CRISPR (clustered regularly interspaced short palindromic repeats) Cas13a mutant as well as coding gene, expression plasmid, protein expression system and application thereof

Abstract

The invention is suitable for the technical field of bioengineering, and provides a CRISPR Cas13a mutant, and a coding gene, an expression plasmid, a protein expression system and application thereof. Compared with the wild type CRISPR Cas13a (Cas13a-WT), the amino acid residue at the 967th site of the amino acid sequence of the CRISPR Cas13a mutant Cas13a-Y967E is mutated into an amino acid which keeps the specificity of the amino acid sequence and has improved RNA (Ribonucleic Acid) shearing activity. The amino acid sequences of the Cas13a-WT and the Cas13a-Y967E are respectively as shown in SEQ ID NO. 1 and SEQ ID NO. 2, and the Cas13a-WT and the The RNA shearing activity of the Cas13a-Y967E is remarkably improved, the specificity of the Cas13a-Y967E is kept, target pathogens or disease biomarkers can be recognized and detected more accurately and efficiently in the fields of pathogen detection, disease diagnosis and treatment and the like, and missing detection and false detection are reduced.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of bioengineering, and particularly relates to a CRISPR Cas13a mutant, a coding gene thereof, an expression plasmid, a protein expression system and application. BACKGROUND

[0002] The CRISPR / Cas system is a breakthrough technology in the fields of medicine and biology, and is widely used in gene editing and molecular detection. Among them, Cas13a belongs to the VI type CRISPR system, which is initially called C2c2, which can specifically target and cut RNA molecules, and its working mechanism depends on the guidance of crRNA. When the crRNA and the target RNA sequence are accurately complementary paired, the Cas13a protein will be activated. The activated Cas13a not only shows strong ribonuclease activity, i.e. cis cleavage, but also non-specifically cuts other single-stranded RNA molecules in the surrounding environment, which is called collateral cleavage or trans cleavage. This feature becomes the core basis for Cas13a to be widely used in the fields of RNA editing, pathogen detection, gene therapy, disease treatment and biosensing.

[0003] However, the inherent cleavage efficiency of wild-type Cas13a limits its clinical application. The existing technology needs to rely on RPA, LAMP and other nucleic acid amplification methods to improve the sensitivity, which leads to the complication of the detection process and increases the risk of contamination. The current research focuses on optimizing the reaction system or inhibiting off-target effects, but there is still a significant gap in the development of mutants with enhanced activity and specificity. In view of this, the application provides a CRISPR Cas13a mutant, a coding gene thereof, an expression plasmid, a protein expression system and application. SUMMARY

[0004] The purpose of the application is to provide a CRISPR Cas13a mutant, a coding gene thereof, an expression plasmid, a protein expression system and application, which aims to solve the problems raised in the background art.

[0005] The purpose of the application is achieved by the following technical solutions:

[0006] A CRISPR Cas13a mutant Cas13a-Y967E has higher single-stranded RNA cleavage activity than wild-type CRISPR Cas13a and retains specific recognition function; it is obtained by mutating the 967th tyrosine (Y) of wild-type CRISPR Cas13a derived from microorganism Leptotrichia buccalis to glutamic acid (E); the amino acid sequence of the wild-type CRISPR Cas13a is shown as SEQ ID NO. 1, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 3; the amino acid sequence of the Cas13a-Y967E is shown as SEQ ID NO. 2.

[0007] An encoding gene of the CRISPR Cas13a mutant Cas13a-Y967E described above, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 4 or SEQ ID NO. 5.

[0008] A recombinant expression plasmid comprising the encoding gene described above.

[0009] A genetically engineered bacterium, including but not limited to E. coli BL21 (DE3), E. coli Rosetta (DE3) and the like, and comprising the recombinant expression plasmid described above.

[0010] A recombinant protein expression system of the CRISPR Cas13a mutant Cas13a-Y967E, including but not limited to bacterial, yeast, mammalian, insect and the like protein expression systems, and comprising the encoding gene described above.

[0011] A ribonucleoprotein complex (RNP) comprising the CRISPR Cas13a mutant Cas13a-Y967E and crRNA described above.

[0012] Use of the CRISPR Cas13a mutant Cas13a-Y967E or the ribonucleoprotein complex described above in the preparation of a kit for detecting RNA.

[0013] Further, the use of the kit comprises the following steps:

[0014] Step 1: Mix the CRISPR Cas13a mutant Cas13a-Y967E and crRNA, incubate at 20-40℃ for 10-40min to obtain a ribonucleoprotein complex;

[0015] Step 2: mix the ribonucleoprotein complex, the RNAse inhibitor, the reporter RNA, the target RNA to be detected and the reaction buffer to obtain a mixed solution; wherein:

[0016] The 5' end fluorescent group of the reporter RNA is FAM, and the 3' end quenching group is BHQ-1 or BHQ-3;

[0017] The final concentration of the ribonucleoprotein complex is 50-200 nM; the final concentration of the RNAse inhibitor is 0.5-1.5 U / mL; and the final concentration of the reporter RNA is 100-1000 nM;

[0018] Step 3: detect the fluorescence signal of the mixed solution, and determine the presence of the target RNA by the change of the fluorescence intensity.

[0019] Further, in step 2, the nucleotide sequence of the reporter RNA is poly (U), poly (A) or a combination of poly (U) and poly (A), and the base number of the poly (U), the poly (A) or the combination of poly (U) and poly (A) is 4-20.

[0020] A kit for detecting RNA comprises the CRISPR Cas13a mutant Cas13a-Y967E, the crRNA, the RNAse inhibitor, the reporter RNA and the reaction buffer as described above.

[0021] Compared with the prior art, the present application has the following beneficial effects:

[0022] The present application utilizes biological engineering technologies such as molecular biology, and mutates the wild-type CRISPR Cas13a (Cas13a-WT) from the microorganism Leptotrichia buccalis to obtain a CRISPR Cas13a mutant Cas13a-Y967E, wherein the amino acid residue at the 967th position is mutated to an amino acid that maintains its specificity but has improved RNA cleavage activity, and the coding gene, expression plasmid and protein expression system of the mutant are also provided. Studies have shown that Cas13a-Y967E has significantly improved RNA cleavage activity and maintains its specificity compared with Cas13a-WT. This improved mutant can improve the accuracy and efficiency of RNA detection, and is helpful for more accurately and efficiently identifying and detecting target pathogens or disease biomarkers in the fields of pathogen detection, disease diagnosis and treatment, etc., reducing missed detection and false detection, and providing a powerful tool for research in related fields. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1Agarose gel electrophoresis map of the mutant PCR product (M: 15000 bp DNA Marker; Lane 1: Cas13a-WT plasmid (9.434 kb); Lane 2: PCR product Control (6.7 kb); Lane 3: Cas13a-Y967E PCR product (should be 9.434 kb in theory)).

[0024] Figure 2 SDS-PAGE and Western Blot results of the Cas13a-WT cell disruption liquid and purified collected samples; wherein, A is the SDS-PAGE electrophoresis map of the Cas13a-WT cell disruption liquid and the sample after Ni affinity chromatography column purification (M: 200 kDa Protein Marker; Lane 1: supernatant after centrifugation of cell disruption liquid; Lane 2: 4-fold dilution of supernatant after centrifugation of cell disruption liquid; Lane 3: flow-through sample; Lane 4: 4-fold dilution of flow-through sample; Lane 5: elution unbound sample; Lane 6: 10% elution buffer B; Lane 7: 20% elution buffer B; Lane 8: 30% elution buffer B; Lane 9: 40% elution buffer B; Lane 10: 50% elution buffer B; Lane 11: 100% elution buffer B); B is the Western Blot map of the Cas13a-WT cell disruption liquid and the sample after Ni affinity chromatography column purification (M: 154 kDa Protein Marker; Lane 1: supernatant after centrifugation of cell disruption liquid; Lane 2: 4-fold dilution of supernatant after centrifugation of cell disruption liquid; Lane 3: 30% elution buffer B); C is the SDS-PAGE electrophoresis map of the sample after Cas13a-WT cation exchange chromatography column purification (M: 200 kDa Protein Marker; Lane 1: Ni column 30% elution buffer B; Lane 2: flow-through sample; Lane 3: elution unbound sample; Lane 4: 30% elution buffer D; Lane 5: 40% elution buffer D; Lane 6: 50% elution buffer D; Lane 7: 60% elution buffer D; Lane 8: 100% elution buffer D).

[0025] Figure 3SDS-PAGE and Western Blot results of Cas13a-Y967E bacterial cell lysate and purified sample collection; wherein, A and B are SDS-PAGE electrophoresis diagrams of Cas13a-Y967E bacterial cell lysate and sample after Ni affinity chromatography purification (M: 200 kDa Protein Marker; Lane 1: supernatant after centrifugation of bacterial cell lysate; Lane 2: supernatant after centrifugation of bacterial cell lysate diluted 5 times; Lane 3: flow-through sample; Lane 4: flow-through sample diluted 5 times; Lane 5: unbound elution sample; Lanes 6, 7: 10% elution buffer B; Lane 8: 20% elution buffer B; Lane 9: 30% elution buffer B; Lane 10: 40% elution buffer B; Lane 11: 50% elution buffer B; Lane 12: 60% elution buffer B; Lane 13: 100% elution buffer B); C is a Western Blot diagram of Cas13a-Y967E bacterial cell lysate and sample after Ni affinity chromatography purification (M: 154 kDa Protein Marker; Lane 1: Ni column 30% elution buffer B; Lane 2: Ni column 20% elution buffer B; Lane 3: supernatant after centrifugation of bacterial cell lysate diluted 4 times; Lane 4: supernatant after centrifugation of bacterial cell lysate); D is an SDS-PAGE electrophoresis diagram of Cas13a-Y967E sample after cation exchange chromatography column purification (M: 200 kDa Protein Marker; Lane 1: flow-through sample after one-time loading of Ni column 20% and 30% elution buffer B; Lanes 2, 3: flow-through sample after two-time loading; Lane 4: unbound elution sample; Lanes 5: 30% elution buffer D; Lanes 6: 40% elution buffer D; Lanes 7: 50% elution buffer D; Lanes 8: 60% elution buffer D; Lanes 9: 70% elution buffer D; Lanes 10: 100% elution buffer D).

[0026] Figure 4 Cas13a-WT and Cas13a-Y967E cleavage results on different concentrations of target RNA; wherein, A is the 1 hour background corrected fluorescence measurement of 100 pM target RNA cleavage experiment; B is the 1 hour background corrected fluorescence measurement of 200 pM target RNA cleavage experiment; C is the 1 hour background corrected fluorescence measurement of 400 pM target RNA cleavage experiment (in Figures A, B, C, the abscissa represents time, and the ordinate represents the background corrected fluorescence measurement value); D is the 1 hour end value of Figures A, B, C; E is the cleavage product percentage normalized to Cas13a-WT data of the 1h end value of Figures A, B, C. Data are expressed as Mean ± SD of 3 technical replicates, 2way ANOVA, n.s., not significant represents not significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; error bar represents standard deviation.

[0027] Figure 5 Non-specific cleavage results of Cas13a-WT and Cas13a-Y967E to different concentrations of Reporter RNA. Data are presented as Mean ± SD of 3 technical replicates, 2way ANOVA, n.s., not significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; error bars represent standard deviation.

[0028] Figure 6 Non-specific cleavage results of Cas13a-WT and Cas13a-Y967E to different concentrations of Reporter RNA. Data are presented as Mean ± SD of 3 technical replicates, 2way ANOVA, n.s., not significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; error bars represent standard deviation.

[0029] Figure 7 Specific cleavage results of Cas13a-WT and Cas13a-Y967E. Cas13a-WT and Cas13a-Y967E were combined with target RNAs with 1-4 pairs of continuous base pair mismatches to activate their cleavage activity. The vertical coordinate is the background-corrected fluorescence value of the reaction for 1 h, and the horizontal coordinate is the different groups. PM: perfectly complementary pairing; MM1: containing 1 pair of base pair mismatches; MM2: containing 2 pairs of continuous base pair mismatches; MM3: containing 3 pairs of continuous base pair mismatches; MM4: containing 4 pairs of continuous base pair mismatches; NC: negative control group. Data are presented as Mean ± SD of 3 technical replicates, 2way ANOVA, n.s., not significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; error bars represent standard deviation. DETAILED DESCRIPTION

[0030] In order to have a more clearly understanding of the technical features, objectives and beneficial effects of the present application, the technical solutions of the present application are described in detail as follows, but cannot be understood as limiting the implementable scope of the present application.

[0031] The specific implementation of the present application is described in detail in combination with specific examples. In the following examples, the experimental methods are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0032] Example 1, mutation of Cas13a

[0033] 1. Use Site-Directed Mutagenesis Kit (NEB) to carry out point mutation. The p2CT-His-MBP-Lbu_C2c2_WT (Addgene) plasmid containing the Cas13a-WT gene sequence (as shown in SEQ ID NO. 3) is used as a template for point mutation. The PCR upstream and downstream primers and reaction conditions are designed as follows:

[0034] Upstream primer: 5'-TTTAGTCGGAGAAACCTCAATTTGG-3' (as shown in SEQ ID NO. 6).

[0035] Downstream primer: 5'-CGATGTAAAATGCGCAGC-3' (as shown in SEQ ID NO. 7).

[0036] Table 1 reaction conditions

[0037]

[0038]

[0039] 2, after the reaction, a small amount of PCR product was taken for agarose gel electrophoresis to verify whether the target gene was successfully amplified. The results are shown in Figure 1 , the PCR product bands of Cas13a-WT plasmid and Cas13a-Y967E are in the correct position in the electrophoresis map, and the band is single without impurity band, which indicates that the PCR product of mutation is correct.

[0040] 3, the PCR product was subjected to Dpnl digestion and recombination. The reaction system is as follows, incubate at room temperature for 5 min.

[0041] Table 2 Dpnl digestion and recombination reaction system

[0042] Component Volume (μL) Final Concentration PCR product 1 / 2x KLD Reaction Buffer 5 1× 10x KLD Enzyme Mix 1 1× Nuclease-free Water 3 /

[0043] 4, the above reaction product was transformed into 50 μL competent cells E. coli DH5α, cultured in LB solid medium, picked single colony, cultured in LB liquid medium, sequenced and extracted plasmid, and obtained Cas13a-Y967E expression vector.

[0044] Example 2, induced expression of Cas13a-WT and Cas13a-Y967E

[0045] 1. Transform Cas13a-WT and Cas13a-Y967E expression vectors into E. coli BL21(DE3) competent cells, and culture overnight in LB solid medium. Pick several single colony strains, inoculate in 20 mL LB liquid medium (containing 50 μg / mL ampicillin sodium), and culture at 37°C, 180 r / min for 3-4 h, until the OD 600nm of the bacterial solution is 0.6.

[0046] 2. Take 10 mL of the bacterial solution and add it to 1 L of ampicillin-free LB liquid medium, and continue to culture at 37°C, 180 r / min for 3-4 h until the OD 600nm of the bacterial solution is 0.6. Add IPTG to a final concentration of 0.5 mM, and continue to culture at 16°C, 160 r / min overnight. Then centrifuge at 8000 r / min, 4°C for 30 min to collect the bacterial cells.

[0047] 3. Take 10 g of Cas13a-WT and Cas13a-Y967E bacterial cells, respectively, add 50 mL of lysis buffer (containing 50 mM Tris-Cl pH 7.0, 500 mM NaCl, 5% glycerol, 1 mM TCEP, 0.5 mM PMSF) to resuspend the bacterial cells, and use a high-pressure disrupter to lyse the bacterial cells. Centrifuge the lysed bacterial cells at 14000 r / min, 4°C for 30 min to collect the supernatant.

[0048] Example 3. Purification of Cas13a-WT and Cas13a-Y967E proteins

[0049] 1. Filter the Cas13a-WT supernatant and Cas13a-Y967E supernatant obtained in Example 2 through a 0.22 μm microporous filter.

[0050] 2. Ni affinity chromatography column purification: load the filtered supernatant into a chromatography column that has been equilibrated with binding buffer A (200 mM sodium phosphate, pH 7.0). After loading is complete, first wash the column with binding buffer A until the OD 280 of the eluate reaches the baseline value, and then perform gradient elution with elution buffer B (200 mM sodium phosphate, 500 mM imidazole, pH 7.0), and collect the eluate of different elution peaks. Perform SDS-PAGE electrophoresis and Western Blot detection on the elution components.

[0051] 3. Cation exchange chromatography purification: The eluate of Ni affinity chromatography column containing the target protein verified by SDS-PAGE electrophoresis and Western Blot was loaded into the chromatography column equilibrated with binding buffer C (50 mM Tris-Cl, 50 mM KCl, 1 mM TCEP, 5% glycerol, pH 7.0). After loading, the column was first washed with binding buffer C until the OD 280 baseline value, and then eluted with elution buffer D (50 mM Tris-Cl, 1 M KCl, 1 mM TCEP, 5% glycerol, pH 7.0) by gradient elution, and the eluate of different elution peaks was collected respectively. The elution components were detected by SDS-PAGE electrophoresis. The results are shown in Figure 2 A-C and Figure 3 A-D. The electrophoresis results show that in the elution components of the target proteins in Ni column affinity chromatography and cation exchange chromatography, the band positions of all target protein samples in SDS-PAGE electrophoresis and Western Blot results are correct, and the concentration of the target protein is high. The Western Blot results further confirm the specific enrichment of the target protein.

[0052] 4. The cation exchange chromatography eluate containing Cas13a-WT and Cas13a-Y967E verified by SDS-PAGE electrophoresis was used to replace the protein in the protein storage buffer (20 mM HEPES-K, 200 mM KCl, 1 mM TCEP, 10% glycerol, pH 7.0) by ultrafiltration.

[0053] 5. The concentrations of Cas13a-WT and Cas13a-Y967E proteins were determined by BCA method for standby use.

[0054] Example 4, in vitro transcription and purification of crRNA and target RNA

[0055] 1. The following crRNA and target RNA in vitro transcription DNA templates were synthesized by Jilin Kumai Biotechnology Co., Ltd.:

[0056] crRNA-1-DNA template:

[0057] 5'-TAATACGACTCACTATAGGGGGACCACCCCAAAAATGAAGGGGACTAAAACACAAATCTATCTGAATAAACTCTTCTTC-3' (as shown in SEQ ID NO. 8).

[0058] Target RNA-1-DNA template:

[0059] 5'-TAATACGACTCACTATAGGGGGGAAACCAAGAAGAAGAGTTTATTCAGATAGATTTGTCACAGCAGAAGCCCACAC-3' (as set forth in SEQ ID NO. 9).

[0060] 2. In vitro transcription: In vitro transcription was performed using HiScribe TM T7 Quick High Yield RNA Synthesis Kit (NEB). The operation was as follows: after the reaction system in Table 3 was added and mixed, it was incubated in a 37°C incubator overnight. 45 μL Nuclease-free Water and 3 μL DNase I (RNase-free) were added to the overnight transcription product, and it was incubated in a 37°C incubator for 15 min to remove residual template DNA.

[0061] Table 3 In vitro transcription reaction system

[0062] Component Volume (μL) Nuclease-free Water 6.5 NTP Buffer Mix 10 Template DNA 10 DTT (0.1 M) 1.5 T7 RNA Polymerase Mix 2

[0063] 3. Transcription product purification: 156 μL Buffer BX and 234 μL anhydrous ethanol were added to the transcription product, which was then transferred to a chromatography column, centrifuged at 16,000 g for 1 min, and the effluent was discarded; 500 μL Buffer WX was added, centrifuged at 16,000 g for 1 min, and the effluent was discarded; this was repeated once; the chromatography column was inserted into a new RNase-free 1.5 mL centrifuge tube, 50 μL Nuclease-free Water was added dropwise, and it was centrifuged at 16,000 g for 1 min, and the effluent was collected as the target RNA, which was immediately placed on ice. The sequence of the obtained RNA was as follows:

[0064] crRNA-1:

[0065] 5'-GGACCACCCCAAAAAUGAAGGGGACUAAAACACAAAUCUAUCUGAAUAAA CUCUUCUUC-3' (as set forth in SEQ ID NO. 10).

[0066] Target RNA-1:

[0067] 5'-GGGAAACCAAGAAGAAGAGUUUAUUCAGAUAGAUUUGUCACAGCAGAAGC CCACAC-3' (as set forth in SEQ ID NO. 11).

[0068] 4. Determine the concentration of the synthesized RNA and freeze it in a -80°C refrigerator.

[0069] Example 5, CRISPR-Cas13a in vitro fluorescence detection;

[0070] 1. Reporter RNA-1 was synthesized by Shanghai Sangon Biotechnology Co., Ltd. with the sequence 5'6-FAM-rUrUrUrUrUrU-3'BHQ-1 (the prefix "r" distinguishes whether the sequence is RNA or DNA. In this case, it is RNA, so "r" was added).

[0071] 2. Cas13a-WT and Cas13a-Y967E were respectively mixed with the crRNA-1 obtained in Example 4 at a concentration ratio of 1: 1, and incubated at 37 ° C for 30 min to form an RNP complex (Cas13a-WT-crRNA and Cas13a-Y967E-crRNA).

[0072] 3. The fluorescence detection system is as follows:

[0073] Table 4 Fluorescence detection system

[0074]

[0075] 4. Place the above system into a fluorescence microplate reader, set the excitation wavelength to 485 nm and the emission wavelength to 520 nm, read the value every 5 min at 37°C for a total of 13 times (accumulative 60 min) to detect changes in fluorescence intensity in the detection system.

[0076] 5. Result determination: If there is a statistically significant difference between the fluorescence intensity value of the test sample detection system and the fluorescence intensity value of the negative control within the same detection time, the test sample is determined to contain or is a candidate for containing the target RNA to be tested. Otherwise, the test sample does not contain or is a candidate for not containing the target RNA to be tested.

[0077] 6. Experimental results are as follows Figure 4 As shown, in the presence of 100 pM ( Figure 4 Middle A), 200pM( Figure 4 Middle B), 400pM( Figure 4 In the three systems with different concentrations of target RNA, the fluorescence intensity values ​​of Cas13a-Y967E were all greater than those of Cas13a-WT; by comparing their 1h endpoint fluorescence values ​​( Figure 4 D), the fluorescence intensity values ​​of Cas13a-Y967E and Cas13a-WT showed significant statistical differences; the percentage of cleavage products was analyzed by normalizing the 1h endpoint fluorescence values ​​relative to the data of Cas13a-WT ( Figure 4The fluorescence intensity value of Cas13a-Y967E is higher than that of Cas13a-WT. The Mean of Cas13a-Y967E in the system of 100 pM target RNA to be tested is 246.212, the Mean of Cas13a-Y967E in the system of 200 pM target RNA to be tested is 227.579, and the Mean of Cas13a-Y967E in the system of 400 pM target RNA to be tested is 180.29. The results show that the cleavage activity of Cas13a-Y967E is significantly stronger than that of Cas13a-WT, about 2 times.

[0078] Example 6, CRISPR-Cas13a non-specific detection;

[0079] 1. Cas13a-WT and Cas13a-Y967E were respectively incubated with crRNA-1 to form RNP.

[0080] 2. Different concentrations of Reporter RNA-1 were respectively added, and the in vitro fluorescence detection method was used, the operation was the same as in Example 5, and the detection system was as follows:

[0081] Table 5 Detection system

[0082] Component Volume (μL) Final Concentration RNP 1.75 100 nM RNase inhibitor 1.25 1 unit / mL Reporter RNA-1 1 50 nM / 100 nM / 200 nM / 400 nM / 800 nM Target RNA 1 100 pM Reaction Buffer 45 /

[0083] 3. The experimental results are shown in Figure 5 The fluorescence intensity increases with the increase of the concentration of Reporter RNA-1, and the fluorescence intensity of Cas13a-Y967E is significantly higher than that of Cas13a-WT in the presence of different concentrations of Reporter RNA-1, which further shows that the cleavage activity of Cas13a-Y967E is higher than that of Cas13a-WT, and the difference in activity between the two is more significant at high concentration of Reporter RNA-1.

[0084] 4. Two Reporter RNAs (Reporter RNA-2 and Reporter RNA-3) were synthesized. The sequence of Reporter RNA-2 is 5'6-FAM-rArArUrUrA-3' BHQ-1 (General Biological (Anhui) Co., Ltd.), and the sequence of Reporter RNA-3 is 5'6-FAM-rUrUrUrUrU-3' BHQ-3 (Shanghai Sangon Biological Engineering (Shanghai) Co., Ltd.). The in vitro fluorescence detection method was used, the operation was the same as in Example 5, different Reporter RNAs were used, and the non-specific cleavage of Cas13a-WT and Cas13a-Y967E was verified, and the results are shown in Figure 6The fluorescence intensity of Cas13a-Y967E was significantly higher than that of Cas13a-WT for different non-target RNAs, indicating that the RNA cleavage activity of Cas13a-Y967E was significantly higher than that of Cas13a-WT.

[0085] Example 7, CRISPR-Cas13a specific detection;

[0086] 1. Design four target RNAs with 1-4 nt mismatches in the region of nucleotides 9-12 of crRNA-1 (as shown in SEQ ID NO. 10) and with the sequence of target RNA-1 (as shown in SEQ ID NO. 11) as the completely complementary pairing sequence, as shown below:

[0087] Target RNA-2:

[0088] 5'-GGGAAACCAAGAAGAAGAGUUUAUUCAGAGAGAUUUGUCACAGCAGAAGCCACAC-3' (as shown in SEQ ID NO. 12);

[0089] Target RNA-3:

[0090] 5'-GGGAAACCAAGAAGAAGAGUUUAUUCAGCAAGAUUUGUCACAGCAGAAGCCACAC-3' (as shown in SEQ ID NO. 13);

[0091] Target RNA-4:

[0092] 5'-GGGAAACCAAGAAGAAGAGUUUAUUCAAGCAGAUUUGUCACAGCAGAAGCCACAC-3' (as shown in SEQ ID NO. 14);

[0093] Target RNA-5:

[0094] 5'-GGGAAACCAAGAAGAAGAGUUUAUUCCUUGAGAUUUGUCACAGCAGAAGCCACAC-3' (as shown in SEQ ID NO. 15).

[0095] 2. Prepare crRNA-1 and each target RNA, and the operation is the same as in Example 4.

[0096] 3. In vitro fluorescence detection, the operation is the same as in Example 5, and the concentration of target RNA-1 to target RNA-5 is 500 pM.

[0097] 4. The experimental results are as follows Figure 7As shown, Cas13a-WT has a significant difference with the NC group in detecting the target RNA with 1nt mismatch in the region of nucleotides 9-12 of crRNA-1, and Cas13a-Y967E has a significant difference with the NC group in detecting the target RNA with 1-2nt mismatch in the region of nucleotides 9-12 of crRNA-1, and maintains its specificity while improving the cleavage activity.

[0098] In summary, compared with Cas13a-WT, the cleavage activity of mutant Cas13a-Y967E is significantly improved and its specificity is maintained, and the mutant exhibits better comprehensive performance in RNA detection performance and has higher value in application fields such as pathogen detection and disease diagnosis and treatment.

[0099] The above is only a preferred embodiment of the present application, and it should be pointed out that for those skilled in the art, without departing from the concept of the present application, several modifications and improvements can be made, which should also be considered as the protection scope of the present application, and these will not affect the effect and practicality of the patent.

Claims

1. A CRISPR Cas13a mutant Cas13a-Y967E, characterized in that The Cas13a-Y967E has higher single-stranded RNA cleavage activity than the wild-type CRISPR Cas13a and maintains specific recognition function; it is obtained by mutating the tyrosine at position 967 of the wild-type CRISPR Cas13a derived from the microorganism Leptotrichia buccalis to glutamic acid; the amino acid sequence of the wild-type CRISPR Cas13a is shown in SEQ ID NO.1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.3; the amino acid sequence of the Cas13a-Y967E is shown in SEQ ID NO.

2.

2. A gene encoding the CRISPR Cas13a mutant Cas13a-Y967E as claimed in claim 1, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.4 or SEQ ID NO.

5.

3. A recombinant expression plasmid, characterized in that: Comprising the coding gene according to claim 2.

4. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria is E. coli BL21 (DE3) or E. coli Rosetta (DE3), and comprises the recombinant expression plasmid according to claim 3.

5. A recombinant protein expression system of a CRISPR Cas13a mutant Cas13a-Y967E, characterized in that The expression system is a bacterial, yeast, mammalian or insect protein expression system, and comprises the encoding gene according to claim 2.

6. A ribonucleoprotein complex, characterized in that Comprising the CRISPR Cas13a mutant Cas13a-Y967E and crRNA according to claim 1.

7. Use of the CRISPR Cas13a mutant Cas13a-Y967E as claimed in claim 1 or the ribonucleoprotein complex as claimed in claim 6 in the preparation of a kit for detecting RNA.

8. The use according to claim 7, characterized in that The use of the kit comprises the following steps: Step 1: Mix the CRISPR Cas13a mutant Cas13a-Y967E and crRNA and incubate at 20-40°C for 10-40 minutes to obtain a ribonucleoprotein complex; Step 2: Mixing the ribonucleoprotein complex, RNase inhibitor, reporter RNA, target RNA to be tested, and reaction buffer to obtain a mixed solution; wherein: The 5'-end fluorescent group of the reporter RNA is FAM, and the 3'-end quencher group is BHQ-1 or BHQ-3; The final concentration of the ribonucleoprotein complex is 50-200 nM; the final concentration of the RNase inhibitor is 0.5-1.5 U / mL; the final concentration of the reporter RNA is 100-1000 nM; Step 3: Detect the fluorescence signal of the mixed solution and determine the presence of target RNA by the change in fluorescence intensity.

9. The use according to claim 8, characterized in that In step 2, the nucleotide sequence of the reporter RNA is polyuracil, polyadenine, or a combination of polyuracil and adenine, and the number of bases in the polyuracil, polyadenine, or a combination of polyuracil and adenine is 4 to 20.

10. A kit for detecting RNA, characterized in that: Comprising the CRISPR Cas13a mutant Cas13a-Y967E according to claim 1, crRNA, an RNase inhibitor, a reporter RNA and a reaction buffer.

Images