Human parainfluenza virus recombinant multi-genotype chimeric antigen and application thereof

Abstract

The invention relates to a human parainfluenza virus recombinant multi-genotype chimeric antigen with large expression quantity, good solubility and natural conformation, which is characterized in that a plurality of immunodominant epitope regions which are not in cross reaction with other pathogens are subjected to chimeric expression with fusion protein and are mutually spaced through connecting peptides, and when the human parainfluenza virus recombinant multi-genotype chimeric antigen is used for immunodetection of a parainfluenza virus antibody by ELISA (enzyme-linked immuno sorbent assay) or chromatography, the human parainfluenza virus recombinant multi-genotype chimeric antigen can be used for immunodetection of a parainfluenza virus antibody. The sensitivity and the specificity of the existing kit can be improved.

Description

Technical Field

[0001] The present invention relates to the field of immunoassays, and more particularly to a human parainfluenza virus recombinant multi-genotypic chimeric antigen, a gene sequence encoding the human parainfluenza virus recombinant multi-genotypic chimeric antigen, a plasmid, a host cell containing the plasmid, a human parainfluenza virus antibody detection kit prepared from the human parainfluenza virus recombinant multi-genotypic chimeric antigen, and the use of the human parainfluenza virus recombinant multi-genotypic chimeric antigen in detecting human parainfluenza virus infection. Background Art

[0002] Human parainfluenza viruses (HPIVs) are a significant cause of respiratory illness in children and adults, presenting with a wide range of clinical manifestations, including colds, croup, bronchiolitis, and pneumonia. Seasonal HPIV epidemics impose a significant burden on children, accounting for 40% of pediatric hospitalizations for lower respiratory tract illnesses (LRTIs) and 75% of laryngitis cases. HPIVs cause approximately 30,000 pediatric hospitalizations annually in the United States, with the majority occurring in children under two years of age, making them one of the most burdensome viral diseases.

[0003] HPIV is divided into types 1-4, with type 4 being divided into subtypes HPIV4a and HPIV4b. HPIV1 and HPIV3 belong to the genus Respirovirus, while HPIV2 and HPIV4 belong to the genus Rubellavirus. According to research data, between July 2011 and June 2019, 288 laboratories in the United States reported parainfluenza virus testing, covering 49 states. Among the reported HPIV-positive individuals, the percentage of infection for each type was as follows: HPIV-1: 18%; HPIV-2: 14%; HPIV-3: 55%; and HPIV-4: 13%.

[0004] Among the four serotypes, HPIV-3 infection has the highest prevalence, peaking in spring and summer. Epidemics of HPIV-1 and HPIV-2 infection typically occur in autumn, a biennial year.

[0005] Human parainfluenza viruses cause respiratory illness in children, and four types have different clinical manifestations. HPIV1 and HPIV2 commonly cause croup, while HPIV3 is the most frequently circulated type worldwide and generally causes more severe illness than HPIV1 or HPIV2, such as bronchitis, bronchiolitis, and pneumonia. Because of the difficulty in isolating the virus, HPIV4 is not included in the panels that laboratories use to test for respiratory viruses in nasopharyngeal swabs, nasopharyngeal aspirates, or other specimens.

[0006] Currently, the following methods are available for HPIV testing:

[0007] 1. Virus isolation. For many years, this was considered the gold standard for diagnosis. However, due to its low efficiency and high false negative rate, it is not suitable for clinical diagnosis and is only used for monitoring by CDCs. It also requires high technical requirements, is easily inactivated during transportation, and has low yields. Furthermore, HPIV4 is extremely difficult to culture.

[0008] 2. Molecular diagnosis. Polymerase chain reaction (PCR) is increasingly being used, with higher sensitivity than viral culture or antigen testing. However, its disadvantage is that it is not widely applicable as a simple and easy-to-use technology, and compared with antigen testing, it takes longer to obtain results. Multiplex PCR testing has the advantages of high sensitivity, high specificity, high efficiency, and the ability to detect multiple pathogens simultaneously. However, caution is warranted regarding the decreased sensitivity when using multiplex PCR, which can result in the failure to detect certain HPIV subtypes. Rapid testing is not easy to achieve. Extraction procedures and primer definitions lack standardization, making false negatives more likely.

[0009] 3. Serological testing: divided into antigen testing and antibody testing.

[0010] 3.1 Antigen Detection. Antigen detection always tests the specificity or broad spectrum of antibody recognition. There is some cross-reactivity between different HPIV serotypes, but developing broad-spectrum antibodies that recognize all four serotypes is technically challenging. Currently, no antigen detection reagents are commercially available.

[0011] 3.2 Antibody Testing. Sequential testing of two serum samples for IgG-specific antibodies reveals a significant increase during the acute recovery phase; testing of a single serum sample for IgM-specific antibodies confirms infection if positive. Currently, serological antibody testing can serve as a diagnostic tool. If paired serum samples from the acute and recovery phases are tested simultaneously, a fourfold increase or decrease in titer is generally considered indicative of acute infection.

[0012] In serological testing, HPIVs can be divided into four serotypes, HPIV1-HPIV4, based on their serological and genomic characteristics. HPIV4 can be further divided into two serotypes, 4a and 4b, based on antigenic differences revealed by hemagglutination inhibition tests and monoclonal antibody reactions. Among the HPIV antigens, the nucleoprotein (N protein) is the most conserved. However, according to reports, there is some crossover between the N proteins of types 1 and 3, while there is no antibody crossover between the N proteins of types 2 and 4. This is also reflected in the comparison of protein amino acid sequence homology, with 60% homology between types 1 and 3 and only 40% between types 2 and 4. This means that one HPIV type antigen cannot detect the other three types. Therefore, separate antigens must be prepared for each type.

[0013] Since the convenient and rapid detection of human parainfluenza virus antibodies requires the batch preparation of high-quality human parainfluenza virus antigens, there are several types of antigens currently prepared by existing technologies:

[0014] 1. Parainfluenza virus culture and its lysate extract: According to the inventors' investigation, the main commercial human parainfluenza virus antigens described in the following table are mostly natural antigens, which have the disadvantages of complex composition, large batch-to-batch difference, and high false positive rate. Most importantly, they all lack type 4 antigen, which can lead to false negatives for type 4 virus infection.

[0015]

[0016]

[0017] 2. Recombinant antigen: Recombinant antigens of four types need to be prepared simultaneously. They can be expressed individually or chimerically. Previous studies are not much, but the performance of the antigens is not good. For example, the article "Synthesis of recombinant human parainfluenza virus 1 and 3 nucleocapsid proteins in yeast Saccharomyces cerevisiae, 2008" mentioned full-length antigens, but it contains a large number of non-epitope regions and hydrophobic regions, which affect the overall expression amount and solubility, and can easily cause false positives during detection. Moreover, only types 1 and 3 were tested, and types 2 and 4 were lacking. The article "Development and evaluation of two truncated recombinant NP antigen-based indirect ELISAs for detection of bovine parainfluenza, 2015" mentioned that the diagnostic performance of the NP protein of bovine PIV was acceptable, but the article "Identification of three antigen epitopes on the nucleocapsid protein of the genotype C of bovine parainfluenza virus type 3, 2015" pointed out that there were fundamental differences in the C-terminal epitopes of bovine and human PIV, which cannot be used as a reference for preparing human parainfluenza antigens.

[0018] Therefore, it is necessary to develop and prepare human parainfluenza virus genetic engineering recombinant antigens with high expression, good solubility, and excellent sensitivity and specificity in conformation, which can be used for ELISA or chromatographic detection of human parainfluenza virus antibodies. SUMMARY

[0019] The first objective of the present invention is to provide a recombinant human parainfluenza virus (HPIV) multi-genotype chimeric antigen with high expression levels, good solubility, and native conformation, having the amino acid sequence set forth in SEQ ID NO: 5. This chimeric antigen utilizes multiple immunodominant epitope regions that do not cross-react with other pathogens and are expressed in a fusion protein separated by connecting peptides. When used in ELISA or chromatographic immunoassays for the detection of antibodies to human parainfluenza virus, it can improve the sensitivity and specificity of existing kits.

[0020] The second object of the present invention is to provide a gene encoding a human parainfluenza virus recombinant HPIV multi-genotype chimeric antigen, which has a nucleotide sequence shown in SEQ ID NO: 6.

[0021] The third object of the present invention is to provide a plasmid containing a gene sequence encoding a recombinant HPIV multi-genotype chimeric antigen of human parainfluenza virus.

[0022] The fourth object of the present invention is to provide a host cell transformed / transfected with an expression plasmid encoding a human parainfluenza virus recombinant HPIV multi-genotype chimeric antigen gene sequence.

[0023] The fifth object of the present invention is to provide a human parainfluenza virus HPIV antibody detection kit prepared from human parainfluenza virus recombinant multi-genotype chimeric antigens.

[0024] The sixth object of the present invention is to provide the use of recombinant multi-genotype chimeric antigens of human parainfluenza virus in detecting human parainfluenza virus HPIV infection.

[0025] The inventors have invented a human parainfluenza virus recombinant multi-genotype chimeric antigen HPIV Chimer, which has an amino acid sequence shown in SEQ ID NO:5.

[0026] Human parainfluenza virus antigens are divided into four serotypes: HPIV1-HPIV4. Due to the significant differences in amino acid sequence homology between the different types, using only one HPIV type antigen is not enough to detect the other three types. Therefore, separate antigens for each HPIV1-HPIV4 type are prepared.

[0027] Most HPIV antigens currently on the market are natural antigens, which have the disadvantages of complex composition, large batch-to-batch variability, and high false-positive rates. Most importantly, they all lack type 4 antigens, which can cause kits to miss type 4 virus infections. Some literature mentions using full-length antigens from types 1 or 3, but these contain numerous non-epitope and hydrophobic regions, which affect overall expression and solubility, making them prone to false-positive results. Furthermore, only types 1 and 3 are tested, with types 2 and 4 lacking.

[0028] Through innovative analysis, the inventors believe that the immunodominant epitope regions of the most conserved protein (nucleoprotein N) of different HPIV types can be chimerized to produce recombinant HPIV multi-genotypic chimeric antigens. Using computer software to predict sequence solubility, hydrophilicity, and surface accessibility, they selected potential dominant epitope regions, resulting in four dominant segments: HPIV1c, HPIV2c, HPIV3c, and HPIV4c. These were then chimerized to form a single HPIV multi-genotypic chimeric antigen, HPIVChimer.

[0029] The inventors found that the HPIV multi-genotype chimeric antigen HPIVChimer has good sensitivity and specificity when used in an ELISA platform or a chromatography platform to detect IgG and IgM compared with the control product.

[0030] Since the nucleoprotein (N protein) of PIV is its main immunogen, patients infected with PIV will produce highly specific antibodies to the N protein, so we focus on the N protein. First, we analyze the sequence homology of the N protein of the four serotypes HPIV1-HPIV4 and find that the homology between the four types is between 20-60%. Figure 1 As shown, the homology within each of the four types is over 92%. Due to the high degree of sequence homology within each type, a single sequence from the N protein of each type can be selected as an antigen.

[0031] First, parainfluenza virus sequences were searched on NCBI using UniProtKB / Swiss-Prot numbers: The published sequence numbers P24304, P21737, P06159, and P17241 were used to screen candidate recombinantly expressed epitope regions for the nucleoprotein ORF sequences of parainfluenza virus types 1, 2, 3, and 4. Computer software was used to predict sequence solubility, hydrophilicity, and surface accessibility to select potential dominant epitope regions. Specifically, the DNAStar software package's Protean component was used to predict antigenicity, hydrophilicity, and surface accessibility; and the Protein-Sol prediction website (https: / / protein-sol.manchester.ac.uk / ) was used to predict sequence solubility. The predicted dominant epitope regions for each of the four types are located at the C-terminus of their respective ORFs, as shown in SEQ ID NOs: 1-4.

[0032] The protein sequences SEQ ID NOs: 1-4 were joined end to end, with a GGS linker added in between, to create the chimeric antigen HPIV Chimer (protein) sequence shown in SEQ ID NO: 5. Codon-optimized synthesis was performed, and appropriate restriction sites were added at both ends. The synthesized gene was loaded into a plasmid vector for subsequent subcloning. Other methods can also be employed, such as designing gene primers corresponding to these four protein segments and amplifying their ORF genes using genomic DNA from HPIV1-4 as a template through PCR.

[0033] The HPIV multi-genotype chimeric antigen gene is digested with enzymes and subjected to agarose gel electrophoresis to recover the target gene band. The target gene band is then ligated into a suitable expression vector, and positive clones are identified using PCR, enzyme digestion, or sequencing. Numerous expression vectors are well known. In this embodiment, pcDNA3.4-TOPO is used as the starting vector, but other vectors not listed are also feasible.

[0034] The successfully subcloned plasmid is introduced (transformed / transfected) into a host cell for expression. This host can be prokaryotic or eukaryotic, such as E. coli, yeast, human, or HEK cells. To increase expression, the gene can be codon-optimized prior to gene synthesis.

[0035] Transform / transfect the plasmid into expression host cells, culture and induce them, and then harvest the cells at the appropriate time. Purify the plasmid using affinity chromatography using the vector's His tag, or use other methods such as ion exchange.

[0036] Through the above operations, the four types of HPIV immunodominant epitope segments were connected to a plasmid and concatenated into a pcDNA-HPIVChimer clone, followed by transformation / transfection and purification operations to obtain the HPIV multi-genotype chimeric antigen HPIVChimer. The purified recombinant protein was labeled with colloidal gold and assembled into test strips, and the reactivity to the sera of infected and normal people was detected by chromatography.

[0037] The HPIV multi-genotype chimeric antigen HPIVChimer is used in the chromatography platform to detect IgG antibodies and IgM antibodies, and can detect the vast majority of positive sera, with good sensitivity and specificity compared with the control product.

[0038] The beneficial effects of the present invention are as follows: the recombinant multi-genotype chimeric antigen of human parainfluenza virus of the present invention is expressed by fusion protein of the dominant epitope region of four different types of HPIV N proteins that do not cross-react with other pathogens. The selected segments are highly hydrophilic and separated from each other by connecting peptides, resulting in a large expression level. In addition, the use of the excellent fusion protein Sumo can improve the expression level and solubility. The overall protein has good solubility and a natural conformation. It has higher sensitivity than a single type and can simultaneously detect HPIV types 1-4 infections. It also has very low homology with protein sequences of other species, thus avoiding false positives caused by cross-reactions. The use of connecting peptides to separate different peptide segments is beneficial to Ni column affinity chromatography purification, exposure of each epitope and full binding to antibodies. The HEK expression system is used, which has better activity than synthetic peptides or prokaryotic expression of antigens. It is used for chromatography to detect IgG and IgM antibodies, which is simple and rapid, with good overall sensitivity and specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 : Amino acid homology of N protein between HPIV1-4;

[0040] Figure 2 : Amino acid homology of HPIV1 internal N protein;

[0041] Figure 3 : Amino acid homology of HPIV2 internal N protein;

[0042] Figure 4 : Amino acid homology of HPIV3 internal N protein;

[0043] Figure 5 : Amino acid homology of HPIV4 internal N protein. DETAILED DESCRIPTION

[0044] The objects, features and advantages of the present invention will be further described in detail with reference to the accompanying drawings in conjunction with the examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are generally performed under conventional conditions, such as: Sambrook et al., Molecular Cloning Laboratory Manual (NewYork: Cold Spring Harbor Laboratory Press, 0989); Modern Molecular Biology Experimental Techniques (Second Edition) (Edited by Lu Shengdong); Protein Purification and Identification Guide, Cold Spring Harbor; Clinical Enzyme Immunoassay Technology, Edited by Li Jinming, People's Military Medical Publishing House, 2005; Colloidal Gold Immunochromatographic Diagnostic Test Paper Technology (Third Edition), or the standard methods recommended by the manufacturer. Practical Example 1: Preparation of HPIV recombinant multi-genotype antigens

[0045] First, check the parainfluenza virus sequence on NCBI, with UniProtKB / Swiss-Prot number: P24304, P21737, P06159, P17241 parainfluenza virus 1, 2, 3, 4 type nucleoprotein ORF sequence candidate recombinant expression epitope region screening. The specific method is: using DNAStar software package Protean component to predict antigenicity, hydrophilicity, surface accessibility; Using Protein-Sol prediction website https: / / protein-sol.manchester.ac.uk / to predict sequence solubility. The predicted four type dominant epitope regions are all at the C terminal of the respective ORF, as shown in the sequences SEQ ID NO: 1-4.

[0046] The protein sequences SEQ ID NO: 1-4 are connected head to tail, with a GGS connecting peptide in the middle, designed into a chimeric antigen HPIVChimer (protein) sequence as shown in SEQ ID NO: 5, entrusted to Shanghai Sangon Biotech Co., Ltd. to optimize and synthesize the HPIVChimer (nucleic acid) sequence as shown in SEQ ID NO: 6, which has an EcoRI enzyme cutting site at the N terminal and a BamHI enzyme cutting site at the C terminal, finally loaded on a puc57 vector and delivered to me. Named: puc57-HPIVChimer.

[0047] To transform the pcDNA3.4 vector with Sumo fusion protein, a gene named Kozak+IgG SP-Sumo was synthesized. The sequence is shown in SEQ ID NO: 25, which contains a promoter, a signal peptide, and an enzyme cleavage site: TCTAGAGGATCGAACCCTTCCCTTAAGCCCCCCGCCGCCACCATGGGGTGGAGCTGCATCATCCTGTTCCTGGTGGCCACCGCCACAGGCGTGCACTCCGGTACCGGCGGCATGTCGGACTCAGAAGTCAATCAAGAAGCTAAGCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGATCTTCAGAAATCTTCTTCAAGATCAAAAAGACCACTCCTTT The above Kozak+IgG SP-Sumo sequence was synthesized by Shanghai Sangon Biotechnology Co., Ltd. and the obtained gene was inserted into the plasmid puc57 vector. Subsequently, puc57-Kozak+IgG SP-Sumo was double-digested with XbaI and HindIII, and the target gene fragment was recovered by gel extraction and ligated into the plasmid vector pcDNA3.4-TOPO that had also been double-digested with XbaI and HindIII. The ligation product was transformed into the DH5α strain, and single clones that were positive by PCR were selected for sequencing verification. The transformed plasmid vector was named pcDNA-SM.

[0048] The plasmid puc57-HPIVChimer was then double-digested with EcoRI and BamHI, and the target gene fragment was recovered by gel extraction and ligated into the plasmid vector pcDNA-SM that had also been double-digested with EcoRI and BamHI. The ligation product was transformed into the DH5α strain, and single clones that were positive by PCR were selected for sequencing verification to obtain the expression plasmid pcDNA-SM-HPIVChimer.

[0049] DH5α bacteria transformed with the pcDNA-SM-HPIVChimer plasmid were inoculated into 200 ml of LB medium and cultured overnight at 37°C and 220 rpm. The bacteria were collected by centrifugation and the plasmid was prepared in large quantities using an endotoxin-free plasmid extraction kit (OMEGA, Cat. No. D6926-03) for subsequent transfection. 500 ml of HEK-293 cells were pre-cultured to the logarithmic growth phase at a density of approximately 2-7 × 10 6 cells / ml) and the survival rate was greater than 98%, the Zhuhai Kairui KOP293 transient transfection protein expression system was used for transfection, and the PEI / pcDNA-SM-HPIVChimer transfection reagent / plasmid mixture was transfected. The detailed steps are in its user guide (version 4.0) and will not be repeated here. After transfection, expression enhancer was added at 24 h, and cell density and viability were counted every day starting from 72 h. When the viability was about 70%, cells were collected and centrifuged at 5000 rpm. The supernatant was collected and purified by affinity chromatography using Ni-NTA Magarose Beads (Cat. No.: SM02505) from Tiandirenhe Biotechnology Co., Ltd. Elution was performed with 20 mM PB pH 7.2, 500 mM NaCl, and 300 mM imidazole. The eluate was dialyzed into 20 mM PBS pH 7.2, and its purity was determined to be about 95% by SDS-PAGE electrophoresis. The protein concentration was determined using the BCA kit (Cat. No.: PC0020) from Beijing Soleb Biotechnology Co., Ltd., and 60 mg of the target protein was finally obtained. This recombinant chimeric protein was named HPIVChimer antigen.

[0050] Example 2 HPIV multi-genotype chimeric antigen detection IgG

[0051] (1) Preparation of colloidal gold: Add 100 ml of ultrapure water to a conical flask and heat to boiling on a magnetic heating stirrer. Add 1 ml of 1% chloroauric acid (Sigma-Aldrich, Catalog No.: 16961-25-4) solution. Immediately after boiling, add 1 ml of 1% trisodium citrate (Sigma-Aldrich, Catalog No.: 6132-04-3) aqueous solution. Continue boiling for 10 minutes and then cool naturally.

[0052] (2) Colloidal gold labeling: Take 10 ml of the above colloidal gold and put it into a beaker. Add 0.1 M K2CO3 to adjust the pH to 7.0 while stirring, and continue stirring for 5 minutes; add a certain amount of HPIV Chimer antigen and chicken IgY antibody, and continue stirring for 15-30 minutes; add 0.1 ml of 10% BSA, and continue stirring for 15-30 minutes; centrifuge at 8000 g for 59 minutes, discard the supernatant, and resuspend the precipitate with colloidal gold diluent (20 mM PB, 250 mM NaCl, 2% BSA, 1% Sucrose, 0.01% Proclin300), adjust the volume to 1 ml, mix thoroughly, and store at 4 degrees.

[0053] (3) Preparation of gold label pad: dilute the gold label compound 10 times with colloidal gold diluent and soak it in glass fiber (Watman Company). Bake at 37 degrees for 2 hours to make the gold label pad. Dry and seal it for future use.

[0054] (4) Nitrocellulose (NC) membrane coating: dilute anti-human IgG to 1 mg / ml with a test line diluent (10 mM PBS + 2% sucrose) to prepare a test line working solution, and dilute goat anti-IgY polyclonal antibody to 0.5 mg / ml with the same diluent to prepare a control line working solution. Use a membrane spotter to draw these two working solutions onto the corresponding positions of a nitrocellulose membrane (Millipore, catalog number: HF135002) and dry at 37 degrees for 8 hours.

[0055] (5) The gold label pad, the coated nitrocellulose membrane, absorbent paper, polyester plate, sample pad and other auxiliary materials are assembled into a parainfluenza negative / positive gold label detection kit.

[0056] (6) Detection method: Add 100ul of the sample to be tested (e.g. serum) to the sample pad and place it at room temperature for 5 minutes. Then determine the result. The determination criteria are as follows:

[0057] ① Only one band appears in the quality control area, and no band appears in the test area, which is negative (-);

[0058] ② Two bands appear, one in the quality control area and the other in the test area, indicating positive (+);

[0059] ③ If no band appears in the quality control area, it indicates incorrect operation or the test card has deteriorated and damaged. In this case, you should read the instructions again carefully and retest with a new test strip.

[0060] The results are shown in Table 2

[0061]

[0062] It can be seen that the immunochromatographic test strip prepared by the HPIV multi-genotype chimeric antigen HPIVChimer of the present invention has high sensitivity, good specificity and excellent performance in detecting IgG antibodies, and can replace the HPIV antigen in the existing test kit.

[0063] Example 3 HPIV multi-genotype chimeric antigen detection IgM

[0064] (1) Preparation of colloidal gold: Add 100 ml of ultrapure water to a conical flask and heat to boiling on a magnetic heating stirrer. Add 1 ml of 1% chloroauric acid (Sigma-Aldrich, Catalog No.: 16961-25-4) solution. Immediately after boiling, add 1 ml of 1% trisodium citrate (Sigma-Aldrich, Catalog No.: 6132-04-3) aqueous solution. Continue boiling for 10 minutes and then cool naturally.

[0065] (2) Colloidal gold labeling: Take 10 ml of the above colloidal gold and put it into a beaker. Add 0.1 M K2CO3 to adjust the pH to 7.0 while stirring, and continue stirring for 5 minutes; add a certain amount of HPIV Chimer antigen and chicken IgY antibody, and continue stirring for 15-30 minutes; add 0.1 ml of 10% BSA, and continue stirring for 15-30 minutes; centrifuge at 8000 g for 59 minutes, discard the supernatant, and resuspend the precipitate with colloidal gold diluent (20 mM PB, 250 mM NaCl, 2% BSA, 1% Sucrose, 0.01% Proclin300), adjust the volume to 1 ml, mix thoroughly, and store at 4 degrees.

[0066] (3) Preparation of gold label pad: dilute the gold label compound 10 times with colloidal gold diluent and soak it in glass fiber (Watman Company). Bake at 37 degrees for 2 hours to make the gold label pad. Dry and seal it for future use.

[0067] (4) Nitrocellulose (NC) membrane coating: dilute anti-human IgM to 1 mg / ml with a test line diluent (10 mM PBS + 2% sucrose) to prepare a test line working solution, and dilute goat anti-IgY polyclonal antibody to 0.5 mg / ml with the same diluent to prepare a control line working solution. Use a membrane spotter to draw these two working solutions onto the corresponding positions of a nitrocellulose membrane (Millipore, catalog number: HF135002) and dry at 37 degrees for 8 hours.

[0068] (5) The gold label pad, the coated nitrocellulose membrane, absorbent paper, polyester plate, sample pad and other auxiliary materials are assembled into a parainfluenza negative / positive gold label detection kit.

[0069] (6) Detection method: Add 100ul of the sample to be tested (e.g. serum) to the sample pad and place it at room temperature for 5 minutes. Then determine the result. The determination criteria are as follows:

[0070] ① Only one band appears in the quality control area, and no band appears in the test area, which is negative (-);

[0071] ② Two bands appear, one in the quality control area and the other in the test area, indicating positive (+);

[0072] ③ If no band appears in the quality control area, it indicates incorrect operation or the test card has deteriorated and damaged. In this case, you should read the instructions again carefully and retest with a new test strip.

[0073] The results are shown in Table 3.

[0074]

[0075] It can be seen that the immunochromatographic test strip prepared by the HPIV multi-genotype chimeric antigen HPIVChimer of the present invention has high sensitivity, good specificity and excellent performance in detecting IgM antibodies, and can replace the HPIV antigen in the existing test kit.

[0076] The embodiments of the present invention are diverse, and each embodiment has a large amount of experimental data, which is not suitable to be listed one by one in the present invention. Various changes and improvements made by technicians in this technical field without departing from the principles of the present invention should be included in the claims of the present invention.

Claims

1. A recombinant multi-genotype chimeric antigen of human parainfluenza virus, characterized in that A or B: A. having the amino acid sequence shown in SEQ ID NO: 5; B. a protein derived from the amino acid sequence in A by substitution, deletion or addition of one or several amino acid residues without changing its hydrophilicity.

2. A gene sequence encoding a recombinant multi-genotype chimeric antigen of human parainfluenza virus according to claim 1, characterized in that: The polypeptide has the nucleotide sequence shown in SEQ ID NO:

6.

3. A plasmid, characterized in that: A plasmid containing a gene sequence encoding a recombinant multi-genotype chimeric antigen of human parainfluenza virus according to claim 1.

4. A host cell, characterized in that: A host cell containing the plasmid according to claim 4.

5. A human parainfluenza virus antibody detection kit prepared using the human parainfluenza virus recombinant multi-genotype chimeric antigen as described in claim 1.

6. Use of the human parainfluenza virus recombinant multi-genotype chimeric antigen according to claim 1 in detecting human parainfluenza virus infection.

Images