Self-assembled ferritin nano antigen particle and application thereof in preparation of duck hepatitis A vaccine

By self-assembling ferritin nanoparticles carrying a fusion protein of VP1 protein, a duck hepatitis A vaccine was prepared using a eukaryotic expression system, which solved the problem of poor vaccine efficacy caused by differences in VP1 protein and achieved safe, efficient large-scale production and broad-spectrum immunization.

CN120757667AActive Publication Date: 2025-10-10THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI

Patent Information

Application Number
CN202511241797.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-02
Publication Date
2025-10-10
Estimated Expiration
2045-09-02

AI Technical Summary

Technical Problem

Existing duck hepatitis A virus vaccines mainly rely on VP1 protein, but there are differences in VP1 proteins among different strains, resulting in poor vaccine effectiveness. In addition, traditional live attenuated vaccines are complex and unsafe to operate.

Method used

Self-assembled ferritin nanoparticles are used to carry a fusion protein of duck hepatitis A virus VP1 protein, and the vaccine is prepared through a silkworm or insect cell eukaryotic expression system. Amino acid mutation is used to optimize the immune titer, and the vaccine is mixed with a medical adjuvant to prepare the vaccine.

Benefits of technology

The prepared vaccine induces a broad-spectrum antibody response, is safe and simple to operate, is suitable for large-scale production, and significantly improves the prevention and treatment effect of duck hepatitis A.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120757667A_ABST
    Figure CN120757667A_ABST
Patent Text Reader

Abstract

The invention discloses a self-assembled ferritin nano antigen particle and application thereof in preparation of a duck hepatitis A vaccine. The VP1 part in the duck hepatitis A virus P1 protein is connected with the N end of a self-assembled ferritin nanoparticle subunit through a connecting sequence to obtain the fusion protein, and the amino acid sequence of the fusion protein is shown as SEQ ID NO.1; in order to improve the expression quantity or expression efficiency of the fusion protein in bombyx mori, a nucleotide sequence of a coding gene of the fusion protein is optimized and modified according to the codon preference of bombyx mori, and an optimized gene sequence with the nucleotide sequence shown as SEQ ID NO.2 is obtained; the fusion protein is subjected to single-site or multi-site mutation, the mutant with obviously improved titer is obtained through screening, and the soluble expression quantity of the mutant is obviously improved. According to the invention, a silkworm or insect cell eukaryotic expression system is used for expressing recombinant protein, and an expression product causes a neutralizing anti-duck hepatitis A virus antibody.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to self-assembled ferritin nanoantigen particles, in particular to nanoantigen particles containing a fusion protein formed by fusing duck hepatitis A virus VP1 protein and a monomeric ferritin subunit, and a duck hepatitis A vaccine prepared from the nanoparticle antigen, belonging to the field of preparation and application of duck hepatitis A vaccines. Background Art

[0002] Duck viral hepatitis (DVH) is an acute, highly lethal infectious disease caused by duck hepatitis A virus (DHAV), primarily affecting young ducklings within 14 weeks of age. Symptoms of the disease in infected ducklings include lethargy, convulsions, ataxia, and a head tilted back in an opisthotonic state. DHAV belongs to the Picornaviridae family, Hepacivirus genus, and is categorized into DHAV-1 (classic genotype A), DHAV-2 (genotype B, found only in Taiwan Province of China), and DHAV-3 (genotype C, originally discovered in South Korea). Currently, DHAV-1 and DHAV-3 are the predominant strains circulating in China.

[0003] Existing virus-like particle vaccines targeting DHAV primarily utilize two proteins within the P1 protein, VP1 and VP0, with VP1 being the predominant protein. As the primary protective protein of DHAV, VP1 encodes the primary antigenic site and possesses the primary specific neutralization site. Furthermore, a comparison of the VP1 proteins of DHAV-1 and DHAV-3 strains reveals significant differences, including insertions and deletions, point mutations, and continuous variations. Some researchers have explored new approaches to developing subgenic vaccines by monitoring VP3 expression or 3C protein hydrolysis.

[0004] Natural ferritin consists of an inner core and an outer shell. Ferritin found in bacteria, plants, and animals is composed of 24 subunits, with three subunits forming a trimer subunit. Eight trimers form a spherical cage structure with an outer diameter of 12 nm and an inner diameter of 8 nm. Ferritin is also very stable, withstanding high temperatures and various denaturants without affecting its native protein structure. Ferritin's ability to be modified chemically and genetically makes it an ideal multifunctional nanocarrier. Its highly ordered repeating antigens, distributed at intervals of 5-10 nm on the surface of microorganisms, readily induce strong T cell-dependent antibody responses. Ferritin nanoparticles, self-assembled from 24 subunits, have been used to develop a duck hepatitis A vaccine, which would have important applications in the prevention and treatment of duck viral hepatitis. Summary of the Invention

[0005] One of the objectives of the present invention is to provide a fusion protein comprising the VP1 protein in the P1 protein of duck hepatitis A virus; The second object of the present application is to provide a unit point mutant or a multi-point mutant of the fusion protein. The third object of the present application is to provide a preparation method of the fusion protein or the unit point mutant or the multi-point mutant thereof. The fourth object of the present application is to provide an application of the fusion protein or the unit point mutant or the multi-point mutant thereof in preparing duck hepatitis A vaccine.

[0006] To achieve the above objects, the technical solutions adopted by the present application include: An aspect of the present application is to provide a fusion protein, which is obtained by connecting the C-terminal of VP1 protein of duck hepatitis A virus P1 protein and the N-terminal of monomeric ferritin subunit through a connecting sequence SGG.

[0007] The VP1 protein of duck hepatitis A virus P1 protein is selected from the 1-type duck hepatitis A virus P1 protein shown in the amino acid sequence number ACI02689.1 in GenBank database. The monomeric ferritin subunit is duck ferritin monomer, and the amino acid sequence thereof is shown in the amino acid sequence number P80145 in GenBank database.

[0008] In a preferred embodiment of the present application, the amino acid sequence of the fusion protein is shown in SEQ ID NO. 1. In order to improve the expression amount or expression efficiency of the fusion protein in the silkworm, the nucleotide sequence of the coding gene of the fusion protein is optimized and modified according to the codon bias of the silkworm, and various related parameters such as GC content, CpG dinucleotide content, codon bias, secondary structure of mRNA, stability of mRNA free energy, RNA instability gene sequence, and repetitive sequence which affect the transcription efficiency, translation efficiency and protein folding of the gene are optimized and designed, and the final translated protein sequence is kept unchanged. Finally, the optimized gene sequence shown in SEQ ID NO. 2 is obtained. According to the ELISA titer results of the gene expression product, it can be seen that the protein expression amount of the optimized gene is significantly improved compared with that before optimization.

[0009] Another aspect of the present application is to provide a unit point mutant or a multi-point mutant of the fusion protein.

[0010] In order to improve the titer of the fusion protein, the fusion protein is subjected to unit point mutation or multi-point mutation, and the unit point mutant or the multi-point mutant with obviously improved titer is screened from the mutants.

[0011] The present invention obtains multiple single-site mutants by subjecting the fusion protein with the amino acid sequence shown in SEQ ID NO.1 to amino acid single-site mutations of P12Q, L42V, S66H, T87G, M110A, L133Y, F164L, K189C or D203N; the present invention expresses these single-site mutants in a silkworm expression system, and according to the expression results, it can be seen that the titers of the expression products of the four single-site mutants obtained by subjecting the amino acid sequence shown in SEQ ID NO.1 to amino acid single-site mutations of L42V, M110A, L133Y or D203N are significantly improved, among which the titer of the mutant obtained by subjecting the amino acid sequence shown in SEQ ID NO.1 to amino acid single-site mutation of L133Y is the most significantly improved; on the basis of the single-site mutation, the present invention obtains the fusion protein with the amino acid sequence shown in SEQ ID NO.1 to amino acid single-site mutation of L133Y. Four multi-site mutants were obtained by multi-site mutation of the amino acid sequence shown in NO.1 using L42V-M110A-L133Y, L42V-M110A-D203N, L42V-L133Y-D203N, or M110A-L133Y-D203N. These multi-site mutants were expressed in a silkworm expression system. According to the expression results, the mutant obtained by multi-site mutation of the amino acid sequence shown in SEQ ID NO.1 using M110A-L133Y-D203N had the most significant improvement in potency.

[0012] The amino acid single-site mutant "P12Q" of the present invention indicates that the 12th amino acid of the amino acid sequence shown in SEQ ID NO.1 is mutated from P (proline) to Q (glutamine); the expressions of the remaining single-site mutations are similar.

[0013] The amino acid multi-site mutation "L42V-M110A-L133Y" described in the present invention means that the 42nd amino acid of the amino acids shown in SEQ ID NO.1 is mutated from L (leucine) to V (valine), the 110th amino acid is mutated from M (methionine) to A (alanine), and the 133rd amino acid is mutated from L (leucine) to Y (tyrosine); the expressions of the remaining multi-site mutants are deduced by analogy.

[0014] Another aspect of the present invention is to provide a method for preparing the fusion protein or a single-site mutant or multi-site mutant thereof.

[0015] Those skilled in the art can use conventional eukaryotic expression methods to express the coding gene of the fusion protein or its mutant in eukaryotic cells using a eukaryotic expression system to obtain a recombinant protein. These are all conventional technical means in the art.

[0016] In a preferred embodiment of the present application, the present application provides a method for preparing the fusion protein or the mutant thereof, which comprises: expressing the coding gene of the fusion protein or the mutant thereof in a silkworm expression system, collecting and purifying the expressed antigen; preferably, the coding gene of the fusion protein, or the unit point mutant or the multi-site mutant thereof, or the mutant coding gene is constructed into a silkworm baculovirus expression vector to infect silkworm cells to obtain a recombinant silkworm baculovirus; the recombinant silkworm baculovirus is amplified in silkworm cells and then expressed in silkworms or silkworm pupae.

[0017] Or the coding gene of the fusion protein or the mutant thereof is expressed in an insect cell eukaryotic expression system, and the expressed antigen is collected and purified; preferably, the coding gene of the fusion protein or the mutant thereof is cloned into a baculovirus recombinant vector to construct a recombinant baculovirus recombinant vector; the baculovirus recombinant vector is co-transfected with baculovirus DNA into insect cells to obtain a recombinant baculovirus; the recombinant baculovirus infects insect hosts or insect cells, and the infected insect cells or insect hosts are cultured to express the corresponding antigen, which is purified.

[0018] In the present application, the expression product of the mutant coding gene of the fusion protein in the silkworm expression system is observed by electron microscopy after preliminary purification, and the observation result shows that the product size is consistent with the expected nanometer particles, and the diameter of the cage body is about 12 nanometers.

[0019] Animal experiments and virus neutralization experiments prove that the fusion protein prepared by the present application and the unit point mutant or the multi-site mutant of the fusion protein are used to immunize mice, and the immunization result shows that the neutralizing antibody titer caused by duck hepatitis A virus is high, and the duck hepatitis A virus has a significant prevention and treatment effect.

[0020] Still another aspect of the present application is that the fusion protein, the unit point mutant or the multi-site mutant of the fusion protein is applied to prepare a duck hepatitis A vaccine, which comprises: a therapeutically effective amount of the fusion protein, or the unit point mutant or the multi-site mutant of the fusion protein is mixed with a medically acceptable immunoadjuvant or carrier to obtain a duck hepatitis A vaccine.

[0021] Therefore, the present application provides a duck hepatitis A vaccine, which comprises an antigen and a medically acceptable immunoadjuvant or carrier; wherein the antigen is the fusion protein shown in SEQ ID NO. 1; or the antigen is the unit point mutant or the multi-site mutant of the fusion protein shown in SEQ ID NO. 1.

[0022] Compared with the prior art, the present application mainly has the following advantages and effects: 1. The present application utilizes silkworm baculovirus and insect cell eukaryotic expression system to express recombinant protein vaccine, and the vaccine preparation process does not involve live harmful viruses, compared with the traditional attenuated live vaccine method, the operation is safer and simpler, and large-scale production is suitable.

[0023] 2. The duck hepatitis A vaccine prepared from the nanoparticle antigen provided by the present application can induce duck hepatitis A virus antibodies with broad-spectrum properties, and lays a foundation for preparing a duck hepatitis A vaccine.

[0024] Definitions of terms used in this invention Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0025] The terms "antigen" and "immunogen" are used interchangeably and refer to a molecule, substance, protein, glycoprotein, or live virus capable of inducing a specific humoral (antibody) and cellular immune response.

[0026] The term "antigenicity" refers to the ability of an antibody to react or bind with a specific antigen; the term "immunogenicity" refers to the ability of an antigen or vaccine to induce a specific immune response; the term "immune response" refers to a humoral or antibody-mediated and cell-mediated immune response to an antigen, vaccine, or infectious agent; the term "vaccine" refers to a composition comprising an antigen for therapeutic treatment or prophylactic immunization against an infectious or non-infectious disease; the term "immunization" refers to an immune response generated by vaccination or infection that provides protection against an infectious or foreign agent; the term "recombinant protein or antigen" refers to a protein or antigen produced by recombinant DNA technology that can be used to clone and express genes in a variety of hosts including bacteria, mammalian cells, insect cells, and plants to produce proteins.

[0027] The term "potency" refers to the amount of antigen in an antigen preparation or vaccine as measured by a specified potency assay.

[0028] The terms "mutation" and "mutant" have their usual meaning herein and refer to a genetic, naturally occurring or introduced change in a nucleic acid or polypeptide sequence, and have the same meaning as is generally known to those in the art.

[0029] The term "host cell" or "recombinant host cell" means a cell which contains a polynucleotide of the present application, regardless of the manner in which the cell was modified to contain the polynucleotide, e.g., by direct uptake, transduction, f-pairing, or other methods known in the art. The exogenous polynucleotide can be maintained as a non-integrated vector, e.g., a plasmid, or can be integrated into the host genome.

[0030] The term "transfection" refers to the process by which a eukaryotic cell acquires new genetic markers as a result of the incorporation of foreign DNA. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 Figure 4 is a Western Blotting detection chart of the expression product of DHAV VP1-FE in the silkworm expression system; wherein lane 1 is Marker, lane 2 is the expression product of DHAV VP1-FE in the silkworm expression system, and lane 3 is negative control.

[0032] Figure 2 Figure 5 is an electron microscope chart of the expression product of DHAV VP1-FE-X-Y-Z in the silkworm expression system. DETAILED DESCRIPTION

[0033] The advantages and features of the present application will become more apparent with the following description of specific experimental examples. However, these experimental examples are only exemplary and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that the details and forms of the technical solutions of the present application can be modified or replaced without departing from the spirit and scope of the present application, and such modifications or replacements all fall within the protection scope of the present application.

[0034] 1. Test materials and reagents 1.1 Vectors, virus strains, cells and experimental animals The recombinant vector pBR, E. coli The strains TOP10, BmN cells and Vero cells were preserved and provided by the Institute of Biotechnology, Chinese Academy of Agricultural Sciences; the test silkworm variety JY1 was provided by the Sericultural Institute of Jiangsu University of Science and Technology, and the parent virus BmBac DNA was constructed according to the method disclosed in the literature (CN 102286534 A).

[0035] The animal experiment of the nano-vaccine constructed by fusing duck hepatitis A virus with ferritin was carried out in an isolated laboratory.

[0036] 1.2 Preparation of related solutions and media The preparation method of the related solutions and media refers to the relevant tool books (Joseph et al., Molecular Cloning Laboratory Guide, Third Edition, 2002; O'Sullivan et al., Concise Guide to Molecular Biology, 1998).

[0037] Experimental Example 1 Preparation and detection of nano-particle antigen after amino acid unit point mutation of DHAV VP1-FE 1. Synthesis of DHAV VP1 gene sequence The C-terminus of VP1 protein was connected to the N-terminus of ferritin with the first 18 amino acids removed through a linker to obtain the original fusion protein sequence, and further OptimumGene TM The technology is used to optimize the amino acid sequence of the fusion protein (whose amino acid sequence is shown in SEQID NO.1), and the nucleotide sequence of the optimized sequence is modified according to the codon preference of silkworm. The GC content, CpG dinucleotide content, codon preference, mRNA secondary structure, mRNA free energy stability, RNA instability gene sequence, repetitive sequence and other related parameters that affect gene transcription efficiency, translation efficiency and protein folding are optimized and designed, while keeping the final translated protein sequence unchanged.

[0038] In order to improve the translation initiation and termination efficiency of the target gene, the Kozak sequence ATCAAC was added in front of the gene, and the stop codon was changed to TAA. The restriction enzyme sites that affect the operation in the gene sequence were removed, and the Bam HI, add downstream of the gene Eco RI restriction enzyme cutting site for subsequent cloning into the eukaryotic recombinant vector pBR. The optimized nucleotide sequence is shown in SEQ ID NO. 2. The optimized gene sequence was synthesized and inserted into the pUC57 vector to form the plasmid pUC57-VP1-FE.

[0039] 2. Expression of DHAV VP1-up in a prokaryotic expression system and preparation of polyclonal antibodies In order to qualitatively and quantitatively verify the antigen samples expressed in the eukaryotic expression system, polyclonal antibodies were prepared using a prokaryotic expression system. A portion of VP1 containing the antigen epitope was selected for synthesis and named VP1-up. Its amino acid sequence is shown in SEQ ID NO.3, and its nucleotide sequence is shown in SEQ ID NO.4. The synthetic gene was cloned into the expression vector pET28a.

[0040] The His-VP1-up protein was expressed and purified according to the general method for prokaryotic expression of target proteins in Escherichia coli. The expression level was 579 μg / mL after determination by the BCA method. Polyclonal antibodies were obtained after immunization of mice for subsequent protein qualitative and quantitative experiments.

[0041] 3 Construction of VP1-FE single-site mutant gene With VP1-FE as a template, a plurality of primers are designed to carry out site-directed mutation by using fusion PCR method. The method of fusion PCR is described in reference to the method described in Qiang Feting et al. (A new method for vector construction: recombination fusion PCR method, Genomics and Applied Biology, 2012, Vol. 31, No. 6, pp.634-639). A large number of mutation experiments are carried out in the present application, and only the mutation sites with obvious mutation effects are described in detail, and the same below. The mutation sites of single site mutation are P12Q, L42V, S66H, T87G, M110A, L133Y, F164L, K189C, D203N; the obtained mutants are named as VP1-FE-P12Q, VP1-FE-L42V, VP1-FE-S66H, VP1-FE-T87G, VP1-FE-M110A, VP1-FE-L133Y, VP1-FE-F164L, VP1-FE-K189C, VP1-FE-D203N, respectively.

[0042] Primer required for amino acid single site mutation of VP1-FE: (1) Upper and lower upstream primers: F: GCGGATCCATCAACATGGGTGATAG (SEQ ID NO. 5); R: CGGAATTCTTAGGACTCGCTGCT (SEQ ID NO. 6); (2) Middle upstream and downstream primers (only primers with obvious mutation effects are listed): 1. F: GGCGACGATGAACAGGTGTGC (SEQ ID NO. 7); 1. R: TTCAGGAAGCACACCTGTTCATCGT (SEQ ID NO. 8); 2. F: CCGTCAATGGGTCGTGCGTAC (SEQ ID NO. 9); 2. R: GTACGCACGACCCATTGACGG (SEQ ID NO. 10); 3. F: ATCAAGGCCACGCGCACC (SEQ ID NO. 11); 3. R: AAACGCAGCAGGTGCGC (SEQ ID NO. 12); 4. F: AACAACGGCGGCACCCC (SEQ ID NO. 13); 4. R: CGGGGTGCCGCCGTT (SEQ ID NO. 14); 5.F: TGACCGCTGCGGGTGGCATTCT (SEQ ID NO.15); 5.R: AGAATGCCACCCGCAGCGGTCA (SEQ ID NO.16); 6.F: GTGACCCCGTATCGTCCGACC (SEQ ID NO.17); 6.R:GGTCGGACGATACGGGGTCAC (SEQ ID NO.18); 7. F: GTGAGCGTTTTGATGGGCCTGCAC (SEQ ID NO. 19); 7.R: GTGCAGCCCATCAAAACGCTCAC (SEQ ID NO. 20); 8.F: ACACCCTGCTGAACTGCATTGAAACCATGAA (SEQ ID NO. 21); 8.R: TTCATGGTTTTCAATGCAGTTCAGCAGGGTGT (SEQ ID NO. 22); 9.F: AGCGACCAACCGAATTGCCACCT (SEQ ID NO.23); 9.R: ATTTCGCACAGGTGGCAATTCGGTTG (SEQ ID NO. 24); The recombinant product was transformed into E. coli competent cells TOP10, colonies were selected for culture, plasmids were extracted, and Bam HI and Eco Positive clones were identified by RІ double enzyme digestion, and the correctly identified recombinant plasmids were sequenced. The correctly sequenced plasmids were named as follows: pUC57-VP1-FE-P12Q, pUC57-VP1-FE-L42V, pUC57 -VP1-FE-S66H, pUC57 -VP1-FE-T87G, pUC57 -VP1-FE-M110A, pUC57 -VP1-FE-L133Y, pUC57 -VP1-FE-F164L, pUC57-VP1-FE-K189C, and pUC57 -VP1-FE-D203N (hereinafter referred to as "pUC57-VP1-FE-X").

[0043] 4 Construction and identification of DHAV VP1-FE and VP1-FE-X recombinant vectors Plasmids pUC57-VP1-FE and pUC57-VP1-FE-X were Bam HI and EcoAfter double digestion, agarose gel electrophoresis was performed. The target fragment was recovered using a TIANgel DNA recovery kit, and the target fragment was ligated into the same enzyme-treated vector pBR using T4 DNA ligase. The plasmid correctly identified by enzyme digestion and sequencing was named pBR-VP1-FE and pBR-VP1-FE-X.

[0044] 5. Recombinant protein expression and preliminary purification in the silkworm eukaryotic expression system 5.1 Construction and acquisition of recombinant silkworm baculovirus rBmBacmid-VP1-FE and rBmBacmid-VP1-FE-X About 1×10 6 The silkworm cells (BmN) were inoculated in 15 cm 2 After the cells adhered, the culture medium containing fetal bovine serum (FBS) was removed, and the cells were washed three times with a culture medium without FBS, and 1.5 mL of the culture medium without FBS was added. 1 µg of the silkworm baculovirus parent strain BmBcmid DNA (CN 102286534 A), 2 µg of the recombinant transfer plasmid, and 5 µL of liposomes were sequentially added to a sterile tube, and the volume was made up to 60 µL with sterile water, and then the mixture was gently mixed and incubated for 15 min, and then the mixture was added dropwise to the culture bottle for co-transfection. After 4 h of culture at 27°C, 1.5 mL of the culture medium without serum and 300 µL of FBS were added. The cells were cultured at 27°C for 4-5 days, and the supernatant was collected for screening of the recombinant virus. An appropriate amount of cells (about 70-80%) were inoculated in a 35 mm petri dish, and after the cells adhered, the culture medium was removed, and the co-transfection supernatant was diluted at different concentrations, and 1 mL of the co-transfection liquid was added to the adherent cells and evenly distributed. After 1 h of infection at 27°C, the infection liquid was removed, 2% low-melting-point agarose gel was melted in a 60°C water bath, and then cooled to 40°C and mixed with 2×TC-100 culture medium (containing 20% FBS) preheated at 40°C. Each petri dish was added with 4 mL of the gel, and then the petri dish was sealed with Parafilm after solidification. The petri dish was cultured at 27°C for 3-5 days, and the plaques formed by the recombinant virus were observed under a microscope. The plaques with good morphological separation were selected, and the above steps were repeated for 2-3 rounds of purification to obtain the pure recombinant silkworm baculovirus rBmBacmid-VP1-FE and rBmBacmid-VP1-FE-X.

[0045] 5.2 Identification of the recombinant virus The integration of the foreign gene was analyzed by PCR method, and the extraction method of the free virus genome DNA was as follows: 150 μL of virus supernatant was mixed with 150 μL (0.5 mol / L) of NaOH, and then 20 μL (8 mol / L) of ammonium acetate was added. After mixing, equal volume of phenol and chloroform were extracted once, and the DNA was dissolved in 20 μL of TE after alcohol precipitation. 1 μL of the virus genome DNA was taken for PCR amplification, and the results proved that the recombinant virus was obtained. 5.3 Expression of the recombinant virus in silkworm and pupa The silkworm pupa used was high expression variety JY1 (preserved in the laboratory of the inventor). The silkworm of JY1 variety was bred according to the conventional method of "Chinese Sericulture" edited by Lv Hongsheng (Shanghai Scientific and Technical Publishing House, 1991). After feeding, 48 h, silkworms with the same average weight and 15 silkworm pupae with the same average weight after cocooning for seven days were selected, and each silkworm pupa and silkworm was inoculated with about 1.0 x 10 5 pfu rBmBacmid-VP1-FE, rBmBacmid-VP1-FE-X, 4-5 d after collection of sick silkworm pupae and silkworm blood, and stored at -20°C for ELISA detection.

[0046] 6 Western blotting detection The blood lymph of the silkworm infected with the recombinant virus was diluted 10 times with PBS (pH 7.4) and broken by ultrasonic wave, and then subjected to SDS-PAGE gel electrophoresis, with the concentration of the concentrated gel being 5% and the concentration of the separation gel being 15%. Then, the protein was transferred to a polyvinylidene fluoride (PVDF) membrane by semi-dry transfer method, blocked with 3% BSA prepared by PBST, and the serum of the mouse immunized with the His-VP1-up protein expressed in prokaryotic cells was used as the primary antibody (diluted 1:1000), and the HRP-labeled goat anti-mouse IgG was used as the secondary antibody (diluted 1:5000). Finally, DAB (diaminobenzidine) was used for color development, and deionized water was used for termination, and the detection results were obtained. The Western blotting results showed that the recombinant expression product could detect a specific band of 40 kDa in size Figure 1 ).

[0047] 7 ELISA detection The silkworm hemolymph sample to be tested was diluted in coating buffer in appropriate serial dilutions. A blood sample from a silkworm infected with the parental virus was also prepared as a negative control. 100 µL of this solution was added to each well of the ELISA plate and incubated at 4°C overnight. The liquid in the wells was quickly discarded and the plates were washed three times with PBST. 300 µL of 3% BSA blocking solution was added to each well and incubated at 37°C for 3 h, followed by washing three times with PBST. Serum from mice immunized with prokaryotically expressed His-VP1-up protein was diluted 1:1000 and added to each well. The plates were incubated at 37°C for 1.5 h, followed by washing four times with PBST. 100 µL of HRP-conjugated goat anti-mouse (1:5000) was added to each well and incubated at 37°C for 45–60 min, followed by washing four times with PBST. 100 µL of freshly prepared OPD (o-phenylenediamine) colorimetric solution was then added and the plates were developed in the dark at room temperature for 10–30 min. The reaction was terminated by adding 50 µL of 2M sulfuric acid to each well. The OD value was measured on a microplate reader at a wavelength of 492 nm, and the OD value of each well was measured after adjusting the blank control well to zero.

[0048] ELISA result judgment criteria: A P / N value (OD value of the positive well minus the OD value of the blank control well / OD value of the negative well) greater than or equal to 2.1 is considered positive, and the highest single-site mutant ELISA value is approximately 2400.

[0049] Table 1 ELISA titer and expression level of silkworm expression products (only mutations with significant effects are listed)

[0050] From the data in Table 1 , it can be seen that the expression levels of four single mutants (VP1-FE-L42V, VP1-FE-M110A, VP1-FE-L133Y, and VP1-FE-D203N) among the obtained single-site mutants were significantly improved, among which VP1-FE-L133Y had the highest expression level, reaching 434 μg / mL.

[0051] Experimental Example 2 Preparation and Detection of Nanoparticle Antigens after Multiple Amino Acid Mutations of DHAV VP1-FE-X 1 Construction of VP1-FE-X amino acid sequence multi-site mutant genes Based on the results of Experimental Example 1, some effective mutation sites were identified. Considering that the order of amino acids is the primary structure of the protein and determines its higher-order structure, and that the positions of some mutation sites in the single-site amino acid mutations performed in Experimental Example 1 may be interrelated, we attempted multi-site amino acid mutagenesis. Multi-site mutagenesis was performed based on the single-site mutation sequence obtained in Experimental Example 1. Using the codon-optimized gene sequence of VP1-FE-X as a template, and using corresponding primers (see Experimental Example 1 for details), site-directed mutagenesis at the second and third positions was performed via fusion PCR. Site-directed mutagenesis was performed using the same fusion PCR method as in Experimental Example 1.

[0052] The multi-site mutation sites are: L42V-M110A-L133Y, L42V-M110A-D203N, L42V-L133Y-D203N, M110A-L133Y-D203N; the obtained multi-site mutants are named: VP1-FE-L42V-M110A-L133Y, VP1-FE-L42V-M110A-D203N, VP1-FE-L42V-L133Y-D203N, VP1-FE-M110A-L133Y-D203N.

[0053] 2 Construction and identification of VP1-FE-XYZ recombinant vector The recombinant product was transformed into E. coli competent cells TOP10, colonies were selected for culture, and plasmids were extracted. Bam HI and Eco Positive clones were identified by RІ double enzyme digestion, and the correctly identified recombinant plasmids were sequenced. The correctly sequenced plasmids were named as follows: pBR-VP1-FE-L42V-M110A-L133Y, pBR-VP1-FE-L42V-M110A-D203N, pBR-VP1-FE-L42V-L133Y-D203N, and pBR-VP1-FE-M110A-L133Y-D203N.

[0054] The specific experimental method is the same as that of Experimental Example 1.

[0055] 3. Expression and purification of recombinant proteins in the silkworm eukaryotic expression system The specific experimental method is the same as that of Experimental Example 1.

[0056] 4 Western blotting The specific experimental method is the same as that of Experimental Example 1.

[0057] Western blotting results showed that a specific band of 40 kDa could be detected in the supernatant of the hemolymph samples of silkworms infected with the recombinant virus (see Figure 2 ).

[0058] 5 ELISA test The specific experimental method was the same as that of Experimental Example 1. The ELISA results showed that the highest multi-mutant ELISA value was about 2800.

[0059] Multi-site mutagenesis was performed based on single mutations to obtain four multi-site mutants (VP1-FE-L42V-M110A-L133Y, VP1-FE-L42V-M110A-D203N, VP1-FE-L42V-L133Y-D203N, and VP1-FE-M110A-L133Y-D203N). As can be seen from the data in Table 2, the expression level of VP1-FE-M110A-L133Y-D203N was the highest, reaching 507 μg / mL.

[0060] Table 2 ELISA titer and expression level of silkworm expression products (only mutations with significant effects are listed)

[0061] 6 Electron microscopy observation A 1mL syringe was used to draw a certain amount of 1% uranyl acetate for use. A separate syringe was used to draw a certain amount of distilled water. After preliminary purification of silkworm hemolymph, VP1-FE-XYZ (VP1-FE-L42V-M110A-L133Y, VP1-FE-L42V-M110A-D203N, VP1-FE-L42V-L133Y-D203N, and VP1-FE-M110A-L133Y-D203N) nanoparticles were diluted with the suspension solution. The suspended sample was dropped onto Parafilm to form a small drop. The sample was then picked up by gripping the grid with the membrane facing down with the tip of tweezers. The sample was then blotted dry with filter paper and washed to remove excess suspended matter. This was repeated five times. After blotting, place the grid on a drop of 1% uranyl acetate stain solution and stain for 3 minutes. Use filter paper to absorb excess stain from the edge of the copper grid. Repeat 2-3 times. After drying, examine under a microscope. The results are as follows: Figure 2 shown.

[0062] Experimental Example 3 Animal Experiment and Virus Neutralization Experiment 1. Inoculate animals with the expression products VP1-FE, VP1-FE-L133Y, and VP1-FE-M110A-L133Y-D203N of the silkworm eukaryotic expression system. The silkworm pupa expressed target protein is quantitatively tested, and each type of vaccine is prepared according to the equal molar ratio of the target protein amount to immunize animals. The preparation method is as follows: the crude product containing the corresponding expression amount of antigen or nanoparticle antigen is weighed, 90 mL of PBS buffer is added, and the stirrer is stirred for 5-10 min to mix thoroughly, and the mother liquor is placed in a sterilized bottle. The 206 adjuvant is sterilized in advance and placed in a 30°C incubator. The appropriate amount of mother liquor is placed on ice and adjusted. When mixed with the adjuvant, 3 mL of adjuvant is added to a 15 mL centrifuge tube, and the mother liquor is slowly added dropwise. The homogenizer is homogenized for 3 min. Ciprofloxacin hydrochloride is added. The vaccine is milky white, and a small amount is taken for quality inspection. The vaccine is not layered after centrifugation at 3000 rpm for 15 min. The same method is used to process healthy silkworm pupae to prepare a vaccine as a control.

[0063] Take 50 SPF mice and adaptively feed them for one week, then randomly divide them into 5 groups, 10 in each group. 10 mice are injected intraperitoneally with 1 portion (0.2 mL) of vaccines prepared from blank silkworm blood control, VP1-FE, VP1-FE-L133Y, VP1-FE-M110A-L133Y-D203N silkworm expression products, respectively; 10 mice are not immunized as normal control group. After 15 days of inoculation, about 1 mL of blood is taken from the eye socket, placed in a test tube and inclined, and then placed at 37°C for 2 h, and then transferred to room temperature overnight. The serum is transferred to a centrifuge tube, centrifuged at 2000 rpm for 10 min, and the serum is collected.

[0064] 2 ELISA detection The specific experimental method is the same as that of Experimental Example 1.

[0065] The prokaryotic expression protein VP1-up is used as a quantitative antigen, and the expression product with obvious mutation effect is selected for animal experiment to determine the antibody titer of the experimental animal. The results are shown in Table 3.

[0066] Table 3 Antibody titer detection of immunized mouse serum (21 days)

[0067] 3 Virus neutralization experiment The animal experiment serum of the expression product with obvious mutation effect is further subjected to neutralization experiment of the target virus. The serum to be tested is diluted with 2 times of serum-free DMEM medium. Then, equal amount of 100 TCID 50 of virus solution is added to each dilution of the serum to be tested, and then the mixed sample is placed in a 37°C incubator for 1 h. 200 μL of each mixed sample is inoculated into duck embryo. It is observed daily, and the neutralization titer of the serum to be tested is calculated according to the Reed-Muench method according to the mortality rate of the duck embryo. The detection results are shown in Table 4.

[0068] Table 4 Detection of neutralizing antibody titers in sera of immunized mice (21 days)

[0069] The results of immunization of mice showed that the titer of neutralizing anti-duck hepatitis A virus antibody caused by the mutant antigen was not lower than that of the control of serum of VP1-FE immunized mice.

Claims

1. A fusion protein, characterized in that The fusion protein is obtained by connecting the C-terminus of the VP1 protein of the duck hepatitis A virus P1 protein and the N-terminus of the monomeric ferritin subunit via a connecting sequence SGG.

2. The fusion protein according to claim 1, characterized in that The amino acid sequence of the fusion protein is shown in SEQ ID NO.

1.

3. The gene encoding the fusion protein according to claim 2, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.

2.

4. The mutant of the fusion protein according to claim 1 or 2, characterized in that The mutant is a single-site mutant obtained by mutating the fusion protein shown in SEQ ID NO.1 according to any one of P12Q, L42V, S66H, T87G, M110A, L133Y, F164L, K189C or D203N; or a multi-site mutant obtained by mutating the amino acid sequence shown in SEQ ID NO.1 according to any one of L42V-M110A-L133Y, L42V-M110A-D203N, L42V-L133Y-D203N or M110A-L133Y-D203N. The gene encoding the mutant according to claim 4 .

6. An expression vector containing the coding gene according to claim 3 or 5.

7. A method for preparing the fusion protein according to claim 1 or the mutant according to claim 4, characterized in that: include: expressing the coding gene of the fusion protein or the coding gene of the mutant in a silkworm expression system, and collecting and purifying the expressed antigen; Alternatively, the coding gene of the fusion protein or the mutant is expressed in an insect cell eukaryotic expression system, and the expressed antigen is collected and purified.

8. The method according to claim 7, characterized in that The fusion protein encoding gene or the mutant encoding gene is constructed into a Bombyx mori baculovirus expression vector and the vector is infected into Bombyx mori cells to obtain a recombinant Bombyx mori baculovirus; the recombinant Bombyx mori baculovirus is amplified in Bombyx mori cells and then expressed in Bombyx mori or silkworm pupae; Alternatively, the coding gene for the fusion protein or the coding gene for the mutant is cloned into a baculovirus recombinant vector to construct a recombinant baculovirus recombinant vector; the baculovirus recombinant vector and baculovirus DNA are co-transfected into insect cells to obtain a recombinant baculovirus; the recombinant baculovirus is infected with an insect host or insect cells, the infected insect cells or insect host are cultured to express the corresponding antigen, and the antigen is purified.

9. Use of the fusion protein according to claim 1, the mutant according to claim 4, or the encoding gene according to claim 3 or 5 in the preparation of a duck hepatitis A vaccine.

10. A duck hepatitis A vaccine comprising an antigen and a medically acceptable immune adjuvant or carrier, characterized in that: The antigen is the fusion protein according to claim 1 or the mutant according to claim 4.

Citation Information

Patent Citations

  • Insect bioreactors expressing multiple exogenous genes, their construction methods and applications

    CN102286534A

  • Korean novel duck hepatitis viral antibody ELISA (Enzyme-Linked Immunosorbent Assay) detection kit

    CN102127531A

  • Fusion protein antigen of duck hepatitis A virus-3 VP1 protein and LTB and application of fusion protein antigen

    CN104448005A

  • Self-assembled ferritin antigen nanoparticles, porcine circovirus vaccine prepared from antigen nanoparticles and application of antigen nanoparticles

    CN112316127A

  • Self-assembled ferritin-based nano antigen particles, O-type foot-and-mouth disease vaccine prepared from same and application

    CN112439056A

Cited By

  • Bovine I-type alpha interferon-ferritin fusion protein, and mutant, preparation method and application of bovine I-type alpha interferon-ferritin fusion protein

    CN121293376A