of injectable compositions can be achieved by using agents such as aluminum monostearate and gelatin that delay absorption in the composition. By mixing the required amount of active polypeptide with several other ingredients (as needed) listed above into a suitable solvent, then filter sterilization to prepare a sterile injectable solution. Usually, dispersions are prepared by mixing various sterilized active ingredients into a sterile vehicle containing a basic dispersion medium and other required ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred preparation methods can be vacuum drying and freeze drying techniques, which produce active ingredients plus any additional required ingredient powders from their previously sterile filtered solutions. When formulated, the solution will be used in a manner compatible with the dosage formulation and in a therapeutically effective amount.Preparation is easy to use with various dosage forms, for example the type of above-mentioned injectable solution, but also can use drug release capsule etc.Specific aqueous solution is particularly suitable for intravenous administration.In this respect, according to the disclosure, operable sterile aqueous medium is well known to those skilled in the art.For example, a dosage can be dissolved in 1ml isotonic NaCl solution and added in 1000ml subcutaneous infusion or injected at the infusion site of suggestion.Some variations of dosage will inevitably occur, and this depends on the condition of the experimenter being treated.In any case, the personnel responsible for using will determine the appropriate dosage of individual experimenter.
[0249] The present invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted as limiting the scope of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS
[0250] Figure 1. Intravenously injected 2'-MOE-modified FXYD2-LASO-gapmer provides sustained pain relief in neuropathic and inflammatory pain models. (A, B) After mechanical hypersensitivity induced by SNL (A) or CFA (B), animals were intravenously injected with 40 mg / kg of FXYD2- or control-LASO-gapmer daily for 15 days, as assessed by the Randall-Selitto paw pressure test, followed by single injections of 20 mg / kg, 15 mg / kg, 10 mg / kg, 5 mg / kg, and finally 20 mg / kg every 9 to 10 days. (A', A") After mechanical hypersensitivity induced by SNL, animals were intravenously injected with 20 mg / kg of FXYD2- or control-LASO-gapmer daily for 16 days, as assessed by the Randall-Selitto paw pressure test (A') and the von Frey test (A"). After treatment was stopped and analgesic effect was observed to be weakened, animals were injected intravenously with 20 mg / kg of FXYD2- or control-LASO-gapmer every day for 2 days. (C-D') To test spontaneous pain, 40 mg / kg of FXYD2-LASO-gapmer was injected intravenously every day in SNL- (day 28 in A) or CFA (day 25 in B)-rat cohorts for 15 days. When complete attenuation of pain behavior was achieved, the rat pain expression scale (Rat Grimace Scale, RGS) (after SNL in D and after CFA in D') and static weight bearing (Static Weight Bearing, SWB) test (after SNL in D and after CFA in D') were used. Mean ± standard error of the data from 6 animals. Two-way (AB) and one-way (C-D') ANOVA and Bonferroni test were used, **=p<0.01; ***=p<0.001; ****=p<0.0001. Example:
[0251] Materials and methods
[0252] Animals. All animals were housed on a 12 / 12 dark / light cycle with ad libitum access to water and food. Five-week-old female or male Sprague-Dawley rats (Janvier, France) weighing 200-250 g at the start of the experiment were used.
[0253] Chronic pain model. The SNL (spinal nerve ligation) model of peripheral neuropathic pain and the CFA (competitive Freund's adjuvant) model of chronic inflammatory pain were used. All surgeries were performed under deep isoflurane anesthesia. The SNL procedure was performed as described previously (1). Briefly, the L6 transverse process was removed to expose the L4 and L5 spinal nerves. The L5 spinal nerve was then isolated and tightly ligated with 6.0 silk thread. To obtain Sham-animals, a posture was performed to expose the nerves, but no ligature was performed. The CFA-induced pain model (2) was used to evaluate chronic inflammatory pain. Briefly, under isoflurane anesthesia, an intraplantar injection (50 μl) of 1 mg of Mycobacterium tuberculosis (Sigma-Aldrich) solution per ml was performed in the left hind paw of the animal. Control animals were obtained by injecting 50 μl of saline solution (NaCl 0.9%).
[0254] 2'-MOE-lipid conjugated LASO gapmer. Synthesis of LASO-gapmer: Oligonucleotides were synthesized on an automated synthesizer using conventional phosphoramidite chemistry on a 1 to 40 micromolar scale. An AKTA Oligopilot 10 (GE healthcare, USA) was used to synthesize larger sequences of 25 to 40 micromolar scale. These batches synthesized on a polystyrene solid support (GE healthcare) were used for in vivo studies. 2'MOE monomer and synthetic reagents were sourced from Glen Research (USA). Lipid oligonucleotides were modified at the 5'-end with a double-stranded C16 ketal core lipid phosphoramidite synthesized in the laboratory according to a literature procedure (3).
[0255] Purification and characterization of oligonucleotides. The lipid-oligonucleotide gapmer 2'MOE sequence was purified on a preparative C4-reverse phase HPLC column (Waters, Xbridge Protein BEH, 5 μ m, 30mm × 50mm) on purification. Use the HPLC Nucleosil C4 column (4 × 250mm, 5 μ m) from Macherey-Nagel to analyze the purified lipid oligonucleotide. Linear gradient is programmed from 100% A to 100% B in 10 minutes. The mobile phase consisting of 100% B is maintained for 2 minutes, and then the column is balanced with 100% A for 5 minutes and then run. Flow rate is fixed at 1.0 mL / min. All samples are characterized by the ESI mass spectrometry carried out on Thermo Fisher Q-exactive. 50mM ammonium acetate (Sigma-Aldrich) is dialyzed to prepare oligonucleotide samples using 3.5kD vivacon membrane (Sartorius). All oligonucleotide samples are lyophilized and stored at -20 ℃.
[0256] A non-targeting LASO-gapmer (sense sequence: 5'CGTGTAGGTACGGCAGATC3' = SEQ ID NO: 40) was used as a negative control and is referred to as control-LASO-gapmer.
[0257] Intravenous LASO-gapmer Injections in Rats SNL-operated and CFA-injected rats were tested to demonstrate mechanical hypersensitivity and then injected daily intravenously with 40 mg / kg control- or FXYD2-LASO-gapmer in 200 μl of 5% glucose in water under brief isoflurane anesthesia.
[0258] Behavioral testing of rats. Sprague-Dawley female or male rats were housed two per cage under standard conditions of light and temperature. Commercially available food pellets and tap water were available ad libitum. Upon arrival, the animals were habituated to the colony room for 4 days. To avoid stress caused by the experimental conditions, analyses were performed by the same experimenter under quiet conditions in a test room adjacent to the colony room. Two weeks before the experiment, the animals were weighed daily, gently handled for 5 minutes, and placed in the test room for 1 hour to habituate them to the nociceptive apparatus. Mechanical allodynia and mechanical hyperalgesia were evaluated before surgery and on the day of surgery (day 0) and once a day thereafter. For mechanical allodynia, we performed the von Frey test as described previously (4). For mechanical hyperalgesia, the nociceptive threshold of hand-held rats was determined by the Randall-Selitto paw pressure test using a Basile analgesia meter (Apelex; stylus tip diameter, 1 mm) as described previously (5). Briefly, increasing pressure was applied to the injured hind paw until the rat screamed. A 600 g cut-off was determined to prevent tissue damage.
[0259] To assess spontaneous pain, two non-reflexive behavioral tests were used: the Rat Grief Scale and the Static Weight Bearing Test. i) The Rat Grief Scale (RGS) test was performed as previously described (6). The four RGS action units were observed: orbital contraction, nose / cheek flattening, ear changes, and whisker changes. For pre-randomly assigned animals, two different scorers assigned a value of 0, 1, or 2 to each of the four RGS action units (0: action unit absent, 1: action unit moderately present, and 2: action unit clearly present). The RGS score corresponded to the mean value obtained for each action unit. ii) The incapacity test was performed using the Static Weight Bearing (SWB) test system (Bioseb, Vitrolles, France). Rats were placed in the test box and allowed to acclimate for approximately 5 minutes before recording. The two hind paws were placed on two independent platforms, and the force exerted by each hind paw was measured (in grams). Three replicates were performed for each hind paw and each animal. The weight ratio between the left hind paw and the right hind paw was calculated.
[0260] It should be noted that in the SNL- and CFA-rat models used in all experiments, the left hind paw was injured.
[0261] Von Frey, Randall-Selitto, RGS, and SWB tests were performed on 6 to 9 animals in each experimental condition.
[0262] Statistical Analysis. For RGS and SWB experiments, statistical analyses were performed using unpaired Student's t-test or one-way analysis of variance (ANOVA) followed by Bonferroni post hoc tests. For behavioral studies, group and time effects were verified by two-way ANOVA with repeated measures using Von Frey and Randall-Selitto tests. When ANOVA showed a significant effect, the Bonferroni post hoc test was used to determine the significance of the difference. P values < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and p < 0.0001 (****) were considered statistically significant. All data are presented as mean ± standard error.
[0263] Study Approval. All animal experiments were approved by the French Ministry of Research (authorizations #17923 and #32862) and performed according to the guidelines of the International Association for the Study of Pain (IASP).
[0264] result:
[0265] Intravenously injected 2'-MOE-modified FXYD2-LASO-Gapmer provides sustained pain relief in neuropathic and inflammatory pain models.
[0266] Although highly effective, FXYD2-LASO-based treatments require long-term daily intrathecal injections, which may represent an obstacle to their routine use in clinical practice. To circumvent this potential problem, we tested whether 2'-O-2-methoxyethyl chemical modification, known to significantly increase the metabolic stability of ASOs and the binding affinity of ASOs to their target mRNA sequences, might be advantageous. We thus synthesized 2'-O-2-methoxyethyl-modified FXYD2-LASOs (hereinafter referred to as FXYD2-LASO-Gapmers) and injected them intravenously, a less invasive route of administration. We then evaluated their efficacy in rat models of chronic neuropathic (SNL) or inflammatory (CFA) pain.
[0267] We evaluated the in vivo effects of daily intravenous injections of 40 mg / kg FXYD2-LASO-Gapmer in SNL- and CFA-rats. In both models, we found that 15 daily injections were initially required to achieve complete pain relief ( Figure 1A , B). However, it is noteworthy that the analgesic effect persisted for 9 days after treatment was discontinued. To optimize the dose to maintain effective and long-lasting analgesia, single intravenous injections of FXYD2-LASO-gapmer were subsequently administered every 9 to 10 days, initially at 20 mg / kg, then 15 mg / kg, then 10 mg / kg, then 5 mg / kg, and finally again at 20 mg / kg.
[0268] By doing this, we determined that a single injection of a 20 mg / kg dose was effective in maintaining analgesia for up to 9 days, similar to the effect of 40 mg / ml. Single doses of 15 mg / kg or 10 mg / kg were also able to maintain analgesia, but were slightly less effective and for a shorter duration than 40 mg / kg or 20 mg / kg. In contrast, a dose of 5 mg / kg was less effective, and the treated animals quickly developed pain hypersensitivity similar to that of the control group. Furthermore, when recovery of hypersensitivity to mechanical stimulation was observed, the analgesic effect was restored after only 3 injections of FXYD2-LASO-Gapmer treatment. Therefore, a single injection of FXYD2-LASO-Gapmer at a minimum of 20 mg / kg every 9 days is sufficient and most efficient to maintain analgesia for very long periods of time ( Figure 1A , B).
[0269] Finally, we evaluated the in vivo effects of daily intravenous injections of 20 mg / kg of FXYD2-LASO-Gapmer in SNL rats and confirmed that 15 daily injections were initially required to achieve complete pain relief ( Figure 1A' and A", days 5 to 19). The analgesic effect was maintained for 8 days after cessation of treatment. Therefore, we determined that a single injection of 20 mg / kg during the second phase of treatment was effective in maintaining analgesia for 8 days.
[0270] Taken together, these data allow us to establish an effective and minimally invasive approach to treating chronic pain symptoms using intravenous FXYD2-LASO-Gapmer, which consists of a two-phase regimen: a first phase with daily intravenous infusions of FXYD2-LASO-Gapmer until complete analgesia is achieved, followed by a second phase with more spaced injections to maintain the analgesic effect over time.
[0271] Classic behavioral tests, widely used in the aforementioned experiments, were designed to assess evoked pain. We also tested whether our treatment had a positive effect on spontaneous pain by monitoring changes in the rats' pain expression using the Rat Grief Scale (RGS) (Figure 1C, C') and assessing hindpaw weight distribution using the static weight bearing (SWB) test (Figure 1D, D'). As expected, the naive group showed no signs of spontaneous pain (score 0; Figure 1C, C'), whereas the RGS scores of the SNL and CFA groups treated with the control-LASO-Gapmer were significantly increased (scores of 0.75 for both groups; Figure 1C, C'). In contrast, the RGS scores of the SNL or CFA rat groups treated with the FXYD2-LASO-Gapmer were significantly decreased (scores of 0.25 for both groups; Figure 1C, C'). This suggests that intravenous administration of FXYD2-LASO-Gapmer can also alleviate spontaneous pain. In the SWB test, the pressure applied by each hind paw was recorded, and the weight balance was assessed by calculating the ratio between the left and right hind paws. As expected, these ratios of the natural group rats were close to 1.0, reflecting the balanced distribution of weight on the two hind paws (Figure 1D, D'). In contrast, in the SNL or CFA rat groups treated with control-LASO-Gapmer (left hind paw damaged), this ratio was significantly reduced (0.41 and 0.49, respectively; Figure 1D, D'). It is worth noting that this ratio in the SNL or CFA rat groups treated with FXYD2-LASO-Gapmer was significantly higher than that of the control-LASO-Gapmer (0.60 and 0.72, respectively; Figure 1D, D'), although it did not reach the level of the natural group. These results indicate that intravenous injection of FXYD2-LASO-Gapmer significantly alleviated the spontaneous pain symptoms of rats with neuropathic pain and inflammatory pain.
[0272] Overall, these data demonstrate the long-term advantages of using FXYD2-LASO-Gapmer for the treatment of neuropathic or inflammatory pain in a treatment regimen consisting of daily intravenous injections of the molecule for 15 days, followed by single injections every 8 days, which may be readily applicable to human patients.
[0273] References:
[0274] Throughout this application, various references are cited to describe the state of the art to which this invention pertains. The disclosures of these references are incorporated herein by reference.
[0275] 1.SHKim and JMChung,An experimental model for peripheralneuropathy produced by segmental spinal nerve ligation in the rat.Pain 50,355-363(1992).
[0276] 2. J. Ferreira, MM Campos, JBPesquero, RCAraujo, M. Bader, JBCalixto, Evidence for the participation of kinins in Freund's adjuvant-inducedinflammatory and nociceptive responses in kinin Bl and B2 receptor knockoutmice. Neuropharmacology 41, 1006-12 (2001).
[0277] 3. A. Gissot, C. Di Primo, I. Bestel, G. Giannone, H. Chapuis, P. Barthelemy, Sensitive liposomes encoded with oligonucleotide amphiphiles: a biocompatibleswitch. Chem. Commun. 43, 5550-5552 (2008).
[0278] 4.S.Venteo,S.Laffray,C.Wetzel,C.Rivat,F.Scamps,I.Mechaly,L.Bauchet,C.Raoul,E.Bourinet,G.R.Lewin,P.Carroll,A.Pattyn,Fxyd2 regulates A6-and C-fiber mechanosensitivity and is required for the maintenance of neuropathicpain.Sci.Rep.6,36407(2016).
[0279] 5.C.Rivat,E.Laboureyras,J.P.Laulin,C.Le Roy,P.Richebe,G.Simonnet,Nonnociceptive environmental stress induces hyperalgesia,not analgesia,inpain and opioid-experienced rats.Neuropsychopharmacology 32,2217-28(2007).
[0280] 6.S.G.Sotocinal,R.E.Sorge,A.Zaloum,A.H.Tuttle,L.J.Martin,J.S.Wieskopf,J.C.Mappiebeck,P.Wei,S.Zhan,S.Zhang,J.J.McDougall,O.D.King,J.S.Mogil,The Rat Grimace Scale:a partially automated method for quantifyingpain in the laboratory rat via facial expressions.Mol Pain.7,55(2011).
Claims
1. An antisense oligonucleotide targeting FXYD2 for use in treating pain, wherein the antisense oligonucleotide is administered intravenously. 2 . The antisense oligonucleotide for use according to claim 1 , wherein the antisense oligonucleotide comprises a 2′-O-methoxyethyl group (2′-MOE).
3. The antisense oligonucleotide for use according to claim 1, wherein the antisense oligonucleotide is a lipid-conjugated antisense oligonucleotide (LASO).
4. The antisense oligonucleotide according to claim 1 , comprising or consisting of the following sequence: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:
39. 5 . The antisense oligonucleotide for use according to claim 1 , wherein the pain is neuropathic pain, diabetic pain, chemotherapy pain, inflammatory pain, postoperative pain and / or chronic postoperative pain.
6. A pharmaceutical composition comprising the antisense oligonucleotide according to claims 1-5.
7. The pharmaceutical composition according to claim 6, for use in treating pain.
8. The pharmaceutical composition for use according to claim 7, wherein the pain is neuropathic pain, diabetic pain, chemotherapy pain, inflammatory pain, postoperative pain and / or chronic postoperative pain.
9. A method for treating pain, comprising the step of intravenously administering a therapeutically effective amount of an antisense oligonucleotide targeting FXYD2 to a subject in need thereof.
Citation Information
Patent Citations
Electric water heater with pulsed electronic control and detection
US20020125241A1
Novel nucleoside and oligonucleotide analogues
US20020147332A1
Novel bicyclonucleoside and oligonucleotide analogue
US20030105309A1
Therapeutic uses of LNA-modified oligonucleotides in infectious diseases
US20030125241A1
Valve
US20040244840A1